ID: 1022467317

View in Genome Browser
Species Human (GRCh38)
Location 7:30660636-30660658
Sequence AAACCAGCACCTGTGAAGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022467312_1022467317 -1 Left 1022467312 7:30660614-30660636 CCAGGTCGCCAGGCTCCTTGCCA 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1022467317 7:30660636-30660658 AAACCAGCACCTGTGAAGATGGG 0: 1
1: 0
2: 1
3: 13
4: 180
1022467311_1022467317 2 Left 1022467311 7:30660611-30660633 CCACCAGGTCGCCAGGCTCCTTG 0: 1
1: 0
2: 0
3: 20
4: 171
Right 1022467317 7:30660636-30660658 AAACCAGCACCTGTGAAGATGGG 0: 1
1: 0
2: 1
3: 13
4: 180
1022467308_1022467317 18 Left 1022467308 7:30660595-30660617 CCTTGGTAGATGTAGTCCACCAG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1022467317 7:30660636-30660658 AAACCAGCACCTGTGAAGATGGG 0: 1
1: 0
2: 1
3: 13
4: 180
1022467313_1022467317 -9 Left 1022467313 7:30660622-30660644 CCAGGCTCCTTGCCAAACCAGCA 0: 1
1: 0
2: 0
3: 18
4: 219
Right 1022467317 7:30660636-30660658 AAACCAGCACCTGTGAAGATGGG 0: 1
1: 0
2: 1
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022467317 Original CRISPR AAACCAGCACCTGTGAAGAT GGG Exonic
900007395 1:71031-71053 AAATGAGCATCTGTTAAGATTGG - Intergenic
901938753 1:12645837-12645859 AAAAAAACACCTGTGAAGCTAGG - Intronic
902499592 1:16900850-16900872 AAACTAACTCCTGAGAAGATAGG + Intronic
908156491 1:61358793-61358815 CAGCCACCACCTGTGGAGATAGG + Intronic
912408070 1:109458654-109458676 AAACTAGCTCCTGTTAAGATAGG + Intergenic
918553347 1:185769830-185769852 AAGCTAGCATCTGTGATGATGGG - Intronic
921347854 1:214205399-214205421 AAACCTGCACCTGTTAGGCTTGG + Intergenic
923479994 1:234374978-234375000 TCACCAGTACCTGTTAAGATAGG + Intronic
1062901461 10:1149926-1149948 CAGCCAGCAGCTGTGAAGACCGG + Intergenic
1063371946 10:5527859-5527881 AAGCCTGCACCTGGGAAGAAGGG - Intergenic
1063454080 10:6170927-6170949 AATCCAGCAGCTGGGAAGACAGG + Intronic
1063797877 10:9533483-9533505 AAAACTGCATCTGTGAACATGGG - Intergenic
1064224606 10:13471805-13471827 ACAACAGCCCCTGTGAAGCTTGG - Intronic
1064715653 10:18174135-18174157 AACTTAGCACCTTTGAAGATGGG + Intronic
1066241924 10:33545992-33546014 AAACCAACACATGTGAGGATAGG + Intergenic
1066561164 10:36671310-36671332 CACACAGCACCTCTGAAGATGGG + Intergenic
1069285043 10:66703308-66703330 ATGCCAGCACCAGTGAAGAGAGG - Intronic
1069816056 10:71195201-71195223 AAACCAGCTCCTCTGAAGGAGGG + Intergenic
1071346005 10:84693909-84693931 AAATCAGCAAATGTGAAAATAGG + Intergenic
1071578843 10:86752371-86752393 AAACCAGGTGCTGTGAGGATAGG + Intergenic
1072019360 10:91382964-91382986 AAACTAGCACAAGTGAAAATTGG + Intergenic
1072507303 10:96081251-96081273 AAAACAGCTCCTGTGGAGAATGG + Intergenic
1073945409 10:108744461-108744483 AAACCAGGACAAGTGAATATGGG + Intergenic
1074251602 10:111756369-111756391 AAGCCAGCAGCTGTGGAGCTGGG + Intergenic
1074357419 10:112798677-112798699 AACCCAGCACCCTTGAGGATGGG - Intronic
1075495564 10:122915972-122915994 AAAGCAGCACCTGAGATGCTGGG - Intergenic
