ID: 1022465658

View in Genome Browser
Species Human (GRCh38)
Location 7:30651881-30651903
Sequence GGTGTTTTTAAAATAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022465652_1022465658 28 Left 1022465652 7:30651830-30651852 CCTGTCTCAAAAAAAAAAAAAAA 0: 13279
1: 16490
2: 27851
3: 54067
4: 109329
Right 1022465658 7:30651881-30651903 GGTGTTTTTAAAATAGATGAGGG No data
1022465651_1022465658 29 Left 1022465651 7:30651829-30651851 CCCTGTCTCAAAAAAAAAAAAAA 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
Right 1022465658 7:30651881-30651903 GGTGTTTTTAAAATAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022465658 Original CRISPR GGTGTTTTTAAAATAGATGA GGG Intergenic
No off target data available for this crispr