ID: 1022471253

View in Genome Browser
Species Human (GRCh38)
Location 7:30682942-30682964
Sequence GAGGAGGCCTGGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022471247_1022471253 -2 Left 1022471247 7:30682921-30682943 CCTCTGGGAAGGAAATGTATCGA 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG No data
1022471245_1022471253 7 Left 1022471245 7:30682912-30682934 CCTCCATAGCCTCTGGGAAGGAA 0: 1
1: 0
2: 3
3: 26
4: 439
Right 1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG No data
1022471240_1022471253 17 Left 1022471240 7:30682902-30682924 CCTCCAAAAGCCTCCATAGCCTC 0: 1
1: 0
2: 1
3: 21
4: 272
Right 1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG No data
1022471241_1022471253 14 Left 1022471241 7:30682905-30682927 CCAAAAGCCTCCATAGCCTCTGG 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG No data
1022471246_1022471253 4 Left 1022471246 7:30682915-30682937 CCATAGCCTCTGGGAAGGAAATG 0: 1
1: 0
2: 3
3: 25
4: 239
Right 1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022471253 Original CRISPR GAGGAGGCCTGGAGGGAAGC AGG Intronic
No off target data available for this crispr