1077623935 11:3753345-3753367 AAACCAGCACCTGGGACTCTTGG - Exonic
1079587901 11:22148972-22148994 AAGACAGAACCTGTGACGATTGG - Intergenic
1080405509 11:31975310-31975332 ATTCCATCAACTGTGAAGATGGG + Intronic
1083088937 11:60179997-60180019 AAACCAGCATTTGTAAAGACAGG + Intronic
1086916261 11:92533272-92533294 ATCCCAGCACATGGGAAGATGGG - Intronic
1087936414 11:104038455-104038477 AAAACAAAACCTGTGAAAATGGG - Exonic
1087946857 11:104172418-104172440 GAACCAGCACCTGGCATGATAGG - Intergenic
1089644121 11:119866711-119866733 ATACCTGGACATGTGAAGATAGG - Intergenic
1090959649 11:131544745-131544767 ATACAAGGACCTGTGAAGAGTGG + Intronic
1091032432 11:132202810-132202832 AAACCAGTGCTTCTGAAGATTGG - Intronic
1091401012 12:180706-180728 AAACCAGCAACAGTGAAGTCAGG + Intergenic
1091764546 12:3110181-3110203 AAACCAGGCCCAGGGAAGATAGG + Intronic
1091792365 12:3279168-3279190 CAAGCAGCACCTGTGCAGAAAGG + Intronic
1091942105 12:4496198-4496220 AAACCAGCACCTAAAAAGAATGG + Intronic
1094038556 12:26097825-26097847 AAACCAGAATGTGTGAAGATGGG + Intergenic
1095539662 12:43294805-43294827 AAAGCAGAACCTGGGAAGAGAGG + Intergenic
1097573006 12:61356528-61356550 AATACTGCACCTGGGAAGATGGG + Intergenic
1108524908 13:51278388-51278410 CAACCCGCACCTGTGAAGGTTGG - Intronic
1116423813 14:44765626-44765648 CATCCAGCACCTGTGAAAACAGG + Intergenic
1122831617 14:104400283-104400305 AAACCATCACCAGTGACGACAGG + Intergenic
1123398553 15:19961504-19961526 AAAACATCCCATGTGAAGATAGG + Intergenic
1128194254 15:65736635-65736657 AAACCAGCATTTGTCAAGCTTGG + Intronic
1132003764 15:98207470-98207492 AAGCCAGCACTTATGAAGACAGG + Intergenic
1132446157 15:101921097-101921119 AAATGAGCATCTGTTAAGATTGG + Intergenic
1135949708 16:26902654-26902676 AAACCAGGTCTTGTGAAGCTGGG + Intergenic
1136173104 16:28499911-28499933 CAGCCAGCACCTGTGAGGAGAGG + Exonic
1138893473 16:61174341-61174363 CAACAGGCAGCTGTGAAGATTGG - Intergenic
1138957288 16:61986452-61986474 AAAGGAGAACCTGAGAAGATAGG - Intronic
1140999145 16:80291435-80291457 AAACCATCACCTGTGAAATTGGG + Intergenic
1141163027 16:81641711-81641733 AAGCCAGCTCCTGGGGAGATGGG - Intronic
1142163281 16:88570468-88570490 GAGCCAGAACCTGTGAAGAGCGG + Exonic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1143850311 17:9806338-9806360 AAACCAGTTACTGTGATGATGGG - Intronic
1143884404 17:10055231-10055253 AAGCTAGCACCTGGGAACATGGG + Intronic
1144740156 17:17577264-17577286 AAATCAGCACCTCTGAAGAGGGG + Intronic
1145358932 17:22194953-22194975 AAAACAGAGACTGTGAAGATAGG - Intergenic
1149422141 17:56521419-56521441 ACACCAGCACCTCTCATGATGGG + Intergenic
1150500472 17:65646087-65646109 AAACCATCACATGTGAATAGTGG - Intronic
1151493488 17:74446102-74446124 AAGCCAGCAACTGTGATGCTGGG + Intronic
1152051840 17:77985297-77985319 AAAACAGCAACTGTGAGGCTGGG + Intergenic
1154409145 18:14126872-14126894 TCACCAGCACCTGTGAATTTTGG - Intronic
1155382021 18:25233572-25233594 ATAACAGCAGCTGTGAAGAGCGG + Intronic
