ID: 1022462857

View in Genome Browser
Species Human (GRCh38)
Location 7:30627734-30627756
Sequence CTTGTTCAGAACCAAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022462857 Original CRISPR CTTGTTCAGAACCAAATTAC TGG (reversed) Intronic
901523649 1:9805256-9805278 ATTATTTAGAAGCAAATTACTGG + Intronic
901589303 1:10326624-10326646 CTTCTTCAGAACAAAATTACTGG - Intronic
907723415 1:56995724-56995746 CTTGTTTAGAATCAAATCATAGG + Exonic
908948591 1:69530249-69530271 CTTGATCAAAACAAAATCACAGG + Intergenic
910191718 1:84602064-84602086 CTTGTTAAGAAGCAGATTGCTGG - Intergenic
912051541 1:105535453-105535475 CTTGTTCTGAAACAAATTCCAGG - Intergenic
914728019 1:150344776-150344798 CTTGTTCAGAACTAATATTCTGG - Intronic
916598604 1:166270983-166271005 CTTGGTCAGAGTCACATTACTGG + Intergenic
916781719 1:168038637-168038659 CTTGTTAAGATGCATATTACTGG + Intronic
919177707 1:194039602-194039624 ATTGCTCAGAGTCAAATTACTGG - Intergenic
920092812 1:203466140-203466162 CTTGTTCAGAGCCAAATCACAGG - Intergenic
920241168 1:204551796-204551818 CTTGTTCAAATGCAAATTCCTGG - Exonic
923505785 1:234605968-234605990 CATGTTAAGAAGGAAATTACAGG + Exonic
1064413199 10:15126109-15126131 ATTGGTTAGAACCAAATCACAGG - Intronic
1064850693 10:19705939-19705961 CTTGTTCAGAGTCAAATGAGAGG + Intronic
1067551772 10:47241468-47241490 GTGGCTCAGAGCCAAATTACAGG - Intergenic
1069430120 10:68327096-68327118 CTGGTTCAGAATCAATTCACTGG + Intronic
1073713617 10:106075330-106075352 CTTGTTAAAACCCAGATTACTGG - Intergenic
1075644200 10:124086850-124086872 CTTGTTCAGAGCCACAGTAATGG + Intronic
1079762723 11:24351258-24351280 TTTATTCAGAACCAAAATAATGG - Intergenic
1083140737 11:60719041-60719063 CTTGTTCAAAAACAGATTGCTGG - Intergenic
1086290170 11:85299697-85299719 CTTGTTAAAAAACAGATTACTGG + Intronic
1086673618 11:89576871-89576893 TTTGTTTTGAAACAAATTACTGG - Intergenic
1087842356 11:102933532-102933554 TTTGTCCAGAACCAAATGAAGGG + Intergenic
1093470486 12:19496204-19496226 CTTGCTTAGAAACAAAGTACTGG + Intronic
1095761997 12:45850350-45850372 GTTGTTCAGAATCATAGTACAGG + Exonic
1097534033 12:60842664-60842686 GTTATTCAGGACCAAATGACTGG + Intergenic
1099277448 12:80595186-80595208 CTTGTTGAGAAACAAATTTTGGG - Intronic
1100240124 12:92702905-92702927 CTTTTTCATAAACAAATAACTGG + Exonic
1101623013 12:106408484-106408506 CTTGTTAAGACACAGATTACCGG - Intronic
1101825071 12:108213840-108213862 GGTGTTCTGAACCAAATTCCAGG - Intronic
1102774519 12:115507018-115507040 CTAATTCAGAACCACATTTCTGG + Intergenic
1105635200 13:22209741-22209763 CTTGTTTAAAACCTAATCACAGG - Intergenic
1106210195 13:27635171-27635193 CTTGTTAAGAACCCAAATAAAGG + Intronic
1106784981 13:33097868-33097890 CTTGTTTACAACCAAAATGCTGG + Intergenic
1107405457 13:40108229-40108251 CTTGTTAAAACCCAGATTACTGG + Intergenic
