ID: 1022480770

View in Genome Browser
Species Human (GRCh38)
Location 7:30741649-30741671
Sequence CTCAGGTTCTTAAAGTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022480770_1022480777 14 Left 1022480770 7:30741649-30741671 CCTTTCCACTTTAAGAACCTGAG 0: 1
1: 0
2: 2
3: 28
4: 189
Right 1022480777 7:30741686-30741708 GTGGAAAAACCAGCCTCCCCAGG No data
1022480770_1022480772 -8 Left 1022480770 7:30741649-30741671 CCTTTCCACTTTAAGAACCTGAG 0: 1
1: 0
2: 2
3: 28
4: 189
Right 1022480772 7:30741664-30741686 AACCTGAGATCCTGTTCCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 171
1022480770_1022480774 -5 Left 1022480770 7:30741649-30741671 CCTTTCCACTTTAAGAACCTGAG 0: 1
1: 0
2: 2
3: 28
4: 189
Right 1022480774 7:30741667-30741689 CTGAGATCCTGTTCCTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022480770 Original CRISPR CTCAGGTTCTTAAAGTGGAA AGG (reversed) Intronic
900295705 1:1948177-1948199 CCCCGGTTCTGAAAGTGGAAGGG + Intronic
900371062 1:2332421-2332443 CTCAGGTTCTTCCAGTGGGATGG + Intronic
900576318 1:3384215-3384237 CTCAGGTCCCTAAAGTAGAAAGG - Intronic
904238427 1:29128597-29128619 CTCAGGATCTTAGAGGGCAATGG + Intergenic
907783902 1:57593192-57593214 CACAGGTCCTGAAAGTAGAATGG - Intronic
908055408 1:60280884-60280906 CTCAGGCTCTGAAAGGCGAAGGG + Intergenic
911563129 1:99430827-99430849 CTCAGATTCTTAACTAGGAAAGG + Intergenic
916006748 1:160668523-160668545 CTCAGCTTCTCAAAGTGTTAGGG + Intergenic
916891930 1:169120493-169120515 CTCTGTTACTTAAAATGGAAAGG + Intronic
917485463 1:175451142-175451164 CTCAGTTTCCTCAAGTGCAAAGG - Intronic
917619978 1:176785775-176785797 CTGAGGTTATTAAACTGGCAAGG + Intronic
917684064 1:177397870-177397892 CCCAGATTCTTACATTGGAAGGG - Intergenic
918207783 1:182324764-182324786 CTTTGGTTCTTAGAGTGGCAAGG + Intergenic
918694792 1:187532027-187532049 ATGAGTTTCTTAAAGTGGCAGGG - Intergenic
919659970 1:200234713-200234735 CTACAGTTCTTAAAGTTGAAGGG - Intergenic
920692816 1:208159779-208159801 CTCTGGTTCTCAGAGAGGAAGGG + Intronic
923318146 1:232801724-232801746 CTCAGCTTCAGAAAATGGAAAGG - Intergenic
1062893190 10:1081239-1081261 CTGACCTTCTTAAAGTGGAAAGG + Intronic
1066024883 10:31345930-31345952 TATAGATTCTTAAAGTGGAAAGG + Intronic
1066493229 10:35915376-35915398 CACAGGTCCTTAAAATGAAAAGG - Intergenic
1069465335 10:68633487-68633509 CTCAGGAGGCTAAAGTGGAAGGG - Intronic
1070600086 10:77859895-77859917 CTCAGGGTCTTTTGGTGGAAAGG - Intronic
1073126633 10:101154719-101154741 CTCAGCCTCTCAAAGTGGGAAGG + Intergenic
1073423339 10:103441504-103441526 CTCAGCTTCTTAAAGTGTTGGGG + Intronic
1074543890 10:114387628-114387650 CTCAGTTTCTTAATCTGAAAAGG - Intronic
1079966462 11:26986126-26986148 CTGAGGTTATTAAAGAAGAATGG - Intergenic
1080265151 11:30392660-30392682 CACTGGTTCTTAAAGGGGACGGG + Intronic
1080279610 11:30541549-