ID: 1022477402

View in Genome Browser
Species Human (GRCh38)
Location 7:30720474-30720496
Sequence GTGAGCAGGACTTTAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022477402_1022477412 30 Left 1022477402 7:30720474-30720496 CCTGCCTTTAAAGTCCTGCTCAC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1022477412 7:30720527-30720549 GACAGTTGGAAGGGTAAGGAAGG 0: 1
1: 0
2: 6
3: 48
4: 477
1022477402_1022477408 16 Left 1022477402 7:30720474-30720496 CCTGCCTTTAAAGTCCTGCTCAC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1022477408 7:30720513-30720535 GAAGTCTGATATGAGACAGTTGG No data
1022477402_1022477411 26 Left 1022477402 7:30720474-30720496 CCTGCCTTTAAAGTCCTGCTCAC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1022477411 7:30720523-30720545 ATGAGACAGTTGGAAGGGTAAGG 0: 1
1: 0
2: 4
3: 15
4: 285
1022477402_1022477409 20 Left 1022477402 7:30720474-30720496 CCTGCCTTTAAAGTCCTGCTCAC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1022477409 7:30720517-30720539 TCTGATATGAGACAGTTGGAAGG No data
1022477402_1022477410 21 Left 1022477402 7:30720474-30720496 CCTGCCTTTAAAGTCCTGCTCAC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1022477410 7:30720518-30720540 CTGATATGAGACAGTTGGAAGGG No data
1022477402_1022477405 -8 Left 1022477402 7:30720474-30720496 CCTGCCTTTAAAGTCCTGCTCAC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1022477405 7:30720489-30720511 CTGCTCACATTTTACCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022477402 Original CRISPR GTGAGCAGGACTTTAAAGGC AGG (reversed) Intronic
900891775 1:5454713-5454735 GTGGGCAGGGCATTCAAGGCAGG + Intergenic
902389060 1:16092240-16092262 GTGAGCAGGACTCTGACAGCGGG - Intergenic
902440730 1:16428161-16428183 GTGAGCAGGAGCTGAGAGGCAGG + Intronic
904028106 1:27517598-27517620 CAGAGCAGGAGTTTAAGGGCTGG + Intergenic
904219949 1:28958976-28958998 GTGGGCAGGGCTTTGAAGGAGGG + Intronic
907744564 1:57199813-57199835 GTGATCAGGACTTAACAGGATGG + Intronic
910568944 1:88678898-88678920 GTGGGTAGTACTTTAAAGTCGGG - Intergenic
912869109 1:113287639-113287661 CTGAGCAGCACTTGAATGGCTGG - Intergenic
917575631 1:176318609-176318631 CTGAGCAGGACTTTAGGGGATGG + Intergenic
918841043 1:189539990-189540012 GTCAGTAGGAGTTTAATGGCGGG - Intergenic
922333214 1:224596161-224596183 GTGAGCTTGACTTTGAAGCCAGG - Intronic
923268810 1:232336382-232336404 GTGTGCAGGACTTTAAAGAGGGG + Intergenic
1069759503 10:70798915-70798937 GTGTGCGGGATTTTATAGGCAGG - Intergenic
1069995073 10:72336906-72336928 GTAAGCAGGGATCTAAAGGCAGG - Intronic
1070804052 10:79260297-79260319 GGAATCAGGACTTTAAAAGCAGG + Intronic
1072987389 10:100153054-100153076 GAGAGCAGAACTTCAAAGGAAGG + Intronic
1076276510 10:129204129-129204151 GTGAGCAAGACTTTCAAGGCAGG - Intergenic
1076430124 10:130395901-130395923 GTGAGCAGGTCTCTCAAGCCCGG - Intergenic
1079645704 11:22861653-22861675 GTGAGCTGGAATTTAAATCCAGG + Intergenic
1079678872 11:23267059-23267081 GTGAGCAGCAATGTAAAAGCAGG - Intergenic
1081667675 11:44926105-44926127 GCGAGCAGGGATTTGAAGGCTGG + Intronic
1084545736 11:69814225-69814247 GAGAGCACGCCTTAAAAGGCAGG - Intronic
1089182811 11:116594712-116594734 TTGAGCAGGTCCTTTAAGGCTGG - Intergenic
1090360747 11:126171087-126171109 GTGATCTGGACTTCAAAGCCTGG + Intergenic
1091044294 11:132312136-132312158 GTGACCAGGACCTCAGAGGCAGG - Intronic
1093058717 12:14580519-14580541 ATAAGCAAGACTTTAAAGCCAGG - Intergenic
1093715761 12:22379436-22379458 TTGAGGATGACTTTAAGGGCTGG - Intronic
1096061939 12:48708807-48708829 ATTAGCAAGACTTTATAGGCTGG + Intronic
1102236664 12:111298221-111298243 GTGATCAGGGTTTTAAAGCCGGG + Intronic
1102366553 12:112341520-112341542 GTGAGCAGGAATTGACAGGAAGG - Intronic
1103498673 12:121383283-121383305 GAGAGCAGTGCTTTAGAGGCTGG + Intronic
1104841079 12:131826227-131826249 GTGAGAAGGGCCTTACAGGCAGG - Intergenic
1107180992 13:37458898-37458920 GTGAGAAGTACCTGAAAGGCAGG - Intergenic
1109213849 13:59565291-59565313 CTGAACAGGACTTTAACTGCAGG - Intergenic
1110153492 13:72284407-72284429 GGGAGCAGGACTTCAAACACAGG - Intergenic
1113117386 13:106887656-106887678 GTGTGCATGAGTTGAAAGGCTGG + Intergenic
1113735047 13:112672508-112672530 GAGAGCAAGGCTTTAGAGGCAGG + Intronic
1116020642 14:39455922-39455944 TTGAGCTGGTCTTTGAAGGCTGG + Intergenic
1116444957 14:44998407-44998429 TTGAGCTTGACTTTAAAGGAGGG + Intronic
1119995474 14:79248809-79248831 GTAAGCAGTACTCTTAAGGCAGG - Intronic
1120430154 14:84403149-84403171 GTGATCAGGACTTTGAGGACTGG - Intergenic
1122233962 14:100321830-100321852 CAGAGCTGGGCTTTAAAGGCAGG + Intergenic
1125041582 15:35193827-35193849 GTGAACAGGACTTTCAAGAAGGG + Intergenic
1127396958 15:58550705-58550727 GTGAGGAGGAGGTTAAGGGCAGG + Intronic
1128575549 15:68772124-68772146 GTGAGCATGACTTTAAGGGGAGG - Intergenic
1130191832 15:81744508-81744530 ATGAGCAGGCCATTAAAGCCAGG + Intergenic
1131031092 15:89186546-89186568 TTGAGATGGACTTTAAAGGATGG - Intronic
1131865033 15:96699277-96699299 GTAAGAAGGACTTTGAAGTCAGG - Intergenic
1133119526 16:3597527-3597549 GCCAGCAGGATTTTAAAGGAAGG - Exonic
1133987571 16:10680144-10680166 GTGAGCAGGACTTTGGGGGCTGG - Intronic
1137931718 16:52594768-52594790 CTGAGCAGGGGTTGAAAGGCAGG - Intergenic
1139440744 16:66965440-66965462 GTGAGCAGGATTTGGAAGACTGG + Intronic
1140807486 16:78546339-78546361 GTGATCAGAACTTTAAGGCCCGG + Intronic
1141323644 16:83035643-83035665 ATGAGCTGGACTTTGAAGGACGG + Intronic
1141598302 16:85110663-85110685 GTGGGCAGGAATATAAATGCGGG + Intronic
1145931226 17:28687226-28687248 GTGAGTAGGATTTGACAGGCAGG + Intronic
1147318669 17:39633138-39633160 CTGAGCAGGTCTTTGGAGGCTGG + Intronic
1147613422 17:41814217-41814239 GTGGCCATGACTTTAGAGGCAGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148440180 17:47708223-47708245 TTGAGCTGGACCTTAAAGGTAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150724019 17:67636936-67636958 GTGAGCTGAACTCTAAAGGAGGG - Intronic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152309143 17:79538551-79538573 AAGAGCAGGACAGTAAAGGCGGG + Intergenic
1152381151 17:79942871-79942893 GTGAGGCGGTCTTTAAAGGGAGG - Intronic
1155288739 18:24319648-24319670 GTGAGCAGGACATTAAATGAAGG + Intronic
1155556748 18:27028416-27028438 GGGATCAGGAGTTTACAGGCGGG + Intronic
1155972667 18:32096034-32096056 GTGAGCTGGACTTTGAAGTTTGG + Intronic
1157569936 18:48705576-48705598 GTGAGGAGGACTTTACAGATGGG + Intronic
1158595172 18:58809533-58809555 TAGATCAGGACTTTAAAGGATGG + Intergenic
1159778217 18:72628521-72628543 GTGGGAAGGAGTATAAAGGCCGG - Intronic
1159821900 18:73155678-73155700 GTGATCAACACTTTAAAGGAAGG - Intronic
1162662710 19:12182790-12182812 GTGAGCAGCACTTTAGTGACAGG + Intronic
1163136542 19:15315556-15315578 GTAAGCAGCACTTCAAGGGCCGG + Intronic
1163807755 19:19410277-19410299 ATGAGCAGTACTCTAAAGGAGGG + Intronic
1164266591 19:23624587-23624609 GTTAAGAGGACTTCAAAGGCAGG - Intronic
1164893149 19:31842430-31842452 GTTAGAAGGACTCTAAAGACTGG + Intergenic
1165267551 19:34674015-34674037 GTGAGAAGAACTTTAAATGGAGG - Intronic
928086546 2:28349841-28349863 GTGGGCACGACTTTGGAGGCCGG - Intergenic
929079288 2:38106492-38106514 GTGAGCTGGACTCTAAGGTCAGG + Intronic
931768137 2:65474964-65474986 GAAAGCAAGAATTTAAAGGCTGG + Intergenic
933998324 2:87686176-87686198 TTGAGCAGGACTTTGCAGGATGG - Intergenic
934945487 2:98538153-98538175 GGCAGCAGGGCTTTACAGGCAGG - Intronic
936295524 2:111264697-111264719 TTGAGCAGGACTTTGCAGGATGG + Intergenic
937334009 2:121049650-121049672 GGGAGCAGGACTCCTAAGGCAGG - Intergenic
938737838 2:134202609-134202631 GTGAGCTGGGCTGTAGAGGCTGG - Intronic
942408856 2:175685414-175685436 TTGAGCTCGACTTTAAAGGATGG - Intergenic
942689649 2:178571964-178571986 TTGAACAGGAGTTTGAAGGCTGG + Exonic
948232484 2:236360611-236360633 GTGAGCTGGAATTTGAAGCCAGG - Intronic
948416894 2:237813922-237813944 GTCAGCAGTTCTTGAAAGGCTGG - Intronic
948563538 2:238869192-238869214 GTGAGGAGTACTTTAAAGAAGGG + Intronic
1169130868 20:3165880-3165902 GTGAGCAGGCCGCGAAAGGCAGG + Exonic
1173419305 20:42886859-42886881 GTGAACAGGGCTTTGAAGGATGG + Intronic
1174914357 20:54639229-54639251 CTGAGCAAGACTGCAAAGGCTGG - Intronic
1176666821 21:9695471-9695493 GTGTGCAGGATTTTTTAGGCAGG - Intergenic
1177834551 21:26173752-26173774 CTGAGTGGGAGTTTAAAGGCGGG - Intergenic
1178398997 21:32267150-32267172 GTGAGAGGGACTTCCAAGGCTGG - Intergenic
1181893341 22:26084284-26084306 ATGAGCAGGACTATATAGGTTGG + Intergenic
1183675374 22:39296375-39296397 GAGGGCAGGACTTTGAAGCCAGG - Intergenic
1184520723 22:44992437-44992459 TGGAGCAGGACTTGGAAGGCAGG - Intronic
949900530 3:8811286-8811308 GTGTACAGCACTTTAAAAGCAGG + Intronic
959905034 3:111701959-111701981 GTGAGCAGGCCATTGGAGGCAGG + Intronic
960713500 3:120554416-120554438 TCGATCAGGACTTTAAAGGATGG - Intergenic
961123139 3:124391164-124391186 GTGAGCGGGACTCTAAAAGAAGG + Intronic
962227943 3:133631995-133632017 GTGAGCACGTCTTTCATGGCTGG - Intronic
964109087 3:153070680-153070702 GTGAGCAGAACTTCAGAGGGCGG + Intergenic
964197892 3:154085640-154085662 GTGACCAGGACTGGGAAGGCAGG - Intergenic
964417625 3:156464364-156464386 TTCAGCAGGACTTAGAAGGCTGG + Intronic
964869853 3:161301802-161301824 GTCAGGAGAACTTTAAAGGCAGG + Intergenic
966244021 3:177785984-177786006 CTGAGCAGAACTTTCCAGGCTGG - Intergenic
969602808 4:8187045-8187067 TTGAGCAGGGCTTTGAAGGATGG - Intronic
972535917 4:39999880-39999902 GTAAGAAGGAATTTAAAGGCAGG + Intergenic
978975950 4:114872809-114872831 CAGAGCAGGACTTTAAAACCAGG + Intronic
979760717 4:124400289-124400311 GTGAGCAGGACAATAAAGGATGG - Intergenic
981346580 4:143683691-143683713 GTGAGCAGAACTCCACAGGCAGG + Intronic
981596201 4:146425661-146425683 GTCAGCAGGACTTTAAGGTATGG + Intronic
982641699 4:157969622-157969644 GTGAAAAGGAGATTAAAGGCTGG + Intergenic
984399652 4:179245244-179245266 GTGAGAAGGATTTGAAAGACAGG + Intergenic
985408188 4:189656871-189656893 GTGTGCAGGATTTTTTAGGCAGG + Intergenic
986659554 5:10046747-10046769 GTGAGCTGGATCTTGAAGGCTGG + Intergenic
988192811 5:27961924-27961946 TTGAGGAGGTCTTTTAAGGCAGG + Intergenic
989770019 5:45133245-45133267 ATGAGATGGTCTTTAAAGGCTGG - Intergenic
990595342 5:57307496-57307518 GGGAGCAGATCTATAAAGGCTGG + Intergenic
990950373 5:61292870-61292892 GTGAGCAGGATTATAGAGGATGG + Intergenic
995455557 5:112348195-112348217 TTGAGGAGGACTTTGAAAGCTGG - Intronic
995596750 5:113755634-113755656 GTGAGGATGACTTTACAGGCAGG + Intergenic
1000191970 5:158919869-158919891 CTGAACAGGGCTTTAAAGACAGG + Intronic
1002549551 5:179977059-179977081 GGGAGCACCACATTAAAGGCAGG + Intronic
1002852613 6:1010071-1010093 GTGAGGAGGTGTTTAAAGCCAGG + Intergenic
1005627601 6:27678175-27678197 ATGAGCAAGACTGTAAAGCCAGG + Intergenic
1007319005 6:41012921-41012943 GGAAGCTGGAGTTTAAAGGCTGG + Intergenic
1007496239 6:42261815-42261837 CTGAGCAGGATTTTGAAGGAAGG - Intronic
1008564561 6:52754623-52754645 GTGCTCAGGACTTCAGAGGCTGG - Intronic
1008566947 6:52777903-52777925 GTGCTCAGGACTTCAGAGGCTGG - Intergenic
1011091113 6:83600978-83601000 GAGAGCAGGAACCTAAAGGCAGG + Intronic
1011224611 6:85093087-85093109 GTTACCAGGTCTTTAAAAGCTGG - Intergenic
1014057716 6:117035995-117036017 GTGAGCATGAATTTAAAGGGAGG - Intergenic