1110422809 13:75332568-75332590 CTTGTTGAAACCCAAATTACTGG + Intronic
1114890841 14:26920875-26920897 ATTATTTAGAAACAAATTACAGG + Intergenic
1115434909 14:33361224-33361246 TTTGGTCAGCAACAAATTACAGG - Intronic
1115478138 14:33835850-33835872 ATTGGTTAGAAGCAAATTACAGG + Intergenic
1117409267 14:55435886-55435908 TTTCTTCAGATCCAACTTACAGG + Exonic
1117812861 14:59567026-59567048 CTTGTTAAAACACAAATTACTGG - Intronic
1118178300 14:63464625-63464647 CTAATTCAGAACCAGATTCCAGG - Intronic
1118547783 14:66912992-66913014 CTTGTTAAGATACAGATTACTGG + Intronic
1123178525 14:106444847-106444869 TTTATATAGAACCAAATTACTGG - Intergenic
1125703239 15:41707458-41707480 ATTGATAAGAAACAAATTACAGG + Intronic
1127036630 15:54925728-54925750 CTTGTGAAGAACCACTTTACTGG + Intergenic
1127080035 15:55368662-55368684 CATTTTCAGAACCAAATACCTGG + Intronic
1129067803 15:72922074-72922096 CTTGTTCTGAAGCAACTTAGGGG + Intergenic
1131418975 15:92287675-92287697 CATGTCCACAACCAAATTCCTGG + Intergenic
1131600648 15:93845623-93845645 CTTGTTCAGATCAAAATCAACGG - Intergenic
1131601698 15:93855743-93855765 CTTGTTCAGAGCCAAACGCCAGG - Intergenic
1131763591 15:95651228-95651250 TTTGTTGAGCACCAAACTACAGG - Intergenic
1131807982 15:96142764-96142786 CTTGGTCAGATCCAAAATATGGG - Intergenic
1133477662 16:6138918-6138940 ATTGGTTAGAAGCAAATTACAGG + Intronic
1133522245 16:6569964-6569986 CTTCTTCTCAAACAAATTACCGG - Intronic
1133896700 16:9936261-9936283 CTTGTTAAGACACAAATTACTGG - Intronic
1138030926 16:53558877-53558899 CTACTTCAGAACCAAATGCCAGG - Intergenic
1144283345 17:13748757-13748779 CATGTTCTGAACCCAATCACTGG - Intergenic
1149292329 17:55229498-55229520 CATGTCCAAAACCAAATTCCTGG + Intergenic
1150665982 17:67138775-67138797 ATTTTTCAGACCCCAATTACTGG + Intronic
1153600776 18:6779428-6779450 CTTGGGCAGAACAAAATTGCAGG + Intronic
1155443264 18:25884260-25884282 CTTTATAAGAACCAAATTTCAGG + Intergenic
1157673802 18:49553042-49553064 CATGGTCAGAACAAATTTACAGG + Intergenic
1161675974 19:5649812-5649834 TTTTTTCAGAACTAAATTTCGGG + Intronic
1162354042 19:10169906-10169928 CTTGTTCTGAAACAAATTCGAGG + Intronic
1162570106 19:11466615-11466637 CTTGTCCCGAACCAACTTGCAGG + Exonic
1163444839 19:17340335-17340357 CTTAATCAGAACTAAATCACTGG - Intronic
929562741 2:42966059-42966081 CTTGTTCTTGAGCAAATTACAGG + Intergenic
931825717 2:65998407-65998429 CTTGACCAGAAAAAAATTACTGG + Intergenic
932631397 2:73346295-73346317 CTTGTTAAAATGCAAATTACTGG + Intergenic
933260865 2:80129749-80129771 CTTGTTCTGATCCACATAACTGG + Intronic
934099272 2:88636709-88636731 CTTCTTCATAACCAAACTCCAGG + Intergenic
935005003 2:99065519-99065541 CTTGTTCTTGACCAATTTACCGG + Intronic
935546188 2:104402136-104402158 CTTGTTCAGGACCACATTCTGGG - Intergenic
