ID: 1022463059

View in Genome Browser
Species Human (GRCh38)
Location 7:30630212-30630234
Sequence AAATATCACAAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022463055_1022463059 3 Left 1022463055 7:30630186-30630208 CCCTGTTACTCTCTTATATTAAA 0: 1
1: 0
2: 1
3: 22
4: 370
Right 1022463059 7:30630212-30630234 AAATATCACAAGATGGAGGAAGG No data
1022463056_1022463059 2 Left 1022463056 7:30630187-30630209 CCTGTTACTCTCTTATATTAAAT 0: 1
1: 0
2: 0
3: 23
4: 261
Right 1022463059 7:30630212-30630234 AAATATCACAAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022463059 Original CRISPR AAATATCACAAGATGGAGGA AGG Intronic
No off target data available for this crispr