ID: 1022467254

View in Genome Browser
Species Human (GRCh38)
Location 7:30660378-30660400
Sequence CAGGGCATCGAGCATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022467243_1022467254 23 Left 1022467243 7:30660332-30660354 CCCAGAGAAAGAGCCCTGAGGTC 0: 1
1: 0
2: 1
3: 19
4: 207
Right 1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 185
1022467246_1022467254 10 Left 1022467246 7:30660345-30660367 CCCTGAGGTCAGCAGAGTGGTGC 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 185
1022467241_1022467254 26 Left 1022467241 7:30660329-30660351 CCTCCCAGAGAAAGAGCCCTGAG 0: 1
1: 0
2: 1
3: 19
4: 271
Right 1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 185
1022467247_1022467254 9 Left 1022467247 7:30660346-30660368 CCTGAGGTCAGCAGAGTGGTGCA 0: 1
1: 0
2: 1
3: 21
4: 194
Right 1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 185
1022467244_1022467254 22 Left 1022467244 7:30660333-30660355 CCAGAGAAAGAGCCCTGAGGTCA 0: 1
1: 0
2: 1
3: 31
4: 231
Right 1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG 0: 1
1: 0
2: 1
3: 11
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022467254 Original CRISPR CAGGGCATCGAGCATGAGGA AGG Intronic
902622116 1:17656649-17656671 CAGGCCAGCGAGCAGGTGGAAGG - Exonic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903810633 1:26033272-26033294 GCGGGCATCGAGGCTGAGGATGG - Exonic
903928492 1:26848820-26848842 GGGGGCATCAAGCATGGGGATGG + Intronic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
905226669 1:36483194-36483216 CAGGGCAGGGGGCATAAGGATGG - Exonic
905356424 1:37388113-37388135 CAGTGCAGGTAGCATGAGGAGGG - Intergenic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
911097376 1:94065608-94065630 CAGGGCATGGAGGCTGAGGTGGG - Intronic
912640605 1:111341971-111341993 GAGGGAGTCGAGCATGAGCATGG + Intergenic
913531010 1:119734338-119734360 CAGGGCTTCCACAATGAGGAGGG - Intronic
915891782 1:159780593-159780615 CAGGGCATCCAGCGTGAAGGAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
922572018 1:226639927-226639949 AAGGGCATCCAGGCTGAGGATGG + Intronic
923114476 1:230922217-230922239 AAGGGCATGGAGCTAGAGGAAGG - Intronic
924625304 1:245692478-245692500 CAGGGCATCGAGGCTGAGGCAGG + Intronic
1062838331 10:650729-650751 CAGGGAAGTGAGCATGAGGGGGG - Intronic
1063982891 10:11470209-11470231 CAGCGCAGAGGGCATGAGGATGG + Intronic
1067457193 10:46427413-46427435 CAGGGCTGTGAGCCTGAGGATGG - Intergenic
1067630009 10:47957225-47957247 CAGGGCTGTGAGCCTGAGGATGG + Intergenic
1069818057 10:71211162-71211184 CTGGGCACCCAGCATCAGGAGGG - Intergenic
1069842484 10:71348491-71348513 CAGGGCATGGAGCCTGAGTCAGG - Intronic
1069902932 10:71716212-71716234 CAGGGCGATGAGCATGGGGAGGG + Exonic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1081060030 11:38462402-38462424 CAGGTCTTCGGGCTTGAGGATGG + Intergenic
1085521680 11:77142837-77142859 CAAGGCATGGGGCAGGAGGAGGG - Intronic
1088047790 11:105474416-105474438 CAAGGTATTGAGGATGAGGAAGG + Intergenic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1090854091 11:130597219-130597241 CTGGGCATGGGCCATGAGGACGG - Intergenic
1091879770 12:3967733-3967755 CAGGGCCTCAAGCATGATGGTGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093913215 12:24770825-24770847 CAAGCCATTGAGGATGAGGATGG - Intergenic
1097264712 12:57738436-57738458 CAGGGCGGGGAGCATGGGGAGGG - Intronic
1098218019 12:68240350-68240372 GAGGGTTTCAAGCATGAGGAAGG - Intergenic
1098950531 12:76636414-76636436 CAGGGCACCAAGCAAGGGGATGG + Intergenic
1100036585 12:90259357-90259379 CAGAGAGTCGAGGATGAGGAAGG + Intergenic
