ID: 1022469720

View in Genome Browser
Species Human (GRCh38)
Location 7:30674803-30674825
Sequence AATCCTGCTCACACCAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022469720_1022469722 0 Left 1022469720 7:30674803-30674825 CCATTCTTGGTGTGAGCAGGATT 0: 1
1: 0
2: 2
3: 19
4: 128
Right 1022469722 7:30674826-30674848 TCCCCTACCCAAGGACATGATGG 0: 1
1: 0
2: 2
3: 15
4: 183
1022469720_1022469721 -9 Left 1022469720 7:30674803-30674825 CCATTCTTGGTGTGAGCAGGATT 0: 1
1: 0
2: 2
3: 19
4: 128
Right 1022469721 7:30674817-30674839 AGCAGGATTTCCCCTACCCAAGG 0: 1
1: 0
2: 2
3: 8
4: 139
1022469720_1022469729 21 Left 1022469720 7:30674803-30674825 CCATTCTTGGTGTGAGCAGGATT 0: 1
1: 0
2: 2
3: 19
4: 128
Right 1022469729 7:30674847-30674869 GGCCCCTCCTTCCAGGCCCCAGG 0: 1
1: 2
2: 2
3: 62
4: 595
1022469720_1022469728 14 Left 1022469720 7:30674803-30674825 CCATTCTTGGTGTGAGCAGGATT 0: 1
1: 0
2: 2
3: 19
4: 128
Right 1022469728 7:30674840-30674862 ACATGATGGCCCCTCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022469720 Original CRISPR AATCCTGCTCACACCAAGAA TGG (reversed) Intronic
907143565 1:52211423-52211445 AACCCTGCTCAGACTAAGATTGG + Intronic
909996516 1:82286648-82286670 AAACCTCTTCACACCAGGAAAGG - Intergenic
910494222 1:87808517-87808539 AATCTTTCTGACACCAACAAAGG - Intergenic
910597711 1:88997364-88997386 AATCCTGAACACACCAATAATGG + Intergenic
910614354 1:89180772-89180794 TATCCTGGTCATACCAGGAATGG - Intergenic
912415750 1:109507423-109507445 CATCCTGCTCACACCACAATGGG + Exonic
912700329 1:111873473-111873495 AATCCTTCTCACCCCAAGTAGGG - Intronic
914985072 1:152449532-152449554 TGTCCTGCTCAGATCAAGAAAGG - Intergenic
916668189 1:166986650-166986672 AATCCAGCTCACGCAGAGAAGGG + Intronic
918181200 1:182087068-182087090 AACCCAGTTCACACCAAAAAAGG + Intergenic
921519316 1:216140232-216140254 AATACAGCTCCCACAAAGAAAGG + Intronic
924910247 1:248503344-248503366 AATCCTGAACAGACCAATAATGG + Intergenic
924913854 1:248544694-248544716 AATCCTGAACAGACCAATAATGG - Intergenic
1063141849 10:3262872-3262894 AATCCTCCTCACAGCTAGGAAGG + Intergenic
1063874265 10:10455976-10455998 AATCCTGTTGCCACCAAGCAAGG + Intergenic
1064620346 10:17209584-17209606 AGACCTACTCACACCAGGAAAGG + Intergenic
1066850810 10:40109020-40109042 AACTCTGCTCTCTCCAAGAAAGG - Intergenic
1068147609 10:53091001-53091023 CCTCGTGCTCCCACCAAGAAAGG - Intergenic
1069484799 10:68815032-68815054 ACCCCTGCTCACCCCAAAAAAGG + Intergenic
1071346295 10:84697003-84697025 AGTTCTGCTCACCCCCAGAAGGG - Intergenic
1072162104 10:92777742-92777764 TATCCGGCTCTCACCAGGAAAGG - Intergenic
1073138662 10:101233660-101233682 AATCCTGATCACTCCAAAACAGG - Intergenic
1084933589 11:72575384-72575406 CTTCCTGCTCCCACCAAGAAAGG + Intergenic
1085321486 11:75576787-75576809 ACCTCTGCTTACACCAAGAATGG - Intergenic
1091880461 12:3973168-3973190 AATTATGCACACACCAAGCAGGG - Intergenic
1094354182 12:29560055-29560077 AATCCTGATCTCTCCAGGAAGGG + Intronic
1095154539 12:38836002-38836024 AATCCTGTACACACCAATTATGG + Intronic
1100163499 12:91889813-91889835 AATCCTACTCACATCATGAAAGG + Intergenic
1100785793 12:98076625-98076647 CAACCTGCACACACTAAGAAAGG + Intergenic
1101787198 12:107894416-107894438 AATGCTACTAACACAAAGAAAGG - Intergenic
1108797598 13:54050375-54050397 CATGGTGCTCACACCAAAAAAGG - Intergenic
1108798633 13:54065674-54065696 ACTACTGCTAACACCTAGAATGG + Intergenic
1109797276 13:67332506-67332528 AATCATGCTCACACAAACAATGG + Intergenic
1110305546 13:73983318-73983340 AATCATGCTGGCACCAAGAAAGG - Intronic
1110896134 13:80754685-80754707 CATCCTTCTTCCACCAAGAATGG - Intergenic
1110962518 13:81646456-81646478 ATTCCTGCTCAAAACAGGAAAGG - Intergenic
1111224279 13:85249077-85249099 AATGCTGCCCGCAGCAAGAAGGG - Intergenic
1113208236 13:107941994-107942016 GATACTTCTCCCACCAAGAAAGG + Intergenic
1113695361 13:112342335-112342357 AATCCTGATCACACCAGGAAAGG - Intergenic
1114600403 14:23951730-23951752 AACCCTGCCCACACAAGGAAGGG + Intergenic
1114604582 14:23986564-23986586 AACCCTGCCCACACAAGGAAGGG + Intronic
1116365022 14:44049284-44049306 AATCCAGCTCACATTAAGCAAGG + Intergenic
1120550354 14:85863813-85863835 AAGCATGCTCAGAACAAGAAGGG - Intergenic
1123110006 14:105862708-105862730 AACCCTGCTCTCATCAAGACCGG + Intergenic
1128057166 15:64708711-64708733 AATCAAGCTTAGACCAAGAATGG - Intergenic
1129985964 15:79919949-79919971 AACTCTGCACAGACCAAGAAAGG - Intronic
1131746260 15:95451779-95451801 AATCCTGCTGAAAACAGGAAGGG - Intergenic
1131952097 15:97692268-97692290 AATCCTGCCCAAACCATGCATGG + Intergenic
1132170290 15:99644814-99644836 ACTCTTGCTCACCCCAAGGAGGG + Intronic
1135516981 16:23144333-23144355 AATCCTGCTCAGTTCTAGAAGGG - Intronic
1136686739 16:31999425-31999447 AATCCTCCTCAGGCCTAGAAGGG + Intergenic
1137076592 16:35972545-35972567 CATCCTGCTCAATCAAAGAAAGG + Intergenic
1139724773 16:68888288-68888310 AATCCTTCTCATACCAGGGAGGG - Intronic
1140527533 16:75636000-75636022 AATCCTGGTAAAACCAAGAAGGG - Exonic
1141396906 16:83713266-83713288 AATCCAGCACACACCAGAAATGG + Intronic
1141611191 16:85182089-85182111 AAGGCTGTTCACACCAAGCATGG + Intronic
1142565337 17:836430-836452 AATGCTGCTCACAGAAAGGATGG - Intronic
1147692721 17:42326916-42326938 AAGCCTCACCACACCAAGAAGGG + Intronic
1148731408 17:49839060-49839082 ATTCCTGCCCACACCATGCATGG + Intronic
1148891257 17:50809006-50809028 ACTCCAGCTCACACCAAGAGAGG + Intergenic
1149557220 17:57582100-57582122 ACCCCTCCCCACACCAAGAAGGG - Intronic
1154495841 18:14960174-14960196 AATCCAGATCAAACCAAGAATGG - Intergenic
1156600806 18:38603833-38603855 CAGTCTGCTCACAGCAAGAATGG - Intergenic
1157015514 18:43707941-43707963 TGTCCTGATCTCACCAAGAATGG + Intergenic
1158281141 18:55829164-55829186 AAACTTGATCACACCAGGAAAGG - Intergenic
1160060938 18:75528084-75528106 GATGCTGCTCCCACCAGGAAGGG - Intergenic
1161553524 19:4927876-4927898 AATCCTGCTCGCACCAGGCACGG + Intronic
1164131126 19:22362670-22362692 AATCTTAGTCACAGCAAGAAAGG + Intergenic
1164450750 19:28362203-28362225 CATCCTGCTACCAGCAAGAAAGG - Intergenic
927251226 2:20996532-20996554 CATCCCTCTCACCCCAAGAATGG + Intergenic
928436719 2:31259227-31259249 AACCCTGCTCAGACTCAGAATGG + Intronic
931704351 2:64934960-64934982 ACTCCTGCTCCCTCCAAGAATGG + Intergenic
931861609 2:66360516-66360538 AATACTGCTCAGCCAAAGAAAGG - Intergenic
931998831 2:67864962-67864984 AATGCTGGTCACACAAAGAATGG - Intergenic
933177829 2:79195782-79195804 AATCCTCCTCACACAAAGCAAGG + Intronic
935041680 2:99436029-99436051 AAACATGCTTACACCCAGAATGG + Intronic
935755071 2:106270471-106270493 AATCCTGATCACCCCAAAGATGG + Intergenic
939722801 2:145676455-145676477 AATCATGCTTACTCCTAGAAAGG + Intergenic
942436642 2:175985008-175985030 AATACTGCTCAGAGAAAGAAAGG + Intronic
943647898 2:190427344-190427366 ACTCCTGCCCACACCATCAAAGG - Intronic
944445077 2:199780828-199780850 GATCCTGGTCACACCAGGAAAGG - Intronic
945099862 2:206253830-206253852 ATTCCTGCTCAAAACAAGACTGG - Intergenic
946039782 2:216773675-216773697 AATGCTGCTGACAGCCAGAATGG - Intergenic
947944810 2:234092411-234092433 AATCCTCCCCTGACCAAGAATGG + Intergenic
1169542630 20:6616900-6616922 ATTGCTTCTCTCACCAAGAAGGG - Intergenic
1170932314 20:20780298-20780320 AATCCTGCTAGCATCTAGAAGGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176343081 21:5716116-5716138 AAACCTGCTCCTGCCAAGAAAGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176475335 21:7148267-7148289 AAACCTGCTCCTGCCAAGAAAGG - Intergenic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176501746 21:7608340-7608362 AAACCTGCTCCTGCCAAGAAAGG + Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176537402 21:8114185-8114207 AAACCTGCTCCTGCCAAGAAAGG - Intergenic
1178049825 21:28735355-28735377 AATTCTGCTGACACCAAGAATGG - Intergenic
1178233324 21:30812647-30812669 AAATATGCACACACCAAGAAAGG + Intergenic
1178985447 21:37298968-37298990 AAACCAGCACACACCAAGATGGG - Intergenic
1183208607 22:36435929-36435951 AATCCTGCTCACAGTTACAAAGG + Intergenic
1184475096 22:44716044-44716066 AATGCTGTTCACACCAAGGAGGG - Intronic
953964846 3:47296204-47296226 CATCCTGCTCAGACCAGTAAGGG - Intronic
954264247 3:49460772-49460794 AACCCTCCACACACCATGAATGG + Intergenic
954514144 3:51156395-51156417 AATCCTGCTCACCAGATGAATGG + Intronic
957231734 3:77526733-77526755 ATTCCTGTTCACACTGAGAACGG - Intronic
960083676 3:113568149-113568171 AATACTAGTCACACCAAGAAAGG - Intronic
962804495 3:138917049-138917071 ATTCCTGCCCACACCAGGAAGGG - Intergenic
963750850 3:149178259-149178281 AATCCTGTTCAAAACAAAAAGGG - Intronic
963938120 3:151075231-151075253 AATGCTGTTGTCACCAAGAAGGG + Intergenic
965661782 3:171049697-171049719 ATTCCTGCTCACAGCAGGATGGG + Intergenic
966791119 3:183670656-183670678 AATACTGCTCACACTGAGAATGG - Intronic
969118726 4:4891062-4891084 AAGCCTGCTAATGCCAAGAAAGG + Intergenic
971470513 4:27020982-27021004 AATACTGTTCACTCCATGAAAGG - Intronic
971601999 4:28604727-28604749 CATCATGTTCACTCCAAGAAGGG + Intergenic
972769600 4:42184695-42184717 AGTAATGCTGACACCAAGAAAGG + Intergenic
977645424 4:99406432-99406454 AATGCTGCGCACACCATGCAGGG - Intergenic
979391421 4:120132549-120132571 AAAGCTGCTCAGCCCAAGAAAGG + Intergenic
983285813 4:165737582-165737604 AATTCTGATAATACCAAGAAAGG + Intergenic
986387343 5:7247668-7247690 AAAGCAGCTGACACCAAGAAGGG + Intergenic
987026583 5:13932968-13932990 ACTGCTCCTCACAACAAGAATGG - Intronic
988259117 5:28860713-28860735 AATCCTTCTCACAACAGGTAAGG - Intergenic
994632385 5:102302005-102302027 AATCATGCTTACACTAAAAATGG + Intergenic
997343329 5:133164575-133164597 ACTCATGCTCAAAACAAGAAGGG - Intergenic
1001865760 5:175103990-175104012 AAGCCTGCTAGCACCAACAACGG - Intergenic
1006143144 6:31943114-31943136 CATCCTCCCCACACCAAGGAGGG - Intronic
1014631082 6:123790470-123790492 ATTCCAGCTCACAGCAACAAAGG + Intergenic
1016642786 6:146369025-146369047 AAGCCTGAACACACCAATAATGG - Intronic
1018631268 6:165825217-165825239 AGCCCTGCTCACATCAGGAACGG - Intronic
1022469720 7:30674803-30674825 AATCCTGCTCACACCAAGAATGG - Intronic
1024734559 7:52290552-52290574 AACCCTGCACATTCCAAGAAAGG + Intergenic
1024752203 7:52480122-52480144 GCTGCTGCTCACTCCAAGAATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1028033152 7:85944245-85944267 AATCTTTCTGACACAAAGAAAGG - Intergenic
1034947391 7:155271819-155271841 AGTCCTGCCCACACCCAAAATGG - Intergenic
1036527655 8:9550146-9550168 AATCCTGACCACAGCCAGAAGGG + Intergenic
1037611033 8:20476531-20476553 GTTCCTGCTCACAGTAAGAAGGG + Intergenic
1038321558 8:26531850-26531872 AAGCCTGCTCCCACCAAGACCGG - Intronic
1039922261 8:41901676-41901698 AATCCGGCACACACCCACAAAGG + Intergenic
1046111052 8:109725378-109725400 AATCCTGAACAGACCAATAATGG + Intergenic
1050296267 9:4208522-4208544 AATCCTGCCCACTCCAGCAATGG - Intronic
1051869212 9:21716844-21716866 AATCCTGAACAGACCAATAATGG + Intergenic
1052948420 9:34187526-34187548 AATACTGTCCACACAAAGAAAGG - Intronic
1058631530 9:106993266-106993288 AATCCTGGTACCAGCAAGAAAGG + Intronic
1059680611 9:116581850-116581872 AATACTGGACACAGCAAGAACGG + Intronic
1062152730 9:135030223-135030245 ACACCTGCTGTCACCAAGAACGG - Intergenic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1203416162 Un_KI270593v1:816-838 AAAACTGCTCAAACAAAGAAGGG - Intergenic
1185908279 X:3958181-3958203 ATGTCTCCTCACACCAAGAATGG - Intergenic
1186664501 X:11704037-11704059 AACCCTGCTCACAGCAGGGATGG + Intergenic
1190277828 X:48910664-48910686 GATCCTCCTCATACCCAGAATGG + Intronic
1202008724 Y:20308888-20308910 GATCTTGCTCACTTCAAGAATGG + Intergenic