ID: 1022479764

View in Genome Browser
Species Human (GRCh38)
Location 7:30735070-30735092
Sequence TGGAAGAAACAGATTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 386}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022479764_1022479771 14 Left 1022479764 7:30735070-30735092 CCCTGCACAATCTGTTTCTTCCA 0: 1
1: 1
2: 1
3: 31
4: 386
Right 1022479771 7:30735107-30735129 TGTTTCAGGCCAGGAGTTTGAGG 0: 1
1: 30
2: 539
3: 3720
4: 11225
1022479764_1022479770 5 Left 1022479764 7:30735070-30735092 CCCTGCACAATCTGTTTCTTCCA 0: 1
1: 1
2: 1
3: 31
4: 386
Right 1022479770 7:30735098-30735120 CCTTTGTCTTGTTTCAGGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 161
1022479764_1022479774 24 Left 1022479764 7:30735070-30735092 CCCTGCACAATCTGTTTCTTCCA 0: 1
1: 1
2: 1
3: 31
4: 386
Right 1022479774 7:30735117-30735139 CAGGAGTTTGAGGCCAGCCTGGG 0: 865
1: 21437
2: 41220
3: 57792
4: 49849
1022479764_1022479768 0 Left 1022479764 7:30735070-30735092 CCCTGCACAATCTGTTTCTTCCA 0: 1
1: 1
2: 1
3: 31
4: 386
Right 1022479768 7:30735093-30735115 GGTTGCCTTTGTCTTGTTTCAGG 0: 1
1: 0
2: 3
3: 26
4: 224
1022479764_1022479773 23 Left 1022479764 7:30735070-30735092 CCCTGCACAATCTGTTTCTTCCA 0: 1
1: 1
2: 1
3: 31
4: 386
Right 1022479773 7:30735116-30735138 CCAGGAGTTTGAGGCCAGCCTGG 0: 797
1: 21879
2: 86541
3: 155819
4: 186442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022479764 Original CRISPR TGGAAGAAACAGATTGTGCA GGG (reversed) Intronic
900705840 1:4079653-4079675 GTGAAGAGAGAGATTGTGCAGGG + Intergenic
902069830 1:13724798-13724820 TGGAAGAAAAAGATATTGCAGGG + Intronic
903047413 1:20575219-20575241 TGGGAGCCACAGCTTGTGCAGGG + Intergenic
903660686 1:24976187-24976209 TGGAAAAAACAGACTATGCAGGG - Intergenic
903918880 1:26785456-26785478 TTGAAGACACACAGTGTGCAAGG + Intergenic
903999233 1:27329122-27329144 ACAAAGAAACAGAATGTGCAAGG - Intronic
904583102 1:31562475-31562497 TGGAAGAAACAAATAGTCTAGGG + Intergenic
904616200 1:31751193-31751215 TAGAGGAAACAGCCTGTGCAAGG - Intronic
906701011 1:47858109-47858131 TGGAAGAAACAGCATATACAGGG + Intronic
908481005 1:64539408-64539430 TGGAATACATAGACTGTGCAGGG - Intronic
908856351 1:68434029-68434051 TGCATGAAACAGATTATGGAAGG + Intronic
909256261 1:73426446-73426468 TGGAGGAAACATATTGTACATGG - Intergenic
909700996 1:78522759-78522781 TAGAAAAAACAGATTTTGCAGGG - Intronic
910189002 1:84575500-84575522 TGGAGGAAGCAGATGCTGCAGGG + Intergenic
910670182 1:89764334-89764356 TGGAAGAAACAGAGTGAACAAGG - Intronic
911588117 1:99714516-99714538 TGTAGAAAATAGATTGTGCACGG + Intronic
911615532 1:100006535-100006557 TGGTAGCAACAGGTTGTGCAGGG + Intronic
912045130 1:105444273-105444295 TGACAGAAACATAGTGTGCAAGG - Intergenic
912488637 1:110048912-110048934 GGGAAGAAATAAATTGTGCGAGG + Intronic
915062172 1:153195226-153195248 TGGAAGAAAGAGATTGGAGAGGG - Intergenic
915401132 1:155622638-155622660 TGGAAGAGACAAATTTTACAAGG + Intergenic
916157055 1:161862661-161862683 AGGAGGAAACAGTTTGTTCATGG + Intronic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
917021394 1:170592209-170592231 TGGAAGAAAAAAACTGTTCAGGG - Intergenic
917592553 1:176491561-176491583 AGGTAGAACCAGATTGTGAAAGG + Intronic
918136584 1:181679560-181679582 TGGAAGTAACCGTTTGTGAAAGG - Intronic
918372422 1:183874471-183874493 AGGAAGAAAAAGATTATGAAAGG - Intronic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918633658 1:186748671-186748693 TGGCAAAAAGAGCTTGTGCAAGG - Intergenic
919500539 1:198332487-198332509 TGATAGAAAGAGATTGTGCAAGG - Intergenic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
920833737 1:209488500-209488522 TGGAAGAAGCAAGTTTTGCATGG + Intergenic
923061795 1:230482412-230482434 TGAAAGAAAAAGTTTGGGCATGG + Intergenic
924015150 1:239713066-239713088 TTGCAGAAGCAGATTGTGCCCGG - Intronic