1100457564 12:94767368-94767390 GAGGGCAGCAAGCAAGAGGAGGG + Intergenic
1100705448 12:97195661-97195683 CAAGGTATTGAACATGAGGAAGG + Intergenic
1101605822 12:106247364-106247386 CAGGGCGTCGAGCAGAAGGTGGG - Exonic
1104947961 12:132425465-132425487 CTGTGCACCGAGCATGAGGGAGG - Intergenic
1105207631 13:18236387-18236409 CAGGGCATCGCTAATGAAGATGG + Exonic
1105788714 13:23775513-23775535 CTGGGCATTGAGGATGAGTATGG - Intronic
1106226570 13:27790914-27790936 CATGGCATCTAGCAGGAGTAAGG - Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1110818218 13:79884334-79884356 CAGGGTATTGAGCTGGAGGATGG + Intergenic
1112910629 13:104479124-104479146 GAGGGCATTGAGCAAGAGCAAGG - Intergenic
1113802890 13:113095686-113095708 CAGGGCCTGGAGCAGGAGGACGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1120452926 14:84693807-84693829 CAGTGCTTGGAGGATGAGGAGGG - Intergenic
1122783620 14:104154082-104154104 CAGGGCATCGATCATTAGCGTGG + Intronic
1122817768 14:104321954-104321976 GGAGGCATCCAGCATGAGGAAGG + Intergenic
1124610204 15:31202878-31202900 CAGGGCATTGAGCACCATGAGGG + Intergenic
1125497737 15:40213104-40213126 AAGGGCATCAAGCATGAGCCTGG - Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1128028254 15:64457873-64457895 CAAGGCATCCAGCATGTGGAGGG + Intergenic
1128230745 15:66033356-66033378 CTGGGCATGGAGCCTGTGGAGGG - Intronic
1128715363 15:69903823-69903845 CAGGGCAGAGAGCAAGATGAAGG - Intergenic
1132372104 15:101306398-101306420 CAGAGCATGGAGCTTGTGGAGGG - Intronic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1134008933 16:10836823-10836845 TAGGGCATGGGGCATGGGGATGG + Intergenic
1134515830 16:14886094-14886116 CACGGCATGGGGCATGAGCAGGG - Intronic
1135114070 16:19711176-19711198 AAGGGCCCCCAGCATGAGGATGG + Intronic
1135848367 16:25939798-25939820 TAGGGCAGCCAGAATGAGGAAGG + Intronic
1136560069 16:31033845-31033867 CAGGGCAGCGGGGATGGGGACGG + Intronic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1137891381 16:52166322-52166344 CAGAGCATCAAGCCTCAGGAGGG + Intergenic
1138423164 16:56912973-56912995 CAGGGCATCGGGGGTGAGCAAGG + Intronic
1139782824 16:69365812-69365834 CAGCGCACCCAGCCTGAGGAAGG + Intronic
1139876740 16:70152044-70152066 CCGGGCATTGAGCTTGAGGTGGG + Intronic
1143384795 17:6522622-6522644 CAGAGCGTCCAGCATGAGGCAGG + Intronic
1145289462 17:21531776-21531798 CAGTGCATCCAGAAAGAGGAAGG + Exonic
1147647115 17:42040509-42040531 CAGGGCATCCAGCAGCAGGTGGG + Intronic
1148744911 17:49912735-49912757 GAGGGCGTCGAGGAAGAGGAGGG - Intergenic
1152278175 17:79370076-79370098 CAGAGCAGGGAGCATCAGGAAGG - Intronic
1155257657 18:24012977-24012999 CATGGCATCAATCATGAGAATGG - Intronic
1159025306 18:63177941-63177963 CAGGTCAGCCTGCATGAGGAGGG + Intronic
1161001597 19:1913682-1913704 CAGGGCACCGACCCTAAGGAAGG + Intronic
1165741868 19:38209696-38209718 CGGGGCCTCGAGGAGGAGGAGGG - Intergenic
1165798930 19:38536043-38536065 CTGGGCATGGTGAATGAGGATGG + Exonic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
924997130 2:372450-372472 CAGGGCATGGAGCATGACTTTGG + Intergenic
926725850 2:15997305-15997327 CAGGGCCACCAGCATCAGGAAGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928452034 2:31386029-31386051 CAGAGCACCGAGCATGAGCCAGG - Intronic
930152138 2:48069910-48069932 GAAGGCATCCAGAATGAGGAAGG + Intergenic
930243832 2:48963201-48963223 CAGGACATTGAGCACAAGGAGGG + Exonic
935171276 2:100612917-100612939 GAGGCCATGGGGCATGAGGAGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937473972 2:122197917-122197939 TAGGGCTTCCAGCATGAGGCAGG + Intergenic
942912211 2:181257953-181257975 CAGGGCTTGGAGCATGAAGGAGG + Intergenic
944674755 2:202025970-202025992 CAGGCCATTGAGCAAGAAGAAGG + Intergenic
946336791 2:219042983-219043005 CAAGGGATTGAGCCTGAGGAGGG + Intergenic
947975675 2:234363785-234363807 CAGGGCATCTTGGATGAGGAAGG + Intergenic
1168862109 20:1052862-1052884 CAGGGCTGTGAGCATCAGGAGGG + Intergenic
1169326201 20:4678903-4678925 CAGGGGCTCGAGCCTGAGAAAGG - Intergenic
1170959232 20:21010318-21010340 CAAGTCATCGAACCTGAGGAAGG - Intergenic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1173179795 20:40797178-40797200 CAGGGCTAAGAGCATGAGGGAGG + Intergenic
1175760325 20:61558360-61558382 GATGGCATCAAGCATGAGTAAGG - Intronic
1203231036 22_KI270731v1_random:110659-110681 CAGGGCATCGCCAACGAGGACGG - Intergenic
1203231133 22_KI270731v1_random:111037-111059 CAGGGCATCGCCAACGAGGACGG - Intergenic
1203231146 22_KI270731v1_random:111091-111113 CAGGGCATCGCCAACGAGGACGG - Intergenic
951058848 3:18180421-18180443 CAGTGCATATATCATGAGGAAGG - Intronic
952825262 3:37519417-37519439 CAGGGCATGGTGCATAATGAAGG - Intronic
953879022 3:46682023-46682045 CAGGGCCTGGAGCATGGGTAAGG - Exonic
954614547 3:51962941-51962963 AAGGGCAGCCAGCATGAGGCTGG - Intronic
957801027 3:85081719-85081741 CAGGGCATCGAGGAAGAGGCCGG + Intronic
960965682 3:123103129-123103151 CTGGGCATCCAGCCTGAGGGTGG - Intronic
961040690 3:123676041-123676063 CAGGACACAGAGCATCAGGATGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961918465 3:130401511-130401533 CAGGGCATCCAGTATGTGGATGG - Intronic
962629976 3:137265664-137265686 CAGGAAATAGAGCATGAGGCTGG + Intergenic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
964304508 3:155326086-155326108 ACGGCCATAGAGCATGAGGAGGG + Intergenic
968573678 4:1355210-1355232 CTGGACATCGAGCCTGAGGGAGG + Exonic
969279458 4:6160507-6160529 CAGGGCATGCAGCATGCGGGAGG - Intronic
969294523 4:6262012-6262034 CAGGGAACTGAGCATGGGGAGGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
977176436 4:93826116-93826138 CAGGGCCTTGAGCATGGGGTTGG - Intergenic
979496896 4:121393507-121393529 GAAGGCAGTGAGCATGAGGAAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980944087 4:139302036-139302058 CAGGGCCTCAAGCGTGGGGATGG - Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
984483261 4:180333266-180333288 CAGGACATAGAGAATGAGAATGG + Intergenic
984960290 4:185090712-185090734 CAGGGCATCAAGTAGAAGGAAGG + Intergenic
986476856 5:8143196-8143218 GAGGGCACCGCGCATGAGGGTGG - Intergenic
989151317 5:38302387-38302409 AAGGTCATGGAGCAGGAGGATGG - Intronic
995183424 5:109249381-109249403 CACAGCATGGAGCATGAGTAAGG - Intergenic
1001956931 5:175854101-175854123 CAGGGCACCGGGCATGAAGCTGG - Intronic
1002417073 5:179126261-179126283 CAGGGCACCGAGCCTGCGGCTGG + Intronic
1003570663 6:7254314-7254336 GAGGGCATGGGGCATGGGGATGG + Intergenic
1004345442 6:14844755-14844777 AAGGGCACCGAGCGTGGGGAGGG - Intergenic
1004608768 6:17218900-17218922 CAGGGCAGTGAGCAAGAGAAAGG - Intergenic
1006067802 6:31474947-31474969 CAGGGCTTTGAGCCTGAGCAGGG + Intergenic
1006896605 6:37475346-37475368 AAGGACATCGAGGATGTGGATGG - Exonic
1011196484 6:84785073-84785095 CAAGGCATCGGCCGTGAGGAAGG + Intergenic
1013163550 6:107569395-107569417 GAGGGCATAGTGCATGTGGAAGG + Intronic
1016554928 6:145325889-145325911 CATGGCATCGTGGAAGAGGAAGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1019023143 6:168935826-168935848 CAGGGCCTGGAGCAGGAGGGAGG - Intergenic
1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG + Intronic
