ID: 1022466389

View in Genome Browser
Species Human (GRCh38)
Location 7:30655532-30655554
Sequence GCCTCAGGAAAGCTCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022466379_1022466389 16 Left 1022466379 7:30655493-30655515 CCACGGGACCCCCTTAGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 189
1022466383_1022466389 7 Left 1022466383 7:30655502-30655524 CCCCTTAGTGAGGGCATGGCTGC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 189
1022466376_1022466389 22 Left 1022466376 7:30655487-30655509 CCAGTCCCACGGGACCCCCTTAG 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 189
1022466384_1022466389 6 Left 1022466384 7:30655503-30655525 CCCTTAGTGAGGGCATGGCTGCC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 189
1022466377_1022466389 17 Left 1022466377 7:30655492-30655514 CCCACGGGACCCCCTTAGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 189
1022466382_1022466389 8 Left 1022466382 7:30655501-30655523 CCCCCTTAGTGAGGGCATGGCTG 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 189
1022466385_1022466389 5 Left 1022466385 7:30655504-30655526 CCTTAGTGAGGGCATGGCTGCCA 0: 1
1: 0
2: 2
3: 6
4: 146
Right 1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022466389 Original CRISPR GCCTCAGGAAAGCTCACTGT GGG Intronic
901181396 1:7344286-7344308 GTGTCTGGAAAGCTCACTCTGGG - Intronic
902033288 1:13438524-13438546 GCTTCAGGAAAGATCACGGGAGG + Intergenic
902188561 1:14743931-14743953 GCTTCAGGAAACCTCATTCTTGG - Intronic
902492637 1:16796259-16796281 GCCTCAAGAGAGCTGACTGCAGG - Intronic
903036648 1:20497358-20497380 GCCTCTGGAATGCTCAAAGTTGG - Intergenic
907047134 1:51306152-51306174 GCCTCAGGTAAACTCCCTGGTGG + Intronic
907626298 1:56033526-56033548 GCTTCAGGAAAGCTCCATGGGGG - Intergenic
908446726 1:64204897-64204919 GCCCCAGGAATGTTCGCTGTTGG - Intronic
910975287 1:92900090-92900112 GCCTCAGGAAGGATCATTTTGGG + Intronic
911330906 1:96524777-96524799 GGTTCAGGAAAGCCAACTGTGGG - Intergenic
912259897 1:108100021-108100043 CCCTCATGAAAGATCATTGTCGG + Intergenic
919977712 1:202623481-202623503 GCCCCAGGACAGCTGCCTGTGGG - Intronic
920106543 1:203557306-203557328 GCATCATGAAAGCTCCATGTGGG - Intergenic
920528076 1:206683612-206683634 GCCCCAGGAAAGGACAGTGTTGG + Intronic
920880647 1:209877242-209877264 CCCTCAGGGAGGCTCACTGACGG + Intergenic
922077484 1:222262023-222262045 GCAACAGGAATACTCACTGTTGG + Intergenic
923195937 1:231667361-231667383 GGCTCAGGAAAGGTCACTGAAGG - Intronic
923527810 1:234786275-234786297 GCCTCAAGAGAGCTGACTGCAGG + Intergenic
923933008 1:238723680-238723702 GTATCAGGAAAGATCTCTGTTGG - Intergenic
1063248450 10:4248482-4248504 GCCTCAGGAAAGATCACCCCAGG + Intergenic
1069433493 10:68358505-68358527 GCCTCAGGAAAACTGACTCTTGG + Intronic
1071276131 10:84057019-84057041 TCCTCAAGCAAGGTCACTGTTGG + Intergenic
1072188079 10:93060947-93060969 GCCTCGGGAACGCTCACTCCCGG - Intergenic
1072784791 10:98272365-98272387 GCCACAGGACAGCTGTCTGTGGG - Intergenic
1074109310 10:110411177-110411199 GCCTGAAGAAAGCTTGCTGTAGG - Intergenic
1074506162 10:114072563-114072585 GCCTTTGGAAAGCTCAAGGTAGG + Intergenic
1074559997 10:114527081-114527103 GCCTCAGGGACAATCACTGTCGG - Intronic
1075378494 10:121998683-121998705 GCCTCAGGAGAGCTCTGTGCTGG + Intronic
