ID: 1022474974

View in Genome Browser
Species Human (GRCh38)
Location 7:30704037-30704059
Sequence TGACCATGGTTGGTTGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022474965_1022474974 23 Left 1022474965 7:30703991-30704013 CCAAATGCTATTCACCAAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1022474974 7:30704037-30704059 TGACCATGGTTGGTTGGTACAGG No data
1022474967_1022474974 9 Left 1022474967 7:30704005-30704027 CCAAGCTGGACAATGAGAGTGTC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1022474974 7:30704037-30704059 TGACCATGGTTGGTTGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022474974 Original CRISPR TGACCATGGTTGGTTGGTAC AGG Intronic
No off target data available for this crispr