ID: 1022473945

View in Genome Browser
Species Human (GRCh38)
Location 7:30698370-30698392
Sequence CTCCGTCTAACCAGCTTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022473937_1022473945 21 Left 1022473937 7:30698326-30698348 CCTGAGAATCCTAGGGCACCTCT No data
Right 1022473945 7:30698370-30698392 CTCCGTCTAACCAGCTTGGGCGG No data
1022473939_1022473945 12 Left 1022473939 7:30698335-30698357 CCTAGGGCACCTCTGGAGCAGCC No data
Right 1022473945 7:30698370-30698392 CTCCGTCTAACCAGCTTGGGCGG No data
1022473941_1022473945 -9 Left 1022473941 7:30698356-30698378 CCAGCAGAAGCTTCCTCCGTCTA No data
Right 1022473945 7:30698370-30698392 CTCCGTCTAACCAGCTTGGGCGG No data
1022473940_1022473945 3 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473945 7:30698370-30698392 CTCCGTCTAACCAGCTTGGGCGG No data
1022473936_1022473945 22 Left 1022473936 7:30698325-30698347 CCCTGAGAATCCTAGGGCACCTC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1022473945 7:30698370-30698392 CTCCGTCTAACCAGCTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022473945 Original CRISPR CTCCGTCTAACCAGCTTGGG CGG Intronic