ID: 1022464539

View in Genome Browser
Species Human (GRCh38)
Location 7:30644716-30644738
Sequence CCTACTTGTCACCACCTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022464532_1022464539 18 Left 1022464532 7:30644675-30644697 CCAGCCTGTCAACTCCACCTGCA No data
Right 1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG No data
1022464533_1022464539 14 Left 1022464533 7:30644679-30644701 CCTGTCAACTCCACCTGCACTCT No data
Right 1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG No data
1022464531_1022464539 30 Left 1022464531 7:30644663-30644685 CCATTTTTTTGTCCAGCCTGTCA No data
Right 1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG No data
1022464534_1022464539 4 Left 1022464534 7:30644689-30644711 CCACCTGCACTCTATATCAGAAT No data
Right 1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG No data
1022464535_1022464539 1 Left 1022464535 7:30644692-30644714 CCTGCACTCTATATCAGAATTGG No data
Right 1022464539 7:30644716-30644738 CCTACTTGTCACCACCTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022464539 Original CRISPR CCTACTTGTCACCACCTTCG TGG Intergenic
No off target data available for this crispr