ID: 1022477861

View in Genome Browser
Species Human (GRCh38)
Location 7:30723525-30723547
Sequence CCATGGAAGGCTTTATGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022477851_1022477861 19 Left 1022477851 7:30723483-30723505 CCGCTGCATTGAGAAGTTTGGAA 0: 1
1: 0
2: 1
3: 157
4: 1968
Right 1022477861 7:30723525-30723547 CCATGGAAGGCTTTATGGTGGGG No data
1022477850_1022477861 20 Left 1022477850 7:30723482-30723504 CCCGCTGCATTGAGAAGTTTGGA 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1022477861 7:30723525-30723547 CCATGGAAGGCTTTATGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022477861 Original CRISPR CCATGGAAGGCTTTATGGTG GGG Intronic
No off target data available for this crispr