ID: 1022465658 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:30651881-30651903 |
Sequence | GGTGTTTTTAAAATAGATGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022465652_1022465658 | 28 | Left | 1022465652 | 7:30651830-30651852 | CCTGTCTCAAAAAAAAAAAAAAA | 0: 13279 1: 16490 2: 27851 3: 54067 4: 109329 |
||
Right | 1022465658 | 7:30651881-30651903 | GGTGTTTTTAAAATAGATGAGGG | No data | ||||
1022465651_1022465658 | 29 | Left | 1022465651 | 7:30651829-30651851 | CCCTGTCTCAAAAAAAAAAAAAA | 0: 13494 1: 16907 2: 33917 3: 145359 4: 149502 |
||
Right | 1022465658 | 7:30651881-30651903 | GGTGTTTTTAAAATAGATGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022465658 | Original CRISPR | GGTGTTTTTAAAATAGATGA GGG | Intergenic | ||
No off target data available for this crispr |