ID: 1022473940

View in Genome Browser
Species Human (GRCh38)
Location 7:30698344-30698366
Sequence GCTTCTGCTGGCTGCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022473940_1022473949 15 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473949 7:30698382-30698404 AGCTTGGGCGGCTGGCAGCATGG 0: 1
1: 0
2: 0
3: 20
4: 264
1022473940_1022473950 25 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473950 7:30698392-30698414 GCTGGCAGCATGGACCCCAGAGG 0: 1
1: 0
2: 2
3: 25
4: 279
1022473940_1022473952 30 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473952 7:30698397-30698419 CAGCATGGACCCCAGAGGGACGG No data
1022473940_1022473942 -1 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473942 7:30698366-30698388 CTTCCTCCGTCTAACCAGCTTGG No data
1022473940_1022473943 0 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1022473940_1022473947 7 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1022473940_1022473951 26 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473951 7:30698393-30698415 CTGGCAGCATGGACCCCAGAGGG No data
1022473940_1022473945 3 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473945 7:30698370-30698392 CTCCGTCTAACCAGCTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022473940 Original CRISPR GCTTCTGCTGGCTGCTCCAG AGG (reversed) Intronic