ID: 1022473943

View in Genome Browser
Species Human (GRCh38)
Location 7:30698367-30698389
Sequence TTCCTCCGTCTAACCAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022473933_1022473943 30 Left 1022473933 7:30698314-30698336 CCACAGTGTTGCCCTGAGAATCC 0: 1
1: 0
2: 3
3: 17
4: 173
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1022473936_1022473943 19 Left 1022473936 7:30698325-30698347 CCCTGAGAATCCTAGGGCACCTC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1022473939_1022473943 9 Left 1022473939 7:30698335-30698357 CCTAGGGCACCTCTGGAGCAGCC No data
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1022473940_1022473943 0 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1022473937_1022473943 18 Left 1022473937 7:30698326-30698348 CCTGAGAATCCTAGGGCACCTCT No data
Right 1022473943 7:30698367-30698389 TTCCTCCGTCTAACCAGCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022473943 Original CRISPR TTCCTCCGTCTAACCAGCTT GGG Intronic