1156196794 18:34783341-34783363 CTACCAGGGCCTGTGAAGATTGG + Intronic
1157509768 18:48262548-48262570 AAAACAGCACCAGTGTAGAGTGG + Intronic
1160603458 18:80032252-80032274 AAACCAGCAGGTGGGAAGAAAGG + Intronic
1160639153 19:112619-112641 AAATGAGCATCTGTTAAGATTGG - Intergenic
1164425042 19:28133660-28133682 AAGCCAGAACCTCTGAAGGTCGG - Intergenic
1166395436 19:42436295-42436317 AAAACAGCACATGAGAACATTGG - Intronic
1168013712 19:53554836-53554858 GAACCCGCACCTGTGAACCTCGG + Intronic
927784703 2:25965643-25965665 TAACCATCACCTATGAGGATAGG + Intronic
928094951 2:28398838-28398860 AACGCAGAACCTGTGAAGAATGG + Intronic
928325266 2:30314686-30314708 AAATCAGAATCTGTGGAGATGGG - Intronic
928840663 2:35600485-35600507 AAACCAACACCTGAAAAGAAAGG - Intergenic
930340583 2:50109702-50109724 AAAACATCAGCTGTGAAAATAGG - Intronic
931017600 2:58002490-58002512 AAATCAGTATGTGTGAAGATAGG + Intronic
931353666 2:61515129-61515151 CAACAAGCACATGTGAAGAGGGG + Intronic
934930649 2:98419915-98419937 AAATCAGCATCTCTGAAGACGGG - Intergenic
935145097 2:100390249-100390271 CAACCAACAGCTGTGATGATTGG - Intergenic
936900848 2:117480704-117480726 AAACCAGCTATTGTGAAAATAGG + Intergenic
937980400 2:127611390-127611412 CAACCAGCACCTCTGAAGGGTGG + Intronic
938686018 2:133738511-133738533 AAGGCAGCATCAGTGAAGATGGG + Intergenic
940565813 2:155358230-155358252 AAATCAGCAAATTTGAAGATTGG - Intergenic
940591145 2:155729402-155729424 AAACCAGCTCCTCTGAAGTTTGG + Intergenic
941635111 2:167927768-167927790 AAACCTCCACCTGGGATGATAGG - Intergenic
941746782 2:169095342-169095364 AGACCAGCAGCTCTCAAGATTGG - Intronic
941966858 2:171309415-171309437 AAACCAGCAATAGTGAAGTTAGG + Intergenic
944073639 2:195701979-195702001 CAAAAAGGACCTGTGAAGATAGG - Intronic
945029756 2:205652291-205652313 AAACCACCATCTGAGAAGTTTGG + Intergenic
1169855709 20:10100456-10100478 AAACATGCACCTGTGAGGCTGGG + Intergenic
1170498434 20:16949649-16949671 AATACAACACCTGTGAAGTTTGG + Intergenic
1173062850 20:39678942-39678964 AAAGCAGCAGCTGAGAACATGGG - Intergenic
1175983160 20:62751498-62751520 AAGCCAGCACCGGTGAAGCGGGG - Intronic
1176745245 21:10646247-10646269 AAAACATCCCATGTGAAGATAGG + Intergenic
1176864071 21:14033015-14033037 TCACCAGCACCTGTGAATTTTGG + Intergenic
1177381805 21:20354135-20354157 AAATAATCACATGTGAAGATGGG - Intergenic
1183712791 22:39515526-39515548 CACCCAGCACCTGGGGAGATCGG + Exonic
1184806109 22:46795973-46795995 GAACCAGCACCTGAGCAGAGGGG - Intronic
1185131090 22:49039265-49039287 CAACCAGCACCTCTGTAGGTGGG - Intergenic
1203242345 22_KI270733v1_random:30541-30563 AAACCTGCTCCTGTCAAGAAAGG - Intergenic
950236655 3:11327675-11327697 AAACCAGAACCTCTGGAGGTGGG + Intronic
953056020 3:39387809-39387831 AAACCAGAAACTGTGAGGAGAGG + Intronic
953224344 3:41002596-41002618 AACACAGCACCTGGGAAGTTAGG - Intergenic
953966880 3:47314910-47314932 AAACCAGCTACAGAGAAGATAGG - Intronic
954898804 3:54001097-54001119 ACTCCAGCACCTATGAGGATAGG - Intergenic
956228867 3:66990162-66990184 AAACCAGCACTTTCTAAGATTGG - Intergenic
957316109 3:78578881-78578903 AAACCAGACCCTGAGAAAATGGG + Intergenic
958866748 3:99509667-99509689 AAACCACCACCAGTCCAGATCGG - Intergenic
960724261 3:120654355-120654377 AAATCAGAATCTGTGAAGGTAGG + Intronic
965311719 3:167136520-167136542 AGAGAACCACCTGTGAAGATTGG + Intergenic
967098853 3:186199324-186199346 AAACCAGCACCTCTGAATGCAGG - Intronic
967967208 3:194971312-194971334 CCACCAGCACCTGTGACGCTGGG - Intergenic
969444052 4:7234071-7234093 ACTCCAGCACCTGGGGAGATGGG - Intronic
971725038 4:30300712-30300734 GAACCAACATCTGTGAACATGGG - Intergenic
973954159 4:56047069-56047091 AAAACAGCACCTGTCAAAAGTGG + Intergenic
975588345 4:75974417-75974439 AAAACAACAACTGAGAAGATCGG + Intronic
976814753 4:89134814-89134836 AAACCAGAGCCTGGGAAAATGGG + Intergenic
977096624 4:92753703-92753725 AAACCAGGACCTCTAAAGAAGGG + Intronic
979799022 4:124884120-124884142 AAACCAGTACTTGTTAAGTTGGG + Intergenic
982233377 4:153229727-153229749 AAACCAGCTTCCGTGCAGATGGG - Intronic
982799723 4:159689239-159689261 GAATCAGCAAATGTGAAGATAGG + Intergenic
984168368 4:176331342-176331364 AAACCATGAGCTGTGAACATTGG + Exonic
986162978 5:5247798-5247820 AAGCCAGCCCCTGTGAAGCAGGG + Intronic
986498014 5:8366356-8366378 AAACTTGCACATGTTAAGATTGG - Intergenic
988204131 5:28112800-28112822 AATAGAGCACTTGTGAAGATGGG - Intergenic
993700413 5:91112814-91112836 AAATCAGCACCTCTGAAAAGCGG - Intronic
998863142 5:146465602-146465624 GAAGCAGTACCTGTGAAGTTTGG + Intronic
999390877 5:151188771-151188793 AAACCAGAACCTGTCTTGATAGG - Intronic
1000770172 5:165343145-165343167 AAACAAGCACCTGGTCAGATAGG - Intergenic
1001197488 5:169686506-169686528 AAACCAGCAATTGTGAAAAGAGG + Intronic
1001910989 5:175517600-175517622 ATACCAGCAACTGTGAACTTGGG - Intronic
1002746504 6:61024-61046 AAATGAGCATCTGTTAAGATTGG - Intergenic
1005205801 6:23402954-23402976 TAACAGCCACCTGTGAAGATAGG - Intergenic
1005282174 6:24286096-24286118 GACCCCGCACCTGTGAAGTTAGG + Intronic
1009559198 6:65217757-65217779 AAACCAGAAGCTGGAAAGATAGG + Intronic
1012324171 6:97894024-97894046 AAATCAGCACCTGGGAAAATGGG + Intergenic
1012748713 6:103128373-103128395 AAAGCATTACCTTTGAAGATAGG + Intergenic
1013827941 6:114237543-114237565 GAACCAGAATCTGTGAGGATGGG - Intronic
1015318132 6:131840662-131840684 CAACCAGCAGCTGTGAAAGTAGG - Intronic
1017240274 6:152160417-152160439 AAGCCAGCACCTGTCCAGATGGG - Intronic
1017948694 6:159117571-159117593 AAACCATCAGAAGTGAAGATGGG + Intergenic
1018160790 6:161040740-161040762 AAACCAGCAAATGTGGAGTTGGG - Intronic
1018838588 6:167503148-167503170 AAACCAGCTCCTGTGCAGCCCGG - Intergenic
1018856860 6:167681108-167681130 ATACCAGCACCTTGGAAAATAGG - Intergenic
1019829926 7:3317652-3317674 AAACCAGCTCCTGTGAACATGGG - Intronic
1022467317 7:30660636-30660658 AAACCAGCACCTGTGAAGATGGG + Exonic
1023032042 7:36098374-36098396 GAACCAGCACCTGAGAAGACAGG + Intergenic
1024337767 7:48226585-48226607 GAACCAGCAACTGTGGAGCTTGG + Intronic
1024453287 7:49574337-49574359 AAAGAAGCATGTGTGAAGATGGG - Intergenic
1024894721 7:54244788-54244810 AAACCAACACCTATGGAGAGAGG + Intergenic
1027472039 7:78585579-78585601 AGAGCAGCACCTGTGAAGGGTGG + Intronic
1027570382 7:79858959-79858981 AAACCAGCTCCTGGGGAAATAGG + Intergenic
1031114815 7:117655997-117656019 ATACCAGCATCTTTGAAGTTAGG + Intronic
1031135137 7:117875665-117875687 AAACCAGCACTGTTGAAGGTTGG + Intergenic
1032280393 7:130495287-130495309 AAACCAAAACCTGGTAAGATGGG - Intronic
1032982633 7:137301425-137301447 GAACCAGCTCATGTAAAGATTGG + Intronic
1034511435 7:151538242-151538264 ATCCCAGCACCTCTGAAGATGGG + Intergenic
1034982400 7:155487529-155487551 TAACAAGCACTGGTGAAGATGGG - Intronic
1035522790 8:288636-288658 AAGCCAGAACGTGTGAAGAGAGG - Intergenic
1039364270 8:36914030-36914052 AAACAGGCTTCTGTGAAGATTGG - Intronic
1042985096 8:74574573-74574595 AAACCAGCAATTGTGAATGTAGG + Intergenic
1044337650 8:91006537-91006559 AAATCAGCAACTGTTAAGAGAGG - Intronic
1045449709 8:102310209-102310231 AAACTAGAACCTGTAAAGCTTGG - Intronic
1045833583 8:106493481-106493503 AAATCAGAACCTCTGAGGATGGG + Intronic
1047691126 8:127355612-127355634 AAAAGAGAACCTATGAAGATGGG - Intergenic
1049300046 8:141864755-141864777 CAGCCAGCACCTGTGAATGTCGG - Intergenic
1050535048 9:6623778-6623800 AAACCCACATCTGAGAAGATAGG + Intronic
1052380335 9:27764113-27764135 ATACCAGCATGTGTTAAGATGGG - Intergenic
1052730408 9:32278618-32278640 GTTCCAGCACCTGTGAACATAGG - Intergenic
1055582815 9:77725785-77725807 AAATCAGCAACTGTGAAGTGTGG + Intronic
1056098758 9:83280334-83280356 AGTCCAGCACCTGTGTATATTGG + Intronic
1056476113 9:86952664-86952686 AAACCAGGACATGAGAAGACAGG - Intergenic
1057111555 9:92476983-92477005 AAAGAAGCACCTGTGTAGCTTGG + Intronic
1057875579 9:98751684-98751706 AAACCAGCACCTGAGGGGCTTGG + Intronic
1058337053 9:103843103-103843125 AAAACAGCACCTCTGAAGAAAGG - Intergenic
1059491582 9:114672091-114672113 AAAGTAGCTCCTGTGAAGCTAGG + Intergenic
1060418167 9:123447639-123447661 AACCCAGCACATTTGAAAATTGG + Intronic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1060648397 9:125302663-125302685 AAACCCTCTCCTGTGTAGATAGG + Exonic
1061237937 9:129352876-129352898 AAGCCAGGACCTGTGCAGGTCGG - Intergenic
1062516163 9:136937631-136937653 AGACCAGCAGCTCTGAAGACAGG - Intronic
1203458673 Un_GL000220v1:13618-13640 AAACCTGCTCCTGTCAAGAAAGG - Intergenic
1186980227 X:14950632-14950654 AGCCAAGCACCTGTGAAGAAGGG - Intergenic
1187298198 X:18023050-18023072 AAACCAGACACTGTGATGATAGG + Intergenic
1187404980 X:18995678-18995700 CAACCAGGACCTGTGGAGAAAGG + Intronic
1188688519 X:33100113-33100135 AAACCAGCATCTGTTTGGATTGG - Intronic
1190367128 X:49706100-49706122 AATCCAGCAGCTGAAAAGATTGG + Intergenic
1191873105 X:65766738-65766760 AAACAGGCACCTGTGAAGACAGG - Intergenic
1192488694 X:71553892-71553914 AAATCAGACCCTCTGAAGATAGG - Intronic
1195801117 X:108711929-108711951 GAATCAGTACCTTTGAAGATAGG - Intergenic