1024684795 7:51733711-51733733 CAGGGAAGAGAGCATGTGGAGGG + Intergenic
1026847086 7:73704393-73704415 CAGTCCATCGAGCAAGAGGAAGG - Exonic
1026893262 7:73995542-73995564 CAGGGCTTTGAGCCTGAGGCAGG + Intergenic
1027422096 7:78026730-78026752 CAGGGCATCCAGCTTCAGGCTGG + Intronic
1029488950 7:100860001-100860023 CAGGGCATGGAGGATGCGGGAGG - Exonic
1030800302 7:113841992-113842014 ATGGGCACAGAGCATGAGGAGGG - Intergenic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1031915243 7:127556806-127556828 CAGGCCAGAGAGCATGTGGAGGG - Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034356150 7:150451882-150451904 CAGGGCAACCATCAAGAGGAAGG - Intronic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1035329089 7:158084884-158084906 ATGGGCATCGAGGATGTGGATGG - Intronic
1035807865 8:2468723-2468745 CATGCCATGGGGCATGAGGAGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1039839033 8:41280468-41280490 CAGGGCATTCAGCTTGAGGCCGG - Intronic
1045489456 8:102657321-102657343 CAGGGCTGCGGGGATGAGGAGGG + Intergenic
1046604397 8:116354723-116354745 CAAGACACCGAGCATCAGGAGGG - Intergenic
1049804122 8:144531242-144531264 CAGGGCAGCGAGCAGCAGGTGGG + Intronic
1049804147 8:144531360-144531382 CAGGGCAGCGAGCAGCAGGTGGG + Intronic
1049804173 8:144531478-144531500 CAGGGCAGCGAGCAGCAGGTGGG + Intronic
1049804254 8:144531832-144531854 CAGGGCAGCGAGCAGCAGGTGGG + Intronic
1050150196 9:2612279-2612301 CAGGGCATCTACAAGGAGGATGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1054890619 9:70247010-70247032 CAGGGCATAGAGCAGGTTGAGGG + Intergenic
1056924922 9:90826252-90826274 CTGGTCATCGAGCCTCAGGAGGG - Intronic
1057354393 9:94322099-94322121 CTCAGCATGGAGCATGAGGAGGG - Intronic
1058702098 9:107609675-107609697 CAGGGCTTCCAGGATGAGAAAGG - Intergenic
1060798233 9:126526874-126526896 CAGGGCATAGAGAGTGAGGTAGG + Intergenic
1060983025 9:127804289-127804311 CAGGGTATTGAGCATGCGCACGG - Exonic
1061254907 9:129449352-129449374 AGGGGCATGGATCATGAGGACGG + Intergenic
1185997919 X:4973574-4973596 GCTGGCATTGAGCATGAGGAAGG - Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188111329 X:26198540-26198562 CAGGGCGAGGACCATGAGGAAGG + Intergenic
1189118759 X:38370936-38370958 CATGGCACCCAGCATGAGGAAGG - Intronic
1189461904 X:41250043-41250065 CAGGGCAGGAAGCAAGAGGAGGG - Intergenic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1193751180 X:85346015-85346037 GATGGCATTGAGCCTGAGGATGG + Exonic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1194848815 X:98846826-98846848 GAGGGCATTGAGCAAGAGCAAGG - Intergenic
1196339645 X:114582676-114582698 TAGGGCATCCAGAATAAGGAAGG + Intergenic
1198513949 X:137385334-137385356 CAGGGCCTGGAGTATGGGGATGG + Intergenic
1199494336 X:148436514-148436536 CAGGGCAAGGTGCTTGAGGAGGG - Intergenic
1200686249 Y:6262915-6262937 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200831850 Y:7693181-7693203 CAGGGCAGTGGGGATGAGGATGG - Intergenic
1200989132 Y:9333831-9333853 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200991789 Y:9354161-9354183 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200994443 Y:9374441-9374463 CAGGGCAGCGGGAGTGAGGATGG + Intronic
1200997106 Y:9394787-9394809 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200999622 Y:9463325-9463347 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1201002280 Y:9483633-9483655 CAGGGCAGCGGGAGTGAGGATGG + Intronic
1201004939 Y:9503920-9503942 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1201007597 Y:9524247-9524269 CAGGGCAGCGGGAGTGAGGATGG + Intergenic