ID: 1022473947

View in Genome Browser
Species Human (GRCh38)
Location 7:30698374-30698396
Sequence GTCTAACCAGCTTGGGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022473937_1022473947 25 Left 1022473937 7:30698326-30698348 CCTGAGAATCCTAGGGCACCTCT No data
Right 1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1022473941_1022473947 -5 Left 1022473941 7:30698356-30698378 CCAGCAGAAGCTTCCTCCGTCTA No data
Right 1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1022473940_1022473947 7 Left 1022473940 7:30698344-30698366 CCTCTGGAGCAGCCAGCAGAAGC No data
Right 1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1022473936_1022473947 26 Left 1022473936 7:30698325-30698347 CCCTGAGAATCCTAGGGCACCTC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1022473939_1022473947 16 Left 1022473939 7:30698335-30698357 CCTAGGGCACCTCTGGAGCAGCC No data
Right 1022473947 7:30698374-30698396 GTCTAACCAGCTTGGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022473947 Original CRISPR GTCTAACCAGCTTGGGCGGC TGG Intronic