1075529053 10:123211794-123211816 GCATGAGCATAGCTCACTGTAGG + Intergenic
1076496492 10:130900887-130900909 GCCTCAGGAAGACCCACTGCAGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1080527247 11:33136111-33136133 GACTCAGGAAAGCATAATGTGGG - Intronic
1080684021 11:34500653-34500675 ACCTCAGGAGGACTCACTGTTGG - Intronic
1080879759 11:36308497-36308519 GTCTCAGGAAAGGTCACTTTGGG + Intronic
1082151754 11:48748610-48748632 TCCTCAGTACAGCACACTGTTGG + Intergenic
1083136842 11:60686917-60686939 GCCCTCGGAAATCTCACTGTCGG + Intergenic
1085781189 11:79410674-79410696 GCCTCAGGAAAGGTCAGAGAAGG - Intronic
1097549180 12:61045853-61045875 GGCTCAGCAAAACTCTCTGTGGG - Intergenic
1099834693 12:87894799-87894821 GCCTCAGCAAAGCTGGCTGGGGG + Intergenic
1102339763 12:112112445-112112467 GCCTCAGGCAAGCTGACCCTAGG + Intergenic
1103716242 12:122947096-122947118 GCCTCAGGAAGGCTCTGTTTGGG - Intronic
1104805436 12:131586540-131586562 GCCTCAGGGGAGCACACTGGGGG + Intergenic
1106275543 13:28202209-28202231 GCCTTAGGAAAGCTTAATGCTGG + Intronic
1109461030 13:62657525-62657547 TCCTCAGCAAAGGTCACTGGAGG - Intergenic
1110242903 13:73288535-73288557 GCCTCATGAAACCTCCCTCTAGG - Intergenic
1113769580 13:112899487-112899509 CCCTCAGGAAAACCCACTGCTGG + Intronic
1113922738 13:113923124-113923146 ACCTCAGGAACACTCACTCTAGG - Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114720916 14:24881084-24881106 ACCTCTGGACAGCTCACTGGAGG - Intronic
1116577062 14:46588017-46588039 ACCAAAGGAAAGCTCATTGTAGG - Intergenic
1118749803 14:68797242-68797264 GCCTCAGGAGAGGGCACTTTAGG + Intergenic
1121304993 14:92900496-92900518 GCCCCAGGAGAGCTGACAGTTGG - Intergenic
1121441617 14:93953316-93953338 TCCGCAGGAAAGCTCACTCCGGG + Intronic
1121864900 14:97353585-97353607 GCCACAAGAAACCTCACAGTGGG + Intergenic
1122598221 14:102907988-102908010 GCCTCAGGAAAACTACCTGAGGG - Exonic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123977732 15:25568913-25568935 GCCTCAGAATAGGCCACTGTGGG + Intergenic
1124493360 15:30171845-30171867 GCCCCAGGACAGCTGCCTGTGGG - Intergenic
1124750174 15:32366480-32366502 GCCCCAGGACAGCTGCCTGTGGG + Intergenic
1126166749 15:45659970-45659992 GCCTCTGGAAAGCTGTCAGTGGG + Intronic
1127051450 15:55088434-55088456 CTCTCAGGACAGCTTACTGTTGG - Intergenic
1127313088 15:57769604-57769626 GCCTGAGGAGAGCTCTCTATGGG + Intronic
1127786564 15:62360669-62360691 GGCTCATGAAAGCTGAATGTGGG - Intergenic
1129355821 15:74990772-74990794 GCCTCAGGGTTGCTCACTGCTGG + Intronic
1131733991 15:95312752-95312774 GCCTTAGCAAATGTCACTGTGGG - Intergenic
1135847243 16:25929919-25929941 GCATCAGGAAAAATAACTGTTGG - Intronic
1138184248 16:54964084-54964106 GCCTCAGCAAAGTTCCCTGTTGG - Intergenic
1138495256 16:57405022-57405044 CCCTCAAGAAAGCTCAATGTTGG + Intronic
1138521526 16:57574219-57574241 GCCGCAGGAGAGCCCACTGAGGG - Intronic
1143338595 17:6191826-6191848 GCATCAGGAAAGCCCACAGAGGG - Intergenic
1146138137 17:30341055-30341077 GGCTCAGGAAAGCTCCCAGCAGG - Intergenic
1146949030 17:36893005-36893027 GCTGCAGGAAAGCTCATTCTGGG + Intergenic
1146990782 17:37270121-37270143 GACTCAGGAAAGCTCGATGTAGG - Intronic
1150125229 17:62630727-62630749 ACCTCAGGAAATCTTCCTGTGGG + Intronic