935933661 2:108157380-108157402 CTTGCTAAGAATCAAATTATTGG + Intergenic
937670557 2:124533347-124533369 CTTGTTAAAACACAAATTACTGG + Intronic
941132504 2:161670996-161671018 GTTGTTCAGTACCAAATTATTGG - Intronic
942798663 2:179850984-179851006 CTTCTTAAGAGGCAAATTACTGG - Intronic
945052932 2:205842661-205842683 CTTGTTAAAAACTAAATTAAAGG - Intergenic
946981069 2:225215978-225216000 TTTCTTCAGAACCAGTTTACAGG - Intergenic
947982254 2:234420496-234420518 CTTGTTTAGAACCACACTTCTGG - Intergenic
1169631765 20:7640545-7640567 CTTCTTCAAAACCAAATTTGAGG + Intergenic
1175678391 20:60966559-60966581 CTTGCTCAGAGACAAAGTACAGG + Intergenic
1178207828 21:30490088-30490110 CTTTTTCAGAACGAAAATAAAGG - Intronic
1179502256 21:41817350-41817372 CTTGTTCAGAATCACATCATGGG - Intronic
1184319538 22:43729817-43729839 CTTGGTGAAAATCAAATTACAGG + Intronic
949865525 3:8543921-8543943 CTTGATCAGTATGAAATTACAGG - Intronic
951143199 3:19193237-19193259 TGTGTTGAGCACCAAATTACAGG - Intronic
951313968 3:21165420-21165442 CTTGTTCAGAATCTTAATACTGG - Intergenic
954911738 3:54116519-54116541 CTTGTTCAGAACCGGAGTAAAGG + Intergenic
956645250 3:71448802-71448824 CAATTTCAGAACCAAATCACTGG + Intronic
962889620 3:139659962-139659984 CTTGTTAAGACCCAAGTTGCTGG - Intronic
963867717 3:150380132-150380154 CTTCTACTGAACAAAATTACTGG - Intergenic
964989853 3:162796046-162796068 CTTTTTCAAAAACAAAATACAGG - Intergenic
965699988 3:171450840-171450862 CATGTTCAGCACCACATTCCTGG - Intronic
966706255 3:182918284-182918306 CATGTTCAGATTCAAATTAAGGG - Exonic
966971111 3:185046329-185046351 CATATTCAGAAGCAAATTAGGGG - Intronic
971499371 4:27301634-27301656 CTTGTTGAGAACCAGAATAAAGG - Intergenic
972173080 4:36370868-36370890 CTTGATCAAAACAGAATTACAGG + Intergenic
977223532 4:94367315-94367337 CTTCTTCAGAACCAAAAATCAGG - Intergenic
978130530 4:105190885-105190907 CTTGTTAAGGACCAAATAAATGG + Intronic
980454165 4:133017696-133017718 CTTTTTCAAATCCAAATTACAGG - Intergenic
983754585 4:171319436-171319458 CTTATTCAGAAGGAAATCACAGG - Intergenic
983874169 4:172857023-172857045 CTGTTTCACAACCTAATTACAGG + Intronic
983880639 4:172928314-172928336 CTTGTTCAAAGCCACATAACTGG - Intronic
984373120 4:178892087-178892109 TTTGTTCATAACCTAATCACAGG - Intergenic
984403076 4:179291846-179291868 TTTGTTGAAAAGCAAATTACTGG - Intergenic
988407886 5:30847718-30847740 CTTGATCAAAACTAATTTACCGG - Intergenic
988835528 5:35028701-35028723 ACTGTTTAGAACCAAATAACAGG - Intronic
991573266 5:68077466-68077488 CTTGTTCAGACCCAAAATGGTGG + Intergenic
993313147 5:86363337-86363359 CTTGTTCAGAAACAAAAGCCTGG - Intergenic
994579033 5:101614963-101614985 GATTTTCAGAACCAAATTAGAGG + Intergenic
996662386 5:126019796-126019818 CTTGTTAAAAAACAAATCACTGG - Intergenic
996701961 5:126458726-126458748 CTGGCTCAGACCCAAATTACAGG - Intronic
996976459 5:129440443-129440465 CTTGGTCTGAACCACACTACCGG - Intergenic
997008198 5:129845343-129845365 CATTTTTAGAACCAACTTACTGG - Intergenic
997526391 5:134555708-134555730 CTGGTTCACAACCAAATTACAGG + Intronic
1001577167 5:172771746-172771768 CTTGCCCAGAACCACACTACTGG + Intergenic
1006767536 6:36521789-36521811 CTTGTTCAGAAGAAAGATACGGG - Exonic
1006885077 6:37374898-37374920 CTTGTTCAGAAGCAAAATGCTGG + Intronic
1008783336 6:55135172-55135194 CTTGTTCCAAACCCAATTAATGG - Intronic
1009227581 6:61033024-61033046 CATGTTATGAACCATATTACAGG + Intergenic
1009414800 6:63403848-63403870 ATTGTTTAGAAGCAAGTTACAGG - Intergenic
1010588880 6:77689460-77689482 CATTTTCAGTGCCAAATTACAGG + Intergenic
1021956711 7:25832470-25832492 TTTGTTCTGAACCAAATTTTTGG - Intergenic
1022462857 7:30627734-30627756 CTTGTTCAGAACCAAATTACTGG - Intronic
1028596679 7:92553497-92553519 CTTGTTCAAAAGCTAATTCCTGG - Intergenic
1033480075 7:141730917-141730939 CTTGTCCAAAGCCTAATTACAGG + Exonic
1036151118 8:6299576-6299598 CTTTTCCAGAAGCAAATTGCAGG - Intergenic
1036400800 8:8405969-8405991 ATTGTTCACAACCATTTTACAGG + Intergenic
1042529851 8:69803649-69803671 CTTGTTCAAACCCAGATTGCTGG - Intronic
1046418394 8:113945158-113945180 CTAGTTCAGAACCAGAACACAGG + Intergenic
1047315703 8:123731100-123731122 CTTGTTCAGATGCAGATTGCTGG + Intronic
1047468492 8:125143696-125143718 TTTGTTTAGGACCAAATTTCAGG + Intronic
1048011877 8:130464038-130464060 ATTGTACAGAACCAAGATACAGG + Intergenic
1050871279 9:10573446-10573468 CTTGTTCCTAACAAAATGACTGG - Intronic
1051446272 9:17142448-17142470 CTTGTTCAAAAAAAAATTATTGG - Intronic
1055420659 9:76137794-76137816 ATTGGTCAGAAGCAAAATACTGG - Intronic
1055756158 9:79559906-79559928 CTTGTTCAAATAAAAATTACTGG - Intergenic
1057831191 9:98408535-98408557 CTTCTTGAGAACCACCTTACTGG - Intronic
1058725586 9:107800621-107800643 CTTGTTGAAAAGCAAATTCCGGG + Intergenic
1059739943 9:117140356-117140378 CCTGATCAGAGCCAAGTTACAGG + Intronic
1059915044 9:119090037-119090059 CTTGTTAAGATCCAGATTGCTGG + Intergenic
1186438869 X:9567573-9567595 CTGGTGCAGCACCAAAATACTGG - Intronic
1187122119 X:16419711-16419733 CTTTTTCAGAACAATATTCCAGG + Intergenic
1187929694 X:24282596-24282618 CTTGGTCAGAACCACATTAATGG + Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1193167745 X:78301531-78301553 CTTGTTGAGAACCAGAATAAAGG - Intronic
1196153839 X:112405750-112405772 CTTTATAAGAACCAAAATACAGG + Intergenic
1196610649 X:117711017-117711039 TGGGTTCAGATCCAAATTACTGG - Intergenic
1196659398 X:118253840-118253862 CTTTTTCAGGACCAAAGTTCTGG - Intergenic
1197297058 X:124731834-124731856 CTTGTTCATAGCCATATTATGGG - Intronic
1197333168 X:125179775-125179797 CTTGTTGAGAAACAAATTGCTGG - Intergenic