1063288729 10:4718058-4718080 GGGAAGTAACAGAGTGTGGAGGG + Intergenic
1063916734 10:10890662-10890684 TGGAAGAAACACTTTGCGCATGG - Intergenic
1065323752 10:24532622-24532644 GGCAAGAAAGAGATTGTGCAGGG + Intronic
1066228333 10:33406852-33406874 GGCAAGAAAGAGAGTGTGCAGGG - Intergenic
1066356320 10:34687579-34687601 GGCAAGAAACAGATAGTGCAAGG + Intronic
1067481394 10:46601447-46601469 TGGCAAAAACTGATTATGCAAGG - Intergenic
1067613358 10:47740280-47740302 TGGCAAAAACTGATTATGCAAGG + Intergenic
1071156044 10:82690919-82690941 TGGAAGAAAGAGAATGAGCAGGG - Intronic
1072728448 10:97829038-97829060 TGGGAGAAACAGGTTCTGCATGG - Intergenic
1073961218 10:108931368-108931390 GGCAAGAGACAGCTTGTGCAGGG + Intergenic
1074014039 10:109515086-109515108 AGGAAGAAACTGATTCTGCCTGG + Intergenic
1074732372 10:116392828-116392850 TAGAAGAAAGACATTTTGCAGGG + Intergenic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075972827 10:126669313-126669335 TGGAAGGAACAGGTTTTTCAAGG - Intronic
1076220437 10:128729346-128729368 TGGAAGAAAGAGACTGCACACGG - Intergenic
1076689572 10:132215509-132215531 TGGCAGAGAGAGCTTGTGCAGGG - Intronic
1077687487 11:4310121-4310143 TCAAAGAAAAAGATTCTGCACGG + Intergenic
1079170332 11:18088074-18088096 TGGAGGAAACATACTGTGCAAGG + Intronic
1079490069 11:20978820-20978842 TGGGAGAATCTGATTTTGCAGGG - Intronic
1080052340 11:27870177-27870199 TGTGAGACACAGATTGTGTAAGG - Intergenic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1084414049 11:69020504-69020526 TTGAAGTTACAGAATGTGCAAGG - Intergenic
1085982315 11:81739325-81739347 GGGAAGAGAGAGCTTGTGCAAGG + Intergenic
1086253872 11:84850674-84850696 TAGAATAAACAGATTCAGCAAGG + Intronic
1086314877 11:85580906-85580928 TGGAAGAAACATAATCTGTAAGG - Intronic
1086455081 11:86953333-86953355 TTGGAGAAACAGCTTTTGCAGGG - Intronic
1087015096 11:93546932-93546954 TGGAAGGAACAGCATGTGGAAGG - Intergenic
1088279889 11:108125180-108125202 TGGAACAATTAGAATGTGCACGG + Intronic
1088702327 11:112424518-112424540 TGGAGGAATCAGATGGGGCATGG + Intergenic
1088930597 11:114347448-114347470 TGGAAGAGACAAATTTTACAAGG + Intergenic
1089952471 11:122541966-122541988 TGAAATAAAGAGATTTTGCATGG - Intergenic
1090031620 11:123211366-123211388 TGCAAGTCACAGATTGTGGATGG + Intergenic
1090937401 11:131355951-131355973 AGGAAGAAACAGAATATGAAAGG - Intergenic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091072430 11:132580469-132580491 TAGAAGAAAGAGATTATGCAGGG + Intronic
1091142394 11:133246515-133246537 TTGATGAAACAGTCTGTGCAGGG + Intronic
1091673738 12:2471999-2472021 AGGAAGAAACATTATGTGCAGGG - Intronic
1092285153 12:7124442-7124464 AGGAAGAAACAGAGTGGCCAAGG - Intronic
1094153494 12:27312580-27312602 TGGTAGAAGCAGATGGTGCCTGG + Exonic
1095516310 12:43009836-43009858 TGGTAAAAACAGATTTAGCATGG - Intergenic
1097608051 12:61780243-61780265 CGGAAGAAACTAATAGTGCAAGG + Intronic
1098171189 12:67748954-67748976 TTGAAGAATCAGACTGTACAGGG + Intergenic
1098455108 12:70664058-70664080 TGAAAGAAACTGATTCTGCTAGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1099892080 12:88602193-88602215 GGGAAGAAACAGAATGTTGATGG - Intergenic
1101107603 12:101455624-101455646 TGGAATAAGCAGATTGGGAAAGG - Intergenic
1101749201 12:107569248-107569270 TGGAAAAAAGAGATTCTGCTTGG + Intronic
1102999264 12:117372728-117372750 TGCAAGAGAGAGCTTGTGCAGGG - Intronic
1103809638 12:123603077-123603099 TGTAAGAGATGGATTGTGCAGGG + Intronic
1104521042 12:129475410-129475432 TTGAGGAAACAGTTTGTGGAAGG - Intronic
1105450168 13:20492576-20492598 TGGCAGAAACAGGTGGGGCAGGG - Intronic
1106101191 13:26696076-26696098 TGGAAGGAAGACATTGTGGAAGG + Intergenic
1106185942 13:27409812-27409834 TGGAGGAAACAGATCATGTAGGG + Intergenic
1106196939 13:27502110-27502132 TAGAAGAAACAGTGTGTGAATGG + Intergenic
1106352006 13:28939927-28939949 GGCAAGAAAGAGCTTGTGCAGGG + Intronic
1106527943 13:30559805-30559827 TGGAAACAGCAGATTGTGAAAGG + Intronic
1107907978 13:45079066-45079088 TGAAACAGTCAGATTGTGCAAGG + Intergenic
1108421904 13:50259329-50259351 TGGAGGAAACAGAGTGTGTAGGG - Intronic
1108694965 13:52895122-52895144 TGGAAGAAATATTTTGTGCCTGG + Intergenic
1109479634 13:62932224-62932246 TGGAAAAAACAGACTATGAAGGG + Intergenic
1110874699 13:80494090-80494112 TGGGCAAAACAGATTTTGCAAGG - Intergenic
1111204653 13:84989896-84989918 GGGAGGAAAGAGCTTGTGCAGGG + Intergenic
1111628450 13:90818667-90818689 AGGAAAAAACAGATGCTGCAGGG + Intergenic
1114908872 14:27167030-27167052 TCAAAGAAAGAGCTTGTGCAGGG + Intergenic
1116807519 14:49508349-49508371 TGGAAGAAAGAGCCTGTGAAGGG + Intergenic
1118120892 14:62840859-62840881 TGTAAGAAAGAGATTCTGCAGGG - Intronic
1120234412 14:81874653-81874675 TGGAGGAAATAGATTGGGAAGGG + Intergenic
1120430721 14:84411258-84411280 TAGAAGAAATACATTTTGCATGG + Intergenic
1121373580 14:93383902-93383924 TGGCAGACAGAGTTTGTGCAGGG - Intronic
1121721706 14:96113548-96113570 TGGAAGAAAGAGATTGCCAAGGG + Intergenic
1123135834 14:106026815-106026837 GGGAAGCAACAGTGTGTGCAGGG - Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124068360 15:26367543-26367565 TGGAGAAAACAGACTATGCATGG - Intergenic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124984333 15:34591549-34591571 TGTTAGGAACAGATTATGCAGGG - Intergenic
1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG + Intronic
1125469529 15:39989403-39989425 TGGTAGAAGCAGAATTTGCAAGG + Intronic
1126165876 15:45653442-45653464 TGGAAGAGACATATGGGGCAAGG + Intronic
1126354642 15:47782477-47782499 TGGAAACAACAGATGGTGCATGG + Intergenic
1126684065 15:51231976-51231998 TGGAAGAGAAAGAGTGTGCTAGG - Intronic
1127443363 15:59035074-59035096 GGCAAGAGAGAGATTGTGCAGGG + Intronic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1130059133 15:80557184-80557206 AGGAAGGAGCAGAGTGTGCAGGG - Intronic
1130353470 15:83110350-83110372 AGGAAGAAACAGGTCCTGCAGGG - Intronic
1131014050 15:89042989-89043011 TGGAGGAAACAAATGGTGCTGGG - Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1133386582 16:5375061-5375083 TGGTAGAAACAGATTTTAAATGG + Intergenic
1133693264 16:8236524-8236546 GGGAAGAGAGAGCTTGTGCAGGG + Intergenic
1134431141 16:14207708-14207730 TGGAAGAGACACATAGGGCATGG - Intronic
1134852164 16:17488675-17488697 GGCAAGAAAGAGCTTGTGCAGGG + Intergenic
1136084449 16:27874720-27874742 AGGAAGAAACACATAGGGCAAGG - Intronic
1136629661 16:31482547-31482569 CAGAAGACACAGTTTGTGCAAGG + Intergenic
1137400424 16:48148718-48148740 AGGAATAAACAGTTTGTCCAGGG - Intronic
1138349109 16:56337103-56337125 TGGAAGAGGCACATTCTGCACGG - Intronic
1138535672 16:57659050-57659072 GGGAAGACACAGAATGTGGATGG + Intronic
1138987737 16:62350961-62350983 TGAAAGAAATAGATTGGGCTTGG - Intergenic
1140898170 16:79343842-79343864 AAGAAAAAACAGAGTGTGCAGGG - Intergenic
1140904287 16:79397196-79397218 TGGAAGACACAGATTGCCAAAGG - Intergenic
1141217413 16:82037876-82037898 TGGAAGAAATAGTTTGTATATGG + Intronic
1143130867 17:4676181-4676203 TGGAAGAAAGACAGTGTACAGGG - Intronic
1143986423 17:10918583-10918605 TCTAAGAACCAGATTGTGGATGG + Intergenic
1144197802 17:12912121-12912143 TGGAAGAAACAGATTGTGTAGGG + Intronic
1144419050 17:15079260-15079282 TAGAGGAAACAGGATGTGCAAGG + Intergenic
1144599026 17:16597033-16597055 TGGAAGGAACTGATTGTGTTTGG - Intergenic
1144688175 17:17240593-17240615 AGAAAGAAAGAAATTGTGCATGG - Intergenic
1144945197 17:18966174-18966196 TGGAAAGGACAGTTTGTGCAGGG + Intronic
1145261877 17:21359344-21359366 TGGCAGAAAGAGAGTGTGCCTGG + Intergenic
1146692731 17:34887901-34887923 TGGAAGAAAAAGATTTTGTGGGG - Intergenic
1146703641 17:34983327-34983349 TGCAAGGAAAAGATTGTGAAGGG + Exonic
1146817055 17:35950635-35950657 TGAGAGAAACAGACTGTGCTGGG - Intergenic
1149875067 17:60224391-60224413 GGGAAGAAGCAGATTCTACAAGG + Intronic
1150639971 17:66942864-66942886 AGGAAGAAAGGGATTGGGCATGG - Intergenic
1153912877 18:9719704-9719726 TGGAAGAAAATGATCCTGCAGGG - Intronic
1155105212 18:22657400-22657422 TAGAAGAAACAAATGGCGCATGG - Intergenic
1155549982 18:26954478-26954500 GGAAAGAAGCAGATGGTGCAAGG - Intronic
1157264658 18:46207782-46207804 TGAATGAAACAGATTATGGAAGG - Intronic
1157716126 18:49888610-49888632 AGGAAGAATCAGCTTGTGAATGG + Intronic
1157931338 18:51826775-51826797 TGAAAAAAACAGGTTGAGCAGGG - Intergenic
1158209090 18:55026181-55026203 TAGAAGAACCAGCATGTGCAAGG + Intergenic
1158791545 18:60785538-60785560 GGGAAGAAACACATCTTGCATGG - Intergenic
1160468095 18:79099750-79099772 TGCAAAAAACAGGTTGGGCATGG - Intronic
1160495651 18:79373152-79373174 TGAAAGAAAGCCATTGTGCAGGG - Intronic
1161613470 19:5257031-5257053 TGGTAGAAACAGCTTCTGCCAGG - Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1164399700 19:27894126-27894148 TAGAAGGAACAGAATGTGGAAGG - Intergenic
1164796331 19:31035746-31035768 TGGAAGTTAAAGATTGTGCATGG - Intergenic
1164932301 19:32185183-32185205 GGCAAGAAAGAGATTGTGCAGGG + Intergenic
1165038887 19:33054900-33054922 TGGCAGAAACAGAATTTTCAGGG - Intronic
1165578407 19:36841327-36841349 TGGAAGGAACAGGCTGGGCACGG + Intronic
925223619 2:2162649-2162671 TGGAAGACTCAGATTCCGCAGGG + Intronic
925266398 2:2569460-2569482 GGGAAGAACCAGGTAGTGCAGGG + Intergenic
925705793 2:6683680-6683702 TGAAAGAGAGACATTGTGCAAGG + Intergenic
925723777 2:6853448-6853470 TGGAAAACACAGATCATGCAAGG + Intronic
928441664 2:31297255-31297277 TGGATCACACACATTGTGCATGG + Intergenic
929453754 2:42052450-42052472 TAGAAAAAACAGATTGTGGCCGG + Intronic
931898845 2:66765479-66765501 TGTCAAGAACAGATTGTGCAGGG + Intergenic
932952997 2:76315938-76315960 CAGAAGAAAAAGATTTTGCAGGG - Intergenic
933183615 2:79254454-79254476 TGGAAGAAAGAGAGTGTAGAGGG - Intronic
933303153 2:80565595-80565617 TGGTAGAAACAGTGTGTGCATGG + Intronic
935586004 2:104800937-104800959 TGGTAGAAAGAGATTCTGGAAGG - Intergenic
936646216 2:114375872-114375894 TGGCAGAAGCATTTTGTGCAGGG + Intergenic
937599441 2:123712491-123712513 TGGAAGTAACGGATTCTTCATGG - Intergenic
938606911 2:132903716-132903738 AGTAAGAAACAGATTAGGCAAGG + Intronic
939399130 2:141668687-141668709 AGGAAGAATCAGATTATACATGG - Intronic
939655620 2:144820381-144820403 TGGAAGCATCAGATGGAGCAGGG + Intergenic
941247115 2:163112686-163112708 GGCAAGAAAAAGTTTGTGCAGGG + Intergenic
941333288 2:164207512-164207534 TGGAAGAGATAAATTGGGCAGGG - Intergenic
941577490 2:167251385-167251407 TGAAATAAACAGATGGTTCAGGG + Exonic
942216174 2:173720956-173720978 TGGGAAAAACAGACTCTGCATGG + Intergenic
943008889 2:182422511-182422533 TAGAAGAAACAGATTTTTCTTGG + Intronic
943169465 2:184378579-184378601 TGGAAGAAACTAAGTGTGGAGGG + Intergenic
943629353 2:190233469-190233491 TGGAAGAGGGAGCTTGTGCAGGG - Intronic
943878415 2:193104283-193104305 TGGAGAAAACAGCTTGGGCATGG - Intergenic
945573264 2:211497964-211497986 TGAAAGAAATATAATGTGCAAGG + Intronic
946208723 2:218130013-218130035 TGAAAGAAACAGCTCTTGCAGGG - Intronic
946827534 2:223694380-223694402 TGCAAGAAACAAATGGTGAAAGG - Intergenic
947745936 2:232507370-232507392 TGGAAGAAAAAGGAGGTGCAGGG - Intergenic
948027686 2:234790994-234791016 ATGAAGAAAAAGATTCTGCAAGG - Intergenic
948360266 2:237414982-237415004 TGAAAGAAACAGGCTGGGCACGG + Intergenic
948721228 2:239901636-239901658 TTGAAGAAACACATTTTGTAAGG + Intronic
948731166 2:239964571-239964593 AGGAAGAAAAAAACTGTGCAGGG + Intronic
948978928 2:241482762-241482784 TGAAAGGAACAGATGGTGGAAGG + Intronic
1168763193 20:363671-363693 TGGAAGAAGCAGCTTTTGCGTGG - Intronic
1169120641 20:3093479-3093501 AGGGATAAACAGCTTGTGCAGGG + Intergenic
1169195154 20:3678856-3678878 TGGCACAAACAGATGGGGCATGG + Intronic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172004145 20:31806171-31806193 AGGAAGAAACAGTCTCTGCAAGG - Intergenic
1172014870 20:31867341-31867363 TGGAAAGAACAGAATGAGCAAGG - Intronic
1172503062 20:35440691-35440713 TGGAAGAAACAAACTGTGTTGGG - Intronic
1173088529 20:39948274-39948296 TGGAAGATTCTGATTGGGCATGG + Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174455636 20:50646727-50646749 TGAAATAAACAGCTTGTGCTGGG + Intronic
1174753892 20:53139381-53139403 TTGAAGAAAGAGACTGGGCAAGG + Intronic
1176700700 21:10046227-10046249 TGCAAGAAACATATTGAACAAGG + Intergenic
1177340476 21:19792851-19792873 TGTAAGAAAAAAAGTGTGCAGGG + Intergenic
1178402318 21:32297518-32297540 TGGAAGAGACACATGGGGCAGGG - Intronic
1178739578 21:35185755-35185777 TGCAAGAATCAGACTTTGCAGGG + Intronic
1178833278 21:36074150-36074172 TGGAAGAAACAGAATGGCCTGGG - Intronic
1178870251 21:36367764-36367786 AGAAAGAAACAGATTATGTACGG + Intronic
1178928590 21:36796606-36796628 TGGAAGGCTCAGATGGTGCATGG - Intronic
1180631865 22:17235344-17235366 TACAAGAAACAGATTGTCCGGGG + Intergenic
1182257414 22:29049163-29049185 TGGAGGAAACAGAGTAGGCAGGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183798399 22:40140470-40140492 TGGAAGAAACATATTGAAGATGG + Intronic
1184122394 22:42460593-42460615 TAGAAGAGACAGCTTGTGGAAGG + Intergenic
951096709 3:18640614-18640636 TTGAAGAAACACATTTTGTAGGG - Intergenic
952989362 3:38818207-38818229 TGAAATAAACACATTGTTCAAGG + Intergenic
955206391 3:56899433-56899455 TAGAAGAGAAAGATTGGGCATGG - Intronic
955734858 3:62027574-62027596 TGGAAAAATTAGATTTTGCAGGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956284194 3:67591306-67591328 TAGATGAAACAGACTCTGCAGGG + Intronic
956544813 3:70389091-70389113 TGGAAGAAACAGAAAGGGAATGG - Intergenic
958024920 3:88039348-88039370 GGGTAGAAACAGTGTGTGCAGGG + Intergenic
958556877 3:95690456-95690478 TGGAGGCAAAAGATAGTGCATGG + Intergenic
959793260 3:110390602-110390624 AAGAAGAAACAGATTATGAAGGG - Intergenic
959839285 3:110955754-110955776 GGAAACAAACAGATTGTGTAAGG - Intergenic
960035573 3:113099381-113099403 TGAAAGAAATAAATTTTGCAAGG - Intergenic
960600540 3:119453661-119453683 TGGAAGAAGCATATTGGGGATGG + Intronic
963006146 3:140727705-140727727 TGGAAGAAAGAGACTGGGAAAGG - Intergenic
964419620 3:156487648-156487670 TGGATGGAACAGTTTGTACAGGG + Intronic
965215253 3:165855364-165855386 AGGAAGAAACAGGTTTTTCAGGG - Intergenic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
967043922 3:185719064-185719086 AGGAAGAAACAGACTGTGTTTGG + Intronic
967065482 3:185911577-185911599 AGAAAGAAACAGATTGTGGCCGG + Intergenic
967065529 3:185911883-185911905 TAAAAAAAACAGATTGTGAATGG + Intergenic
967436260 3:189450141-189450163 GGGATGAAACAGGTTTTGCAAGG + Intergenic
967661385 3:192114639-192114661 TTCAAGAAACAGATTTTGTAAGG - Intergenic
968589600 4:1450719-1450741 TGGAGGTGACAGATTGTGCCCGG - Intergenic
969125021 4:4940777-4940799 GGGAAGGAAAACATTGTGCAGGG + Intergenic
970343902 4:15135030-15135052 GGGAAGAGAGAGCTTGTGCAGGG + Intergenic
970398837 4:15698340-15698362 GGCAAGAGACAGCTTGTGCAGGG - Intronic
972138014 4:35917260-35917282 TGGCAGAAACTGATGGTCCAAGG + Intergenic
972722370 4:41713090-41713112 TGGAAGAAACAGAGTCCACAAGG + Intergenic
972993476 4:44851230-44851252 TCAAAGAGACAGCTTGTGCAGGG - Intergenic
973596348 4:52494364-52494386 AAGAAGAAAAAGCTTGTGCAGGG - Intergenic
974093286 4:57334929-57334951 AGGCAGAAGGAGATTGTGCACGG + Intergenic
974773053 4:66441209-66441231 TGAAAGATACACGTTGTGCATGG - Intergenic
974845782 4:67350156-67350178 TGCAAGAAGAAGATTCTGCATGG + Intergenic
975215015 4:71743063-71743085 TTGAAGAAAAAGATTGATCAAGG + Intronic
976416285 4:84779999-84780021 TGGAAGAATTATATTGTCCAAGG - Intronic
976421283 4:84847432-84847454 TGAAAGAAACAGATTATTTATGG + Intronic
977832397 4:101609086-101609108 AAGAAGAGACAGCTTGTGCAGGG - Intronic
978217847 4:106228358-106228380 TGGAGGATACACATTGTGAATGG - Intronic
979746057 4:124214661-124214683 AGGAAGAGACAGACTGTGGATGG - Intergenic
979935899 4:126695130-126695152 TGGAAGAAGCAGGTAATGCAGGG - Intergenic
980720268 4:136686619-136686641 AGGCAGAGACAGCTTGTGCAGGG + Intergenic
980938650 4:139250736-139250758 TGGAAAAAACAAATTGTAAAAGG - Intergenic
981497712 4:145412260-145412282 CAGAAGAAACAGCTAGTGCAAGG - Intergenic
981820182 4:148878936-148878958 TGAAAGACAAAGATTGTGCATGG - Intergenic
982318074 4:154051189-154051211 TGGAAGAGACACATAGTGCATGG + Intergenic
983164437 4:164458478-164458500 GGGAAGAGAGAGCTTGTGCAAGG - Intergenic
983792626 4:171815684-171815706 TGGAAGGTACAGAGTGTTCATGG - Intronic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
985798035 5:1979132-1979154 AGGAAGAGACAGCATGTGCAGGG + Intergenic
986636316 5:9825326-9825348 GGGAAGAGAGAGCTTGTGCAGGG + Intergenic
987081863 5:14432340-14432362 TGGAAGAAACCTTTGGTGCAGGG + Intronic
987275635 5:16359496-16359518 TGGAAACAACAGATGCTGCAAGG + Intergenic
987773453 5:22335626-22335648 AGGCAAAAAGAGATTGTGCAGGG - Intronic
988330127 5:29826782-29826804 TGGAAGAAAGATGCTGTGCATGG - Intergenic
988358327 5:30204392-30204414 TGGAAGAAACAAATTTGACAAGG - Intergenic
989811883 5:45687229-45687251 TGAAAGAAAAAGACTGTCCAAGG - Intronic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990810733 5:59720049-59720071 TGGAAGAAACAGCTTCAGAAGGG - Intronic
991251931 5:64572438-64572460 AGGAAGAAATAAATTGTACAAGG + Intronic
991459173 5:66838737-66838759 AGGAAGCAACAGTGTGTGCAAGG + Intronic
991715154 5:69444863-69444885 TGGAAGAAAGAAAATGTACAGGG - Intergenic
992183032 5:74216428-74216450 TGCTAGAAACAAAATGTGCACGG + Intergenic
993809739 5:92461216-92461238 TGTAACAACCAGATTGTGCAAGG + Intergenic
994784339 5:104136863-104136885 GGCAAGAAACAGATGGTGCATGG - Intergenic
998206844 5:140163480-140163502 TGGAAGAAAGAAATTCTGCCAGG + Intergenic
1000224619 5:159248529-159248551 TGGAAGAAACAGAAGGTACTGGG + Intergenic
1000448680 5:161357375-161357397 TGGCTGGAACAGAATGTGCAAGG + Intronic
1000782815 5:165504834-165504856 TGGAAGAAAAAGATGTTGCTCGG - Intergenic
1000827394 5:166062331-166062353 AGGATGAAACAGATAGTGCAGGG - Intergenic
1002733249 5:181359331-181359353 TGGAAAAAACAGAATGTATAAGG - Intergenic
1004055557 6:12134424-12134446 TGCAAGAATCAGCTTGTACAGGG + Intronic
1004495307 6:16157275-16157297 AGGAAGAAATTGATTTTGCATGG - Intergenic
1006857909 6:37148723-37148745 TGGAAGAATCAGCTAGTGGAAGG - Intergenic
1007032583 6:38641379-38641401 TGGAAGAAAGACATTGTGAATGG - Intergenic
1007256007 6:40529165-40529187 TGGAAGAAGCAGAGAGAGCAGGG + Intronic
1008184523 6:48372498-48372520 TGGATTAAACAGATTGTAGATGG - Intergenic
1008352398 6:50507374-50507396 TGGAAGAAATTAATTATGCAGGG + Intergenic
1008357346 6:50570234-50570256 AGGAAAAAACAGAATCTGCAGGG + Intergenic
1009199295 6:60724404-60724426 TGGAGAAAACTGATTGTGGAAGG - Intergenic
1010550372 6:77214661-77214683 TGGTAGAAAAAGATTCTGAAAGG - Intergenic
1010751104 6:79616825-79616847 GGGAAGAAAAAGAAAGTGCATGG + Intergenic
1011702707 6:89970393-89970415 TGGAAGGAACAGAATGTCAAAGG + Intronic
1011708498 6:90027250-90027272 TGGGAGAAAAAGAATGTGCTTGG + Intronic
1011827415 6:91325782-91325804 TTTAAGAAACAGGGTGTGCAAGG - Intergenic
1013066867 6:106692664-106692686 TGGCAGAAAGAGAGGGTGCAGGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013648281 6:112167760-112167782 AGGAAGATACAATTTGTGCAAGG + Intronic
1013865540 6:114691722-114691744 TCCTAGAACCAGATTGTGCAAGG - Intergenic
1013888837 6:115001566-115001588 TGGAAGAGACAAATTTTACAAGG - Intergenic
1014783605 6:125592703-125592725 TGAAAGAAACAGAATTTGCAGGG - Intergenic
1015449649 6:133350553-133350575 TGAAAGGAACTTATTGTGCATGG + Intronic
1015613212 6:135048233-135048255 TGGAAGAAACTGCTTCTGGAAGG - Intronic
1017371717 6:153717666-153717688 TGGAAGAACCACATTCTGGAGGG - Intergenic
1017561282 6:155631283-155631305 GGCAAGAAAGAGATTGTGCAGGG + Intergenic
1017664448 6:156706075-156706097 TAGAGGAAACAGCTTGTTCATGG + Intergenic
1017692660 6:156982827-156982849 CAGAAGAAACAGATAATGCAAGG - Intronic
1018138951 6:160807532-160807554 TGGATGAATCAGATTGTGGATGG + Intergenic
1018549625 6:164980798-164980820 GGCAAGAAAGAGCTTGTGCAGGG - Intergenic
1018697070 6:166398479-166398501 TGGAAGAGAAAGATTGTCCAGGG + Intergenic
1019237499 6:170631653-170631675 TGGAAAAAACAGAATGTATAAGG - Intergenic
1019480742 7:1265569-1265591 TTGAAGGAACAGATTGTTTATGG + Intergenic
1019480760 7:1265657-1265679 TTGGAGAGACAGATTGTGTATGG + Intergenic
1019840068 7:3432577-3432599 GGGAAGAAACATATTTTGCTAGG + Intronic
1020218109 7:6211267-6211289 TGATAGAAAGCGATTGTGCAGGG - Intronic
1020436053 7:8163703-8163725 TGGAAGGAAAAGTGTGTGCAAGG + Intronic
1021991526 7:26146000-26146022 TGGAAGAGACACATAGGGCAAGG - Intergenic
1022009639 7:26297659-26297681 TGCAGGAAACAGATTTTTCAGGG + Intronic
1022252621 7:28623590-28623612 TTAAAGAAACAGATTCTACAGGG + Intronic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1023274725 7:38506074-38506096 TTGAAGAAACAAATTCTGTATGG - Intronic
1023520690 7:41047319-41047341 TGGATCAGACAGATTGTGGAGGG - Intergenic
1023761828 7:43471393-43471415 AGCAAGAAGCAGATTGTCCAGGG - Intronic
1024050635 7:45620855-45620877 TGGGAGAAGAAGATTCTGCATGG - Intronic
1024960251 7:54967225-54967247 TGGAAGAGAAAGACTGTGAAAGG - Intergenic
1024964882 7:55015551-55015573 TGGAAGAAGCAGCTTTTTCAAGG - Intergenic
1027674263 7:81140559-81140581 TGGAAGAAACAGTATGGGCTGGG - Intergenic
1028094929 7:86748410-86748432 TGGATGTAACATATTGTGCTTGG - Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029515573 7:101021076-101021098 TGGAAGGCACAGAAAGTGCAAGG - Intronic
1030626276 7:111849234-111849256 AGGAAGAAAAAGATAGTTCAGGG - Intronic
1031106858 7:117554433-117554455 TGGGAGAAACAGGTTTTGGATGG + Intronic
1031519527 7:122746553-122746575 TGGAAGAAGCAGATTGTCTTGGG + Intronic
1035358830 7:158296436-158296458 TGGAAGAATCAGATCGCACATGG - Intronic
1035510269 8:174958-174980 TGGAAAAAACAGAATGTATAAGG + Intergenic
1036114100 8:5940091-5940113 AGGAAGAGAGAGCTTGTGCAGGG + Intergenic
1036154300 8:6327536-6327558 TGGAATAAACAGATGGGGGAAGG - Intergenic
1038026466 8:23595381-23595403 TGGAAGACACAAACTTTGCAAGG + Intergenic
1038706435 8:29898274-29898296 GGCAAGAGACAGCTTGTGCAGGG + Intergenic
1039290142 8:36085871-36085893 TGGAAGAATCAGAATGTGTGTGG + Intergenic
1039405714 8:37310703-37310725 TGGCAGACAGTGATTGTGCAGGG - Intergenic
1040507667 8:48065584-48065606 TGAAAGAAAAATATTGTTCAAGG + Intergenic
1040523097 8:48194414-48194436 TGGAAGAAACAAACAGTGCCTGG - Intergenic
1040744736 8:50627756-50627778 TGGAAGAAATACATGGAGCAAGG + Intronic
1041869858 8:62620364-62620386 TTTGAGAAACAGAATGTGCATGG - Intronic
1042773087 8:72399935-72399957 GGGAAGAGAGAGTTTGTGCAGGG + Intergenic
1042797132 8:72676845-72676867 GGGAAGGAACAGAATGTGTATGG - Intronic
1042957947 8:74271852-74271874 TGGAAGAATCACATCCTGCAGGG + Intronic
1043022983 8:75027797-75027819 TCAAAGAAACAGAATGTACAAGG - Intronic
1043031148 8:75135071-75135093 TGAAGGAAACAGATTGAGGAGGG - Intergenic
1043256922 8:78149324-78149346 TGAAAGAAAAAAATTGTCCATGG - Intergenic
1043552470 8:81390123-81390145 AGAAAGAAACAAATTGTTCAAGG + Intergenic
1045706268 8:104926625-104926647 TGGAAGCAACAGAGTTAGCATGG + Intronic
1046635403 8:116669900-116669922 TGGTAGAAGCAGAGTGTGTAGGG - Intronic
1047056370 8:121169079-121169101 TGGAAGAAATAGAGAGTACAAGG - Intergenic
1047425602 8:124742706-124742728 TTGAAGACAAAGATTGTGCCTGG - Intergenic
1048264777 8:132976131-132976153 TGGGAGAAAGAAATTGTGCTTGG + Intronic
1048565129 8:135588300-135588322 TGGAAGAGACACATAGGGCAAGG + Intronic
1048652520 8:136494847-136494869 GGCAAGAAAGAGCTTGTGCAAGG + Intergenic
1048768673 8:137871092-137871114 AGCAAGAAACAGAGTGTACAAGG + Intergenic
1050246938 9:3700286-3700308 CGGAAGAGTCAGATTGTGAATGG - Intergenic
1050379258 9:5009568-5009590 CAGAAGAAACAGATAATGCAGGG - Intronic
1050598264 9:7225566-7225588 GGGAAGAGAGAGCTTGTGCAGGG + Intergenic
1050677891 9:8077161-8077183 TGAAAGAGAAACATTGTGCAGGG + Intergenic
1050694845 9:8267147-8267169 TGGCTGAAACAGAATGTGAAAGG + Intergenic
1050710899 9:8462040-8462062 ATGAAGAGACAGATTCTGCATGG - Intronic
1053618383 9:39792480-39792502 TGGCAGGAACAGCTTGTGGATGG - Intergenic
1053637842 9:40032721-40032743 TGCAAGAAACATATTGAACAAGG + Intergenic
1053768240 9:41432501-41432523 TGCAAGAAACATATTGAACAAGG - Intergenic
1053876559 9:42551838-42551860 TGGCAGGAACAGCTTGTGAATGG - Intergenic
1053896116 9:42742865-42742887 TGGCAGGAACAGCTTGTGAATGG + Intergenic
1054235139 9:62549883-62549905 TGGCAGGAACAGCTTGTGAATGG + Intergenic
1054265772 9:62914949-62914971 TGGCAGGAACAGCTTGTGAATGG + Intergenic
1054318640 9:63629324-63629346 TGCAAGAAACATATTGAACAAGG + Intergenic
1054546908 9:66344004-66344026 TGCAAGAAACATATTGAACAAGG - Intergenic
1055257933 9:74394416-74394438 TGGAAGGAGCAGTGTGTGCAAGG - Intergenic
1057302826 9:93896463-93896485 GGGAAGGAACAGAATGGGCAGGG - Intergenic
1058998557 9:110324182-110324204 TGGATGAAACTGATTTTGAAAGG + Intronic
1059327639 9:113513925-113513947 GGGAGGAAACAGATTGGGCTGGG + Intronic
1059962397 9:119577998-119578020 TGGATGCAACTGATTGTGCCAGG + Intergenic
1060087009 9:120713071-120713093 TGGAAGAAAAAAATGGTGCGAGG + Intronic
1061770740 9:132918922-132918944 TAGAAGAAACAGATTATGCAGGG + Intronic
1061998548 9:134203819-134203841 AGGAAGAAACTGATTTTGTATGG - Intergenic
1062298894 9:135852752-135852774 TTGAAGAATAAGAATGTGCAGGG - Intronic
1202785710 9_KI270719v1_random:16291-16313 TGCAAGAAACATATTGAACAAGG + Intergenic
1185640029 X:1584940-1584962 AGAAAGAAACAGATTTTTCAGGG + Intergenic
1186148158 X:6646424-6646446 TGGAAGAGACATATAGAGCAAGG + Intergenic
1187002069 X:15192244-15192266 TGGATGAAACAGAGTGTCTAGGG - Intergenic
1188538304 X:31221293-31221315 AGCAGGAAGCAGATTGTGCAAGG - Intronic
1189592540 X:42530349-42530371 TGGAAGAAATAGGTTGGGAAAGG - Intergenic
1189757062 X:44282793-44282815 TGGAAGAAACTGAGGGTGGAGGG + Intronic
1190172127 X:48119993-48120015 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190189664 X:48266746-48266768 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1190196891 X:48327370-48327392 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190205949 X:48402755-48402777 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190462285 X:50689526-50689548 TGAAAGAAAGAGGTTGTGTATGG - Intronic
1190658426 X:52633250-52633272 GGGCAGAATCAGAGTGTGCAGGG + Intergenic
1190659907 X:52644756-52644778 GGGCAGAATCAGAGTGTGCAGGG - Intronic
1190676824 X:52789588-52789610 GGGCAGAATCAGAGTGTGCAGGG + Intronic
1193279247 X:79627666-79627688 AGGCAAAAAGAGATTGTGCAGGG - Intergenic
1195086910 X:101421637-101421659 TGGAGGACACAGTGTGTGCAGGG - Intronic
1196126825 X:112109991-112110013 TGGAGGAAACAGATTTGACAAGG + Intergenic
1196267480 X:113667363-113667385 TGGAAGCAACAGTTCATGCATGG + Intergenic
1197287019 X:124607608-124607630 TGGGAGAAGCAGATTGGGTAGGG + Intronic
1198205255 X:134459828-134459850 TGGAAGCCACAGGTAGTGCAAGG + Intergenic
1198625170 X:138564162-138564184 TGGAGGAAACAGATGTTTCAGGG + Intergenic
1200951952 Y:8906225-8906247 TGGTAGAAGCAGATTGTCCTGGG + Intergenic
1202172231 Y:22061965-22061987 TGGAAGGAGCAGACTGTGGAAGG - Intergenic
1202219133 Y:22524406-22524428 TGGAAGGAGCAGACTGTGGAAGG + Intergenic