1015032933 6:128617798-128617820 GGGAGCCAGACATTAAAGGCTGG - Intergenic
1016840250 6:148518217-148518239 TTCAGGGGGACTTTAAAGGCAGG - Intronic
1017137367 6:151160256-151160278 GTGACCATGACATTCAAGGCTGG - Intergenic
1017780672 6:157713118-157713140 GTGACCAGGAATTTCAAGGAGGG - Intronic
1019825811 7:3283306-3283328 TTGAGCTGGAATTTAAAGGGTGG + Intergenic
1022354604 7:29600986-29601008 TTGAGTTGGACTTGAAAGGCTGG + Intergenic
1022477402 7:30720474-30720496 GTGAGCAGGACTTTAAAGGCAGG - Intronic
1023317620 7:38956625-38956647 GTGAGTGGCACTTTGAAGGCTGG - Intergenic
1024296064 7:47843312-47843334 GTTAGAAGGGCTTTGAAGGCAGG + Intronic
1026521674 7:71123372-71123394 GAGAGCAGGACTTGCCAGGCAGG + Intergenic
1026929174 7:74213729-74213751 GTAAACAGGACTTAAAAGGGAGG - Intronic
1028681558 7:93540160-93540182 TTCAGCAGGACTTGAAAAGCAGG + Intronic
1028730953 7:94147861-94147883 ATTACCAGGACCTTAAAGGCTGG + Intergenic
1032321792 7:130892504-130892526 GGGAAAAGGACTTTAAAGGCTGG - Intergenic
1033340675 7:140489958-140489980 TTGAGGAGGATTTAAAAGGCAGG - Intergenic
1033413735 7:141144640-141144662 GAGAGCAGGACTCTAAATTCAGG + Intronic
1034395674 7:150823047-150823069 CTGAGCAGCACTTTTGAGGCAGG + Intergenic
1034964760 7:155384201-155384223 GTGAGCAGGACTGGGGAGGCTGG - Intronic
1040072952 8:43203156-43203178 GTGATAAAGACTTTAAAAGCTGG - Intergenic
1040092268 8:43410266-43410288 GTGAGCAGGCTCTTGAAGGCAGG + Intergenic
1040400363 8:47044090-47044112 GTGAGCAGGCTCTTCAAGGCAGG - Intergenic
1041572222 8:59350653-59350675 ATGAGCAGGAATTTGAAGCCAGG + Intergenic
1042544182 8:69936029-69936051 GCTAGGAGGACATTAAAGGCTGG - Intergenic
1044839715 8:96327312-96327334 ATGAGCAGGATTTTGAAGACAGG + Intronic
1047416600 8:124669400-124669422 GTGAGCTGTACTGTAAATGCTGG - Intronic
1048583115 8:135746988-135747010 GTGCCCAGGACTGGAAAGGCTGG + Intergenic
1048697953 8:137049754-137049776 GTGAGCAGGAGGTGAATGGCTGG + Intergenic
1049213266 8:141396343-141396365 GAGAGCAGGAATTTGAACGCTGG + Intronic
1053255067 9:36610007-36610029 TTGAGCAGGTCTTTAAAAGAAGG + Intronic
1053291522 9:36882554-36882576 TTGAGCTGGTCTTTGAAGGCAGG - Intronic
1055794466 9:79960104-79960126 GTGAGCAGGTTTTTAATGACAGG + Intergenic
1056572425 9:87827638-87827660 GTGTTCAGGTCTTTAAAGCCTGG - Intergenic
1059178256 9:112187647-112187669 GAGAGCAGAGCTTTGAAGGCGGG - Intergenic
1059589089 9:115638087-115638109 CTGTGCAAGACTTTACAGGCTGG + Intergenic
1203659276 Un_KI270753v1:26290-26312 GTGTGCAGGATTTTTTAGGCAGG + Intergenic
1187514786 X:19959201-19959223 GTGAGCTAGGCTTCAAAGGCTGG - Intronic
1196783275 X:119400999-119401021 GGGGGCAGAACTTCAAAGGCTGG + Intronic
1198525153 X:137493236-137493258 GAGAGCTAGGCTTTAAAGGCAGG + Intergenic
1201413445 Y:13723910-13723932 GTGAGGAGGTCTTTTAGGGCAGG - Intergenic