ID: 1022470456

View in Genome Browser
Species Human (GRCh38)
Location 7:30678951-30678973
Sequence CACCATCTGGAGAGGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022470456 Original CRISPR CACCATCTGGAGAGGGAGCC TGG (reversed) Intronic
900378929 1:2374067-2374089 CACCATGGGGAGAGGGAGGGTGG + Intronic
900594129 1:3472724-3472746 CACCAACTGGACAGGGCACCAGG + Intronic
901210961 1:7525854-7525876 CACGGTCTGAAGAGGGAGGCAGG + Intronic
901446982 1:9314508-9314530 CACCAAATGGAGAGAGAGGCAGG + Intronic
901493587 1:9608922-9608944 CACCCTCTGGCGATGGAGACCGG - Intronic
901511167 1:9718677-9718699 CACCAGCTGTAGAAGGTGCCGGG - Exonic
901934080 1:12616274-12616296 AGCCATCAGGAGAGGGAGGCAGG - Intronic
902301723 1:15506869-15506891 CACTATCTGTGGAGGGAGACAGG - Intronic
902395331 1:16129378-16129400 CAGCCTCTGGAGTGGGAGGCGGG + Intronic
902634439 1:17726000-17726022 CACCAGGTGGAGAGGGGGCTGGG - Intergenic
903606721 1:24580325-24580347 CCCCGTCTGCAGAGGCAGCCAGG - Intronic
905183066 1:36178402-36178424 CAGCGTCTGGAGGGGGATCCGGG - Exonic
905211099 1:36374671-36374693 CTCCATCCAGAGAGGTAGCCTGG + Intronic
909468901 1:76004253-76004275 CATCCTCTAGAGAGGGAGCTAGG - Intergenic
911146178 1:94554621-94554643 CCCCATCTGGACAGGGAGGGAGG - Intergenic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
912701566 1:111882033-111882055 CAGCAGCTGTAGAGGGAGGCAGG + Intronic
913172134 1:116242735-116242757 CACCACCTTCAGAGGGAGGCTGG - Intergenic
913597612 1:120393796-120393818 CACCATGTGGTGAGGGAGCCTGG + Intergenic
914089718 1:144485518-144485540 CACCATGTGGTGAGGGAGCCTGG - Intergenic
914308892 1:146448698-146448720 CACCATGTGGTGAGGGAGCCTGG + Intergenic
914512435 1:148345792-148345814 CACCATGTGGTGAGGGAGCCTGG - Intergenic
914593217 1:149124433-149124455 CACCATGTGGTGAGGGAGCCTGG - Intergenic
914939935 1:152013828-152013850 CACCATGTGGTGAGGCAGCCTGG + Intergenic
918651139 1:186964897-186964919 CACCCTCAAGAGAGGCAGCCTGG + Intronic
919570709 1:199243637-199243659 CACCATCTGGAGGAGGATCTGGG + Intergenic
920435828 1:205946529-205946551 CACAATCTGGTGAGGAAGACAGG + Intergenic
923234446 1:232019110-232019132 CATCATCTGGTGAGGGAGACAGG + Intronic
923391074 1:233515116-233515138 CACCAGCTGGAGACTCAGCCCGG - Intergenic
924061686 1:240181592-240181614 TGCCAACTGCAGAGGGAGCCAGG - Intronic
924141528 1:241028788-241028810 CACCATCTGGGTAGTGAGGCAGG + Intronic
1063183338 10:3626988-3627010 CACCATATGAAGATGAAGCCGGG + Intergenic
1064918305 10:20486954-20486976 CAGGAGCTGGGGAGGGAGCCTGG + Intergenic
1065204314 10:23343350-23343372 CACCATGTGGAGACACAGCCAGG + Intronic
1065774057 10:29102939-29102961 GGCCAGCTGGAGTGGGAGCCCGG - Intergenic
1067456906 10:46425559-46425581 GGCCTTCTGGAGAGGGAGGCAGG - Intergenic
1067804377 10:49382914-49382936 CACCTGCTGGAGAGGGACCCCGG + Intronic
1068939675 10:62668660-62668682 CACCACAGGGCGAGGGAGCCAGG - Intronic
1070722822 10:78768390-78768412 TTACATCTGGAGAGGGAGACGGG + Intergenic
1071603940 10:86971904-86971926 CAGCATCTGGACTGGCAGCCAGG - Intronic
1072310011 10:94145667-94145689 CACCACCTGGAGGTGGGGCCAGG - Intronic
1072613415 10:97034340-97034362 TGCCCTCTGGAGAGGGTGCCGGG - Intronic
1072623167 10:97094082-97094104 CACCTTCTGGAAAGGCAGCTAGG + Intronic
1073072189 10:100801690-100801712 CTCCATTTGGGGAGGGTGCCAGG + Intronic
1076417785 10:130303881-130303903 CTCCATCTGGAGAAGGTTCCAGG + Intergenic
1079613989 11:22467940-22467962 CACCATCTGCACAAGGAGACAGG + Intergenic
1080406543 11:31985058-31985080 CACCAGCTGGAGGTGGATCCAGG + Intronic
1080772583 11:35355548-35355570 CACCAGCTGTAGAGGGAGTGAGG + Intronic
1081478250 11:43458267-43458289 GACCATGTAGAGATGGAGCCTGG - Intronic
1083048606 11:59757196-59757218 CACCACCAGGAGAGGAACCCAGG + Intronic
1084157359 11:67321363-67321385 CATTCTCTGGAGAGGGAGCACGG - Intronic
1084214594 11:67640522-67640544 GACAACCTGGAGAGGGTGCCCGG - Intergenic
1084950145 11:72660495-72660517 CGCAACCTGGAGAGGGAGCCAGG + Intronic
1084973516 11:72784019-72784041 CACCTGCTGGCGAGGTAGCCTGG - Intronic
1085679227 11:78555441-78555463 CACCCTCTGAAGACTGAGCCAGG - Intronic
1086420603 11:86633829-86633851 CACCATCTAGAGGGGAAACCTGG + Intronic
1088325052 11:108593035-108593057 CGCGATCTGGAGAGGAATCCTGG - Intronic
1088598566 11:111457047-111457069 CACCACCTGGACAGGGATACAGG - Intronic
1088610551 11:111572220-111572242 AACCATCTGGCAAGGGAGCTGGG - Intergenic
1090360927 11:126172081-126172103 CACCTGCTGTAGAGGGATCCCGG + Intergenic
1091340227 11:134806353-134806375 CACTTTCTGGGGTGGGAGCCTGG - Intergenic
1091670800 12:2450877-2450899 CACCATCTTGTGAGAGTGCCTGG + Intronic
1091782456 12:3222560-3222582 CAGCATCCAGAGAGGCAGCCGGG - Intronic
1092406680 12:8226526-8226548 GACCAGCTGAAAAGGGAGCCAGG - Intronic
1092934569 12:13348651-13348673 CTCCTTCTGGAGAAAGAGCCTGG - Intergenic
1096392820 12:51242446-51242468 CACCATCTGGTGAGGAACCAAGG + Exonic
1096752761 12:53772650-53772672 TGGCATCTGGAGAGGGAGGCTGG + Intergenic
1098637213 12:72799108-72799130 CACCATTTGGAGATGGGGACTGG + Intergenic
1102130882 12:110527919-110527941 CCCCAGCAGGGGAGGGAGCCTGG + Intronic
1104104248 12:125644197-125644219 CTCAATCTGCAGGGGGAGCCTGG - Exonic
1105546028 13:21351844-21351866 CAGCATCTGGAGAGGATGGCTGG + Intergenic
1107665778 13:42689000-42689022 AACAATCTGGTGAGGGAGCAGGG - Intergenic
1107957296 13:45527919-45527941 CTCCATCTCGAGAGAGAGCTAGG + Intronic
1107994755 13:45849158-45849180 CAGGATTTGGAGAGGGCGCCAGG - Intronic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1113148869 13:107239889-107239911 CACCTGCTGGAGAGGGACCATGG + Intronic
1113420083 13:110164547-110164569 CCCCATCTGGAGCGGGAGGCAGG + Intronic
1113651949 13:112039733-112039755 CAGGCTCTGGAGATGGAGCCGGG - Intergenic
1114725035 14:24927263-24927285 GACCCTCTGGAGAGTGAGCCAGG - Intronic
1115729573 14:36254174-36254196 CACGCTCTGTAGAGGGAGACAGG + Intergenic
1118305921 14:64655327-64655349 CTCCATTTGGAGAGGCAGCTTGG + Intergenic
1118776761 14:68978530-68978552 CGCCATATGGAGAGGTGGCCAGG + Intronic
1118864595 14:69693105-69693127 CACCATCTGGAGGTGGAGGTAGG + Intronic
1119477458 14:74939372-74939394 CGCCATCTGGACAGGGAGGTTGG - Intergenic
1119783919 14:77298292-77298314 CACCCTCCAGAGATGGAGCCTGG - Intronic
1121290516 14:92771106-92771128 CAACATCTAGAGAGGTAGCTGGG + Intergenic
1121541810 14:94733531-94733553 AACCTTCTGGAGAAGTAGCCTGG - Intergenic
1126233437 15:46354280-46354302 CACCATATGGAGAGGAGCCCAGG + Intergenic
1126848560 15:52784344-52784366 AAGCATCCGGAGAGGGATCCCGG - Intronic
1128390684 15:67180589-67180611 CATCATCTGCAGACTGAGCCTGG - Intronic
1128657946 15:69476248-69476270 CAGCAACTAGAGAAGGAGCCAGG - Intergenic
1128760482 15:70213226-70213248 CACCAGCCGGCCAGGGAGCCTGG - Intergenic
1128904879 15:71457843-71457865 CACATTCTGGAGAGGAAGACAGG - Intronic
1129389211 15:75212252-75212274 CACCTTCTGGACTGGGAGCAGGG - Intergenic
1129417274 15:75392685-75392707 CACCATGTGAAGAGGCAGACAGG - Exonic
1130313953 15:82779259-82779281 GACCATGTGGAGAGGAAGCCTGG - Intronic
1130668567 15:85890478-85890500 CTCCATCCTGAGAGGGAGCTGGG + Intergenic
1130977981 15:88791963-88791985 CACAATCTGGTGAGGGAGGGAGG + Intergenic
1131269119 15:90935697-90935719 CTCAAGCTGGTGAGGGAGCCTGG + Exonic
1132031791 15:98444618-98444640 CACCACGTGGAGAGAAAGCCTGG + Intronic
1132316289 15:100892743-100892765 TACCATTTGGAGAGGGAGTGGGG - Intronic
1132495210 16:259914-259936 CACCATCTGGGCAGGCAGGCCGG - Intronic
1132676400 16:1123048-1123070 CCCCATCAGTAGAGGGGGCCAGG + Intergenic
1132783891 16:1643763-1643785 AACCAAATGAAGAGGGAGCCTGG + Intronic
1132884721 16:2177620-2177642 CAGCCCCTGGAGAGGGGGCCAGG + Exonic
1133003870 16:2866759-2866781 CAGCATTTGAAGAGGGAACCAGG + Intergenic
1133349152 16:5090048-5090070 CACCACCTGCACAGGGTGCCCGG + Intronic
1133466717 16:6034492-6034514 CACCATATGAAGATGCAGCCAGG - Intronic
1134811831 16:17174109-17174131 CACCCTCTGGAGGGCCAGCCAGG - Intronic
1138806113 16:60090674-60090696 CACTCTCTAGAGAGGGAGCTTGG + Intergenic
1139339944 16:66261990-66262012 CTCCATCTGGGCTGGGAGCCTGG + Intergenic
1139839505 16:69867265-69867287 CACCTGCTGGTGAGTGAGCCTGG - Intronic
1140131049 16:72162035-72162057 CACCATCAGGGAATGGAGCCTGG + Intronic
1140478738 16:75251457-75251479 AACCACCTGGTGAGGGCGCCAGG - Intronic
1141010729 16:80395944-80395966 CACCATGTTGTGAGGAAGCCAGG - Intergenic
1142356094 16:89602776-89602798 CACCAGCTGGACAGGGGTCCTGG - Intergenic
1142811349 17:2396983-2397005 CAACAACTGGAGTGTGAGCCAGG + Intronic
1143448634 17:7022936-7022958 CGCCATCTGGAGAGCGAGGGAGG + Intergenic
1143462858 17:7114958-7114980 CACCATTTGGAAGGGGTGCCAGG + Intronic
1144008449 17:11122724-11122746 AACCATCTGGAAAGAGAGCCTGG + Intergenic
1145236891 17:21214558-21214580 CCCCAGCGGGAGAGGCAGCCTGG - Exonic
1145895961 17:28458166-28458188 GACCATGGGGAGAGGGAGCGGGG - Intronic
1146181018 17:30698090-30698112 CACCAGCTGGAAGGGGAGCCCGG - Intergenic
1146264769 17:31445118-31445140 CACCATCTGCAGCAGGAGCTTGG - Intronic
1146308101 17:31746124-31746146 CACCATCTGGAGTGGGAAATGGG - Intergenic
1146835674 17:36108661-36108683 TCCCATCTGGAGAGTGAGCTGGG - Intergenic
1146850306 17:36215931-36215953 TCCCATCTGGAGAGTGAGCTGGG - Intronic
1147459403 17:40558722-40558744 CACCATCTGCTGAGTGACCCTGG - Intronic
1148776597 17:50099221-50099243 GACCAGGTGGAGAGGCAGCCAGG - Intronic
1149658046 17:58320479-58320501 CACCATCTTGGGAGGAAGGCGGG - Intronic
1149991487 17:61385971-61385993 CACCTGCTGGGGAGGGAGGCTGG + Intronic
1151197225 17:72440242-72440264 GGACACCTGGAGAGGGAGCCTGG - Intergenic
1152435085 17:80271561-80271583 CACCATCTGGAGTGTGTGTCAGG + Intronic
1152604159 17:81280728-81280750 CACGATCTGCAGAGGGAGAGGGG + Exonic
1152823462 17:82449196-82449218 CTCCATCTGAAGAGGGCTCCAGG - Exonic
1153332683 18:3889990-3890012 CACCCTCTGGGCAGGGAGCCAGG - Intronic
1155044305 18:22090130-22090152 CAGCAAATTGAGAGGGAGCCAGG + Intronic
1155359541 18:24986312-24986334 CACCTTCAGGAGAGGCAGCCTGG + Intergenic
1157489959 18:48116243-48116265 GACCAGCGGGAGAGGCAGCCTGG - Intronic
1157824422 18:50800022-50800044 CAGCAGCTGGTGAGTGAGCCAGG - Exonic
1160072891 18:75643676-75643698 CAGCAGCAGGTGAGGGAGCCAGG - Intergenic
1160842897 19:1154397-1154419 CATGATCTGCAGAGGGAGACGGG + Exonic
1161322145 19:3646234-3646256 CTCCCTCTGGGGAGGGAGACTGG + Intronic
1161325011 19:3659348-3659370 CAGCATCTGGGGAGCCAGCCCGG - Intronic
1161443183 19:4304101-4304123 CACCGTCTGCTGAGGGACCCTGG + Intergenic
1161656940 19:5522202-5522224 CACTCCCTGGAGAGGGATCCTGG - Intergenic
1162930428 19:13954679-13954701 CACCATCTGAAGGGCCAGCCTGG - Intronic
1162977580 19:14217489-14217511 CACCAGCTGAAAGGGGAGCCCGG + Intergenic
1163011447 19:14429089-14429111 CTCCATCTGGGGAGGCAGCCTGG + Intergenic
1163163615 19:15480387-15480409 CACCAGCTGGAGACTCAGCCAGG + Intronic
1163281308 19:16319703-16319725 CACCGTCTGGGGAGGAAGCCAGG + Intergenic
1163514768 19:17756142-17756164 CCCCAGCTGGGGAGGGAGCAAGG - Intronic
1163688177 19:18724168-18724190 CACCATCTGCAGAGGGGACGAGG - Intronic
1164017782 19:21268080-21268102 AACCATCTGGAAATGCAGCCCGG - Intronic
1164027601 19:21366962-21366984 AACCATCTGGAAATGCAGCCTGG + Intronic
1165958107 19:39514825-39514847 CCCCTACTGGACAGGGAGCCTGG + Intergenic
1166049818 19:40252035-40252057 CTCCAGCTGGAGAGGCAACCAGG + Intronic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1166344626 19:42157432-42157454 CACCATCTGGAGATGCAGAGAGG - Intronic
1166414302 19:42582193-42582215 TACTATCTGGAGTGGGACCCAGG - Intronic
1167547941 19:50140424-50140446 GACCATGTGGAGAGGGAGACGGG - Intergenic
1167949816 19:53016983-53017005 CTCCATCTGGGGAGGGCGGCGGG + Intergenic
1168061015 19:53892341-53892363 CCCTAGCTGGAGAGAGAGCCCGG + Intronic
1168344185 19:55642492-55642514 CAGCATCTGGAGCGGCAGCTGGG - Exonic
925115918 2:1378310-1378332 CAGAAACTGGAGAGGGAACCAGG - Intronic
925595140 2:5548122-5548144 CACCATGTGGAGAAAGATCCAGG - Intergenic
925761379 2:7187941-7187963 CACCATGTGCAGAAGGTGCCTGG + Intergenic
927119034 2:19936743-19936765 CACCATCTTGAAAGTGAGACAGG + Intronic
927149494 2:20187541-20187563 CACCATGTGGGGAGGGAGGCCGG - Intergenic
927508569 2:23630144-23630166 CAGCACCAGGAGTGGGAGCCAGG + Intronic
927730344 2:25465539-25465561 AACCAGCTGGAGAGGCAGCAAGG - Intronic
927961388 2:27242464-27242486 GACGATCTAGAGAGGGAGGCAGG + Intronic
928108940 2:28490869-28490891 TCCCATCTGGAGAGGCTGCCAGG + Intronic
934575133 2:95395453-95395475 AACCATGTGCAGAGGCAGCCAGG + Intergenic
935476153 2:103526960-103526982 GACCATCTGGGCAGGGACCCAGG - Intergenic
935541544 2:104354415-104354437 CACCTTCCGGAGAGTGAGGCCGG + Intergenic
936054103 2:109247834-109247856 GACCATGTGGAGAGGAACCCAGG - Intronic
937879005 2:126851143-126851165 CAGCAGCTGCCGAGGGAGCCAGG - Intergenic
938467075 2:131531223-131531245 CACCTTCTGCAGAGTGAGCCGGG + Intronic
939623484 2:144448646-144448668 CAAAATCTGGAGAGGGGGCGTGG + Intronic
942149192 2:173057787-173057809 CACCATGTGGACTGGCAGCCTGG + Intergenic
944696043 2:202201370-202201392 CACCATCTGGTGAGGAACCAAGG - Intergenic
945736830 2:213611046-213611068 CTCCATCTTGAGTGGGAGCTAGG - Intronic
946131728 2:217611775-217611797 CACCATCTGGAGATTCATCCAGG + Intronic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
948338750 2:237232154-237232176 AAGCATCTGGAGAGGGAGAGGGG - Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
1169059759 20:2652825-2652847 CAGCACCTGGAACGGGAGCCGGG - Exonic
1169656036 20:7924038-7924060 CACCCTCTGGAGAGGGTCACAGG + Intronic
1171208832 20:23301600-23301622 GAACATCTGGAGAGGGAGCAGGG + Intergenic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1172479796 20:35264266-35264288 CACCATCTGGTGTGGGAGGGAGG - Intronic
1172598741 20:36168891-36168913 CACCATCCTGAGAGGGAGGGAGG + Intronic
1172639871 20:36434450-36434472 TACCATTTTGAGAGGAAGCCCGG - Intronic
1172752309 20:37259361-37259383 CCACTTCTGGAGAGGCAGCCTGG - Intronic
1172891938 20:38271653-38271675 CACCTTCTGGTGAGTGAGGCAGG + Intronic
1174103635 20:48146669-48146691 CACCTCCTGGAGAGGGACCACGG + Intergenic
1174342622 20:49907423-49907445 CTCCATATGAAGAGAGAGCCTGG + Intronic
1176216207 20:63949135-63949157 CACCATCAGGGGAGTGAGCACGG + Intronic
1177549102 21:22597947-22597969 CAGCAGCTGCAGAGGGTGCCGGG + Intergenic
1177971131 21:27790993-27791015 CACCCTCTGAAGATCGAGCCAGG + Intergenic
1178254951 21:31043981-31044003 CAGCATCTGCAGCAGGAGCCTGG - Intergenic
1178670148 21:34582877-34582899 CATCATCTGAAGAGGCACCCAGG + Intronic
1181622589 22:24101136-24101158 CAGCAGTGGGAGAGGGAGCCAGG + Intronic
1182800009 22:33024354-33024376 GAGCCTCTGGAGAGGAAGCCTGG - Intronic
1185153633 22:49180321-49180343 CCACATGTGCAGAGGGAGCCTGG - Intergenic
1185238592 22:49728602-49728624 CAACATCTGGAGAGAAAGCAGGG - Intergenic
1185259290 22:49853012-49853034 CACCGGCTGGAGCGGGAGCGTGG - Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
950104173 3:10377821-10377843 CAGCAGCTGGAGAGGGTGCAGGG - Intronic
950430699 3:12949341-12949363 CACCCTCTTCAGAGGGGGCCGGG + Intronic
951027618 3:17846315-17846337 CAGCAGCTGGAGAGGAAGTCAGG - Intronic
952075647 3:29694123-29694145 CAGCCTCTGGAGAGTGAGGCAGG + Intronic
952819225 3:37471564-37471586 GTGCAGCTGGAGAGGGAGCCAGG + Intronic
953029804 3:39171593-39171615 CACCATATTGTGAGGAAGCCTGG + Intergenic
955044710 3:55348877-55348899 CACCATGGGGAGGGGGAGGCAGG - Intergenic
955222292 3:57032968-57032990 CACCATCAGGAGATGAAGCTAGG + Intronic
955398414 3:58573769-58573791 TACCCTCTGGAGCTGGAGCCTGG + Intronic
956773938 3:72549701-72549723 CAGCATTTGGAGAGGGTCCCGGG + Intergenic
959961347 3:112302631-112302653 CACCATCTGGGGAGGGGCGCTGG - Intergenic
960479547 3:118171542-118171564 CAGCAGCTGCAGAGGGTGCCCGG + Intergenic
960722987 3:120642841-120642863 AACCAGCTGGCTAGGGAGCCCGG + Intronic
960997336 3:123348790-123348812 CACCAGCCTGATAGGGAGCCTGG - Intronic
961390293 3:126548660-126548682 TCCCACCTGGGGAGGGAGCCTGG + Intronic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
961797255 3:129418407-129418429 CACCATCTGGCGGGACAGCCGGG + Exonic
962740364 3:138358917-138358939 CACCAGCTGGAGGCGGAACCAGG - Intronic
963646821 3:147925329-147925351 CACCTACTGGAGAAGGAGCTGGG + Intergenic
964203487 3:154144646-154144668 CACCATCTACAGACAGAGCCAGG - Intronic
966878165 3:184335377-184335399 CACCTTCTCTAGAGGGAGCAGGG - Intronic
967810982 3:193760765-193760787 CTCCATCAGGAGAGAGAGCTGGG - Intergenic
967889666 3:194356309-194356331 GCCCATCTGGAGTGGGAGCTGGG - Intronic
968501042 4:950213-950235 GACCAGCTGGAGACGGAGGCTGG + Intronic
968589877 4:1452031-1452053 CATCACTTGGAAAGGGAGCCTGG + Intergenic
968944277 4:3655379-3655401 CCCCAGCTGGATAAGGAGCCCGG + Intergenic
968966108 4:3769789-3769811 CATCATCTGGGGTGGAAGCCAGG - Intergenic
968975981 4:3822255-3822277 GACCAGATGGAGAGGGAGACGGG - Intergenic
969302135 4:6303425-6303447 CTCCAGCTGGAGATGAAGCCAGG - Intergenic
969504582 4:7576898-7576920 TACCATCTGGAAATGGGGCCGGG + Intronic
969627937 4:8317148-8317170 CACCAAGGGGAGAGGGAGCTGGG + Intergenic
970653646 4:18205835-18205857 CACCGTCTGGAGAGAAAGACAGG - Intergenic
971635365 4:29049819-29049841 GATCATCTGCAGAGGGAGCGGGG + Intergenic
971739235 4:30499310-30499332 CAACATCTGTAGAGAGAGCCTGG - Intergenic
972480274 4:39489956-39489978 CAACCTCTGAAGAGGGAGTCTGG - Intergenic
972605482 4:40609741-40609763 TACCATTTGGAGAGGGATTCCGG - Intronic
980039288 4:127920792-127920814 CAGCATCTGGAAGTGGAGCCCGG - Exonic
982312888 4:154004066-154004088 CACCATCTGCTGAGGAGGCCTGG - Intergenic
983469319 4:168137012-168137034 CACCCTCTGGAGCAGCAGCCTGG + Intronic
984693426 4:182754795-182754817 TACCATCTGGAGAAGCAGCCAGG - Exonic
984706745 4:182852769-182852791 CCCCATCTGGAAATGGAGCAGGG - Intergenic
984852535 4:184166918-184166940 CACCACCTGCAGGCGGAGCCTGG - Intronic
985089479 4:186348673-186348695 CAGAAGCTGGGGAGGGAGCCTGG - Intergenic
985356611 4:189126667-189126689 CACCAGCTGCACAGGAAGCCTGG + Intergenic
985939080 5:3120019-3120041 GACCACCTGGGGAGGGGGCCAGG + Intergenic
986306396 5:6519995-6520017 AACCAGCTGGGGAGAGAGCCAGG - Intergenic
986517527 5:8579878-8579900 CACCAACTGAAGACGGATCCAGG - Intergenic
986662089 5:10068208-10068230 CACCATCCTGAAAGAGAGCCAGG - Intergenic
989183108 5:38597750-38597772 GACCAGCTGGAGACGGAGCGTGG + Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
996149369 5:120016665-120016687 CTCCATCTTAAGAGGGGGCCAGG + Intergenic
1000995166 5:167951166-167951188 CACCTTTTGGAGATGTAGCCCGG + Intronic
1001058005 5:168465110-168465132 TCCCATCAGGAGAGGGATCCAGG + Intronic
1001495215 5:172183271-172183293 CACAATGTGGACAGGGAGCATGG - Intronic
1003270935 6:4607231-4607253 CACCATCTGGAGTGGAGTCCGGG - Intergenic
1003372010 6:5537561-5537583 CTCCAACTCGAGAGGAAGCCCGG - Intronic
1003372016 6:5537589-5537611 CTCCAACTCGAGAGGAAGCCCGG - Intronic
1003372022 6:5537617-5537639 CTCCAACTCGAGAGGAAGCCCGG - Intronic
1003405584 6:5824593-5824615 CAGCATCTGGAGAGGATGGCTGG - Intergenic
1004704862 6:18115314-18115336 CACCATCAGGTGAGTGATCCAGG + Intergenic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1006300768 6:33192577-33192599 CTCCACCTGGGGAGGGAGGCGGG + Intergenic
1007172859 6:39876850-39876872 GACCCTCTGAAGAGGCAGCCTGG + Intronic
1007254351 6:40518275-40518297 CACCAGCTGGAGAGAGAGCAGGG - Intronic
1010193305 6:73214949-73214971 GACCACCTGAGGAGGGAGCCTGG + Intronic
1011861711 6:91765825-91765847 GGCCACCTGGAGAGGCAGCCAGG + Intergenic
1012987120 6:105887047-105887069 CACCATCTGGACAAGAAGACAGG + Intergenic
1015289228 6:131519894-131519916 CTCCATCTGGGGAGTGAGCAGGG - Intergenic
1015694714 6:135967197-135967219 TACAATCTGGGGAAGGAGCCAGG - Intronic
1017061570 6:150490127-150490149 AACCATCTTCAGAGGGAGGCTGG - Intergenic
1017648620 6:156561850-156561872 AAGCATCTGGAGAGTGAGCCCGG - Intergenic
1017876855 6:158531882-158531904 GACCATGTGGAGAGAGACCCTGG - Intergenic
1019943397 7:4308539-4308561 CAGAAGCTGGAGAGGGACCCGGG - Intergenic
1020030882 7:4931932-4931954 CACCAACTGGGCAGGGAGTCCGG + Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020222235 7:6248489-6248511 ACCCATCTGGAGTGGAAGCCAGG - Intronic
1020849788 7:13337780-13337802 CACCAGCTGTAGGGGGATCCTGG + Intergenic
1022284982 7:28948452-28948474 CACCTTCTGAAGGGTGAGCCCGG + Intergenic
1022297696 7:29071711-29071733 AACCATCTGGGGAGGGAGGGCGG - Intronic
1022470456 7:30678951-30678973 CACCATCTGGAGAGGGAGCCTGG - Intronic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG + Intergenic
1026499909 7:70935491-70935513 CACCTTCGGAAGAGTGAGCCTGG + Intergenic
1027575138 7:79922135-79922157 AACAAGCAGGAGAGGGAGCCTGG + Intergenic
1028888608 7:95961897-95961919 AACCATGTGGAGAGGGAGCAAGG - Intronic
1029201264 7:98840636-98840658 CACAGTCTGGAGAGGGGGTCAGG + Intergenic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1030074586 7:105725449-105725471 CACCATCTGAAGAGGAAGTAAGG - Intronic
1031124366 7:117756573-117756595 CATCATCTGGAGAGGGATCATGG + Exonic
1032403272 7:131638344-131638366 AAACATCTAGAGAGGGAGGCTGG - Intergenic
1032581021 7:133103648-133103670 CAACCTCTGGGGATGGAGCCAGG - Intergenic
1034308911 7:150070166-150070188 CACCATCTGGAGCATGGGCCTGG - Intergenic
1034546668 7:151794065-151794087 GACCACCAGGTGAGGGAGCCAGG - Intronic
1034797938 7:154030476-154030498 CACCATCTGGAGCATGGGCCTGG + Intronic
1035453332 7:158993107-158993129 CACCATCAGGAAAGGAAGGCAGG - Intergenic
1035551654 8:532374-532396 CATCATCTTGCTAGGGAGCCTGG - Intronic
1035856639 8:2982832-2982854 CAACAGCTGGAGAAGGAACCTGG - Intronic
1036652431 8:10653974-10653996 CAGCAGCTGGGGAGGGAGCCTGG + Intronic
1037316709 8:17606028-17606050 CAGCATCTGGAGGGAGAGTCTGG + Intronic
1037764255 8:21762209-21762231 CACCACCAGGAGTGGGGGCCAGG + Intronic
1037888315 8:22606864-22606886 CCCCATCAGAAGAGGGACCCTGG - Intronic
1038273233 8:26094406-26094428 CACCTTCTGGCAAGGGAGTCGGG - Intergenic
1038405554 8:27319977-27319999 CACCAGCTGGTGAGACAGCCGGG + Intronic
1038684180 8:29701315-29701337 CACCTATTGGAGAAGGAGCCTGG + Intergenic
1038900640 8:31839890-31839912 GGCCCTCTGGAGAGGGGGCCAGG + Intronic
1039818763 8:41118027-41118049 AAGCATCTGGAGAGGGGCCCAGG - Intergenic
1040890934 8:52314976-52314998 CACCATCTCCAGTGGGGGCCAGG - Intronic
1042857240 8:73279806-73279828 CACCATTTTGTGAGGAAGCCAGG + Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1046307230 8:112385197-112385219 GCCCATGAGGAGAGGGAGCCAGG - Intronic
1048287198 8:133151151-133151173 CACCATCCAGAGAGGGAGACAGG - Intergenic
1048313584 8:133345251-133345273 CACCTTCTGCAGAGTGATCCTGG - Intergenic
1048461537 8:134625504-134625526 AACCACCTGCAGAGGGAGCAGGG - Intronic
1048940090 8:139392935-139392957 GACCAGCTGGAGAGGGTGCATGG - Intergenic
1049789800 8:144467322-144467344 CACCATCTGGAGAGGGGGGCCGG - Exonic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049891380 9:73481-73503 GACCTGCTGGAGAGGGGGCCGGG - Intergenic
1050206086 9:3197731-3197753 CACAAAGTGCAGAGGGAGCCAGG + Intergenic
1053365957 9:37522761-37522783 CACAAGCTGGAGATGGAACCTGG + Intronic
1054695618 9:68357000-68357022 GACCTGCTGGAGAGGGGGCCCGG + Exonic
1055319904 9:75073181-75073203 CACCATGTGGAGATGTAGTCAGG + Intronic
1056714103 9:89014144-89014166 CCCCCACTGGAGAGTGAGCCAGG + Intronic
1056934923 9:90909097-90909119 CACCAGCTGTACTGGGAGCCTGG - Intergenic
1057262480 9:93592901-93592923 CTCCAGTTGGAGAGGGAGTCTGG - Intronic
1057865072 9:98674088-98674110 CATCATCTAGAGAGGGAACAGGG + Intronic
1057897977 9:98924805-98924827 GAGCATCAGGAGAGGGTGCCAGG + Intergenic
1060477287 9:123996407-123996429 CACCATTTTGAGAGGCAGCAAGG - Intergenic
1061388286 9:130303199-130303221 CATCAGCTGGTGAAGGAGCCGGG + Intronic
1061628240 9:131855137-131855159 CACAAGCTGGAGAGCCAGCCCGG - Intergenic
1061763579 9:132867679-132867701 CAGCTTCTGGGGTGGGAGCCAGG + Intronic
1061763915 9:132869569-132869591 CAGCTTCTGGGGTGGGAGCCAGG + Intronic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1062109521 9:134774292-134774314 CACCATGTGGAAAGGGGGCTGGG + Intronic
1062203559 9:135321933-135321955 AACCCTCTGGAGAGACAGCCAGG - Intergenic
1062479457 9:136744679-136744701 CACCAAGTGGAGCAGGAGCCTGG - Exonic
1186862683 X:13689153-13689175 GAGCAGCTGGAGCGGGAGCCTGG + Exonic
1189961973 X:46332742-46332764 CACCAGAAGGAGAGGGAACCTGG + Intergenic
1190180080 X:48184680-48184702 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190184034 X:48219391-48219413 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190189961 X:48268840-48268862 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190193097 X:48293900-48293922 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190197188 X:48329533-48329555 CACCAGAGGGAGAGGGTGCCAGG + Intergenic
1190199070 X:48344879-48344901 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190204895 X:48394778-48394800 CACCAGAGGGAGAGGGTGCCTGG + Intergenic
1190205641 X:48400625-48400647 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190659602 X:52642513-52642535 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190663925 X:52679911-52679933 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190665829 X:52695349-52695371 CACCAGAGGGAGAGGGTGCCTGG - Intronic
1190673589 X:52763061-52763083 CACCAGAGGGAGAGGGTGCCTGG + Intronic
1190675497 X:52778511-52778533 CACCAGAGGGAGAGGGTGCCAGG - Intronic
1194501013 X:94680819-94680841 CCCCATGTGGAGGTGGAGCCTGG + Intergenic
1195072349 X:101292644-101292666 CATCCTCTGGAGAGGGACACAGG + Intronic
1195667937 X:107447747-107447769 CAGGGACTGGAGAGGGAGCCAGG - Intergenic
1196396165 X:115263622-115263644 CACCACCGAGAGAGTGAGCCAGG + Intergenic
1197654306 X:129099672-129099694 CACGATATGTAGAGGGAGGCAGG - Intergenic
1198700603 X:139393521-139393543 AACCATCGGTAGAAGGAGCCTGG - Intergenic
1198958739 X:142161331-142161353 ATCCATGTGGAGAGGGAGACAGG - Intergenic
1199673531 X:150166018-150166040 CTCCATCAGGAGATGGAGGCAGG - Intergenic