ID: 1022473939

View in Genome Browser
Species Human (GRCh38)
Location 7:30698335-30698357
Sequence GGCTGCTCCAGAGGTGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022473939_1022473945 12 Left 1022473939 7:30698335-30698357 CCTAGGGCACCTCTGGAGCAGCC No data
Right 1022473945 7:30698370-30698392 CTCCGTCTAACCAGCTTGGGCGG No data
1022473939_1022473943 9 Left 1022473939 7:30698335-30698357 CCTAGGGCACCTCTGGAGCAGCC No data
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1022473939_1022473947 16 Left 1022473939 7:30698335-30698357 CCTAGGGCACCTCTGGAGCAGCC No data
Right 1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1022473939_1022473949 24 Left 1022473939 7:30698335-30698357 CCTAGGGCACCTCTGGAGCAGCC No data
Right 1022473949 7:30698382-30698404 AGCTTGGGCGGCTGGCAGCATGG 0: 1
1: 0
2: 0
3: 20
4: 264
1022473939_1022473942 8 Left 1022473939 7:30698335-30698357 CCTAGGGCACCTCTGGAGCAGCC No data
Right 1022473942 7:30698366-30698388 CTTCCTCCGTCTAACCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022473939 Original CRISPR GGCTGCTCCAGAGGTGCCCT AGG (reversed) Intronic