1152185526 17:78854322-78854344 GCTTCAGGAAACCACACTGAGGG + Exonic
1152555261 17:81049867-81049889 GCCTGAGGAGAGCCCACTGTGGG - Intronic
1152769022 17:82156384-82156406 GCCCCAGGAGCTCTCACTGTTGG - Intronic
1152873431 17:82771717-82771739 GTGTGAGCAAAGCTCACTGTAGG - Intronic
1155054571 18:22172065-22172087 GCCCCAGTACAGCTCGCTGTCGG + Exonic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1160512592 18:79460948-79460970 GCCTCAGGACAGGTCACGGGAGG - Intronic
1161272352 19:3397105-3397127 CCCTCAGGAAACCACATTGTTGG + Intronic
1162146170 19:8613138-8613160 GCCTCAACACAGCTCACTGGAGG - Intergenic
1162932197 19:13962802-13962824 GCCGCAGGACATCTCACTGGCGG - Exonic
1163196257 19:15723267-15723289 TCCTCAGGAAAGCTCAGGGATGG - Intergenic
1167593790 19:50417390-50417412 GGCTCAGGACAGCTCACAGCTGG - Intronic
928516397 2:32048568-32048590 GCGTGAGGACAGCTCACTGCAGG - Intergenic
929078164 2:38095723-38095745 GCCAGAGGAAATCTCACAGTTGG + Intronic
931620397 2:64204377-64204399 CCCTCAGGAAAGCTTAGTGAAGG - Intergenic
935346343 2:102111882-102111904 CCCTGAGGAAAGCTCTCAGTTGG - Intronic
935675733 2:105593821-105593843 GCCCCAGGCAAGCTCCCTGCTGG + Intergenic
936455007 2:112666264-112666286 GCCTCAGGAAAGGGAAATGTTGG - Intergenic
936462927 2:112725174-112725196 GACTCAGGAAAGCTCCACGTGGG + Exonic
939696924 2:145337688-145337710 GCCTCAGGAAAGCTATCCTTTGG - Intergenic
939959311 2:148552245-148552267 GTCTCAGGAATACTCACTCTTGG + Intergenic
940995259 2:160142709-160142731 GCCTCAGGAAAAAACACTGTGGG - Intronic
945396692 2:209326860-209326882 AGCTCAGGAGAACTCACTGTAGG + Intergenic
948253744 2:236551314-236551336 GCCTCAGGAGACCCCACTGGTGG + Intergenic
948392433 2:237622216-237622238 GCCTCTGGGAAGCTCGCTGAGGG - Intergenic
1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG + Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172106984 20:32522820-32522842 GCCTCAGGAGAGCTCAGTGGAGG + Intronic
1172114418 20:32565096-32565118 GCCTCAGGACAGCTCTGTGAGGG - Intronic
1172123497 20:32612002-32612024 GCCTCTGGATAGCCCAATGTGGG - Intergenic
1173708045 20:45128209-45128231 GCCTCAGAACACCTCAATGTAGG + Intergenic
1176032027 20:63017334-63017356 GCCTCAGGAGAGCCCTCAGTGGG + Intergenic
1179288505 21:39998061-39998083 GCATGAGGAAGGCTCACAGTGGG - Intergenic
1179484563 21:41701471-41701493 GTCCCAGGAGAGCTGACTGTTGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1182016530 22:27044869-27044891 ACCTCTTGAAAGCTCGCTGTAGG - Intergenic
1183410262 22:37650763-37650785 GCCTCAGGCAGGCTGATTGTGGG - Intronic
1184412937 22:44336380-44336402 GCCCCAAAGAAGCTCACTGTCGG + Intergenic
1185348387 22:50320672-50320694 GCCTCAGGATAGCTCCATGAGGG + Intronic
952251642 3:31662069-31662091 CCCTCTGGAAAGCACACTGATGG - Exonic
952847966 3:37704301-37704323 ACCTCAGGAAAGCTCATTCCAGG - Intronic
958521564 3:95195530-95195552 GTATCAGGAAATCTAACTGTTGG + Intergenic
959252499 3:103966042-103966064 GGCTTAGGACAGCTCAGTGTGGG + Intergenic
962705402 3:138038696-138038718 GCCTCTGCAAAGCTCTCAGTGGG + Intergenic
965206190 3:165720990-165721012 CCCTGAGGGAAGCTCAGTGTAGG - Intergenic
965466240 3:169034044-169034066 GCCTCAAGAAATCAGACTGTGGG - Intergenic
965939346 3:174158855-174158877 GCCTAAGGAATGCAGACTGTTGG - Intronic
968208664 3:196827384-196827406 GCCCTAGGAAAGCTTTCTGTCGG - Intronic
968594214 4:1474025-1474047 GCCTCAGCAAAGGCCACTTTGGG - Intergenic
969041020 4:4296230-4296252 GACTGAGGAAAAGTCACTGTCGG + Intronic
969401639 4:6959531-6959553 GCCTCTGGGAAGCACAGTGTGGG + Intronic
969971677 4:11054337-11054359 GCCTTAGAAAAGGTCATTGTAGG + Intergenic
972400163 4:38694228-38694250 GTCTCAGGAAACCACATTGTAGG - Intronic
973051907 4:45608394-45608416 GCCTCAGGAGAGGGCAGTGTGGG - Intergenic
974926511 4:68305150-68305172 ACCTCAGTAAAGCTCATTTTGGG + Intergenic
977283443 4:95070589-95070611 GGCTCAGGAAAGGATACTGTAGG + Intronic
977660132 4:99576048-99576070 ACCTCAGCAAATCACACTGTAGG + Intronic
985310977 4:188598461-188598483 GCCTGAGGAAAGCACGCTGTTGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
986309144 5:6538791-6538813 GCTTCAGAAAAGCTCAGTCTGGG + Intergenic
986603724 5:9500580-9500602 TCCTCAGCAAACCTCAGTGTGGG - Intronic
988027153 5:25710479-25710501 GCCTCATGAAAATTCACTGCCGG + Intergenic
991006050 5:61829006-61829028 GCAGCAGGCAAGCTCGCTGTGGG + Intergenic
995705241 5:114982116-114982138 GCATCAGGATACCTCACAGTTGG - Intergenic
1002294281 5:178221474-178221496 GCCTCAGAGGAGCTCACTGTCGG - Intronic
1002823333 6:749683-749705 GCCACTGTAAGGCTCACTGTGGG + Intergenic
1003313702 6:4991967-4991989 GCCTCAGGAAAACTCAATCATGG - Intergenic
1006101077 6:31686778-31686800 GCCTGAGGAAAGCTCAGGTTAGG + Intergenic
1007260385 6:40559245-40559267 TCATCAGGAAGGCTCACTGCCGG - Intronic
1008286622 6:49660648-49660670 GGCTCAGGAAAGCTGCCTGGGGG - Intergenic
1013912159 6:115289097-115289119 GCCTCAGGAAAGCCATGTGTTGG + Intergenic
1016991613 6:149933616-149933638 TCCACAGCACAGCTCACTGTTGG - Intergenic
1022466389 7:30655532-30655554 GCCTCAGGAAAGCTCACTGTGGG + Intronic
1024165376 7:46724471-46724493 GCCTCTGGGAATCTCTCTGTGGG - Intronic
1024334624 7:48194938-48194960 GCCTTTGCAGAGCTCACTGTAGG + Intronic
1024335726 7:48203504-48203526 TCCTCAGGTAAGTTCACTTTGGG + Intronic
1031213089 7:118856786-118856808 TCTTCTGGAAAGCTCACTTTTGG + Intergenic
1033946069 7:146719232-146719254 GCCTCAGCAAAGCTGACTGTTGG - Intronic
1034196572 7:149252843-149252865 GCCGTGGGAAAGCTCACTCTAGG - Intronic
1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG + Intergenic
1039919686 8:41884505-41884527 GACTCAGGAAAGCTTCCTGGAGG + Intronic
1047486530 8:125335914-125335936 GCCTCAGAAAACATCACTTTTGG + Intronic
1047853317 8:128882688-128882710 GCCCAAAGAAAGCTAACTGTTGG - Intergenic
1051749519 9:20326653-20326675 GCCTCATGACAGCCCACAGTAGG - Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1059658748 9:116380552-116380574 GCCTCAGGAGATCTGCCTGTGGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1188646865 X:32579550-32579572 GCATCTGGATATCTCACTGTAGG - Intronic
1189994161 X:46623233-46623255 GACTGAGGAAGGGTCACTGTGGG + Intronic
1190834046 X:54084070-54084092 GCCTCCTGAAAGCCCACAGTAGG - Intronic
1192048137 X:67698203-67698225 GAGTCAGGGGAGCTCACTGTGGG - Intronic
1196373978 X:115011324-115011346 ACCTCAGAAAAGCCAACTGTAGG + Intronic
1197126906 X:122957616-122957638 GCCAAAGGTAAGGTCACTGTCGG + Intergenic
1197846532 X:130810185-130810207 GCCTCAGTAAATCCCACTGCTGG + Intronic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic