ID: 1022473933

View in Genome Browser
Species Human (GRCh38)
Location 7:30698314-30698336
Sequence GGATTCTCAGGGCAACACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022473933_1022473938 -9 Left 1022473933 7:30698314-30698336 CCACAGTGTTGCCCTGAGAATCC 0: 1
1: 0
2: 3
3: 17
4: 173
Right 1022473938 7:30698328-30698350 TGAGAATCCTAGGGCACCTCTGG No data
1022473933_1022473943 30 Left 1022473933 7:30698314-30698336 CCACAGTGTTGCCCTGAGAATCC 0: 1
1: 0
2: 3
3: 17
4: 173
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1022473933_1022473942 29 Left 1022473933 7:30698314-30698336 CCACAGTGTTGCCCTGAGAATCC 0: 1
1: 0
2: 3
3: 17
4: 173
Right 1022473942 7:30698366-30698388 CTTCCTCCGTCTAACCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022473933 Original CRISPR GGATTCTCAGGGCAACACTG TGG (reversed) Intronic