ID: 1022473938

View in Genome Browser
Species Human (GRCh38)
Location 7:30698328-30698350
Sequence TGAGAATCCTAGGGCACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022473932_1022473938 9 Left 1022473932 7:30698296-30698318 CCTCAAGGGACGCTGAGACCACA 0: 1
1: 0
2: 1
3: 8
4: 299
Right 1022473938 7:30698328-30698350 TGAGAATCCTAGGGCACCTCTGG No data
1022473931_1022473938 19 Left 1022473931 7:30698286-30698308 CCTGGGATGACCTCAAGGGACGC 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1022473938 7:30698328-30698350 TGAGAATCCTAGGGCACCTCTGG No data
1022473933_1022473938 -9 Left 1022473933 7:30698314-30698336 CCACAGTGTTGCCCTGAGAATCC 0: 1
1: 0
2: 3
3: 17
4: 173
Right 1022473938 7:30698328-30698350 TGAGAATCCTAGGGCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022473938 Original CRISPR TGAGAATCCTAGGGCACCTC TGG Intronic