ID: 1022473936

View in Genome Browser
Species Human (GRCh38)
Location 7:30698325-30698347
Sequence GAGGTGCCCTAGGATTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022473936_1022473943 19 Left 1022473936 7:30698325-30698347 CCCTGAGAATCCTAGGGCACCTC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1022473936_1022473942 18 Left 1022473936 7:30698325-30698347 CCCTGAGAATCCTAGGGCACCTC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1022473942 7:30698366-30698388 CTTCCTCCGTCTAACCAGCTTGG No data
1022473936_1022473947 26 Left 1022473936 7:30698325-30698347 CCCTGAGAATCCTAGGGCACCTC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1022473936_1022473945 22 Left 1022473936 7:30698325-30698347 CCCTGAGAATCCTAGGGCACCTC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1022473945 7:30698370-30698392 CTCCGTCTAACCAGCTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022473936 Original CRISPR GAGGTGCCCTAGGATTCTCA GGG (reversed) Intronic