ID: 1022472557

View in Genome Browser
Species Human (GRCh38)
Location 7:30690770-30690792
Sequence CCTCCCGGAAGCCTAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022472544_1022472557 15 Left 1022472544 7:30690732-30690754 CCCACCTGCTCAGACAGGAGAGT No data
Right 1022472557 7:30690770-30690792 CCTCCCGGAAGCCTAGGGTGAGG No data
1022472546_1022472557 11 Left 1022472546 7:30690736-30690758 CCTGCTCAGACAGGAGAGTGCTG 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1022472557 7:30690770-30690792 CCTCCCGGAAGCCTAGGGTGAGG No data
1022472543_1022472557 16 Left 1022472543 7:30690731-30690753 CCCCACCTGCTCAGACAGGAGAG No data
Right 1022472557 7:30690770-30690792 CCTCCCGGAAGCCTAGGGTGAGG No data
1022472545_1022472557 14 Left 1022472545 7:30690733-30690755 CCACCTGCTCAGACAGGAGAGTG 0: 1
1: 0
2: 0
3: 20
4: 214
Right 1022472557 7:30690770-30690792 CCTCCCGGAAGCCTAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022472557 Original CRISPR CCTCCCGGAAGCCTAGGGTG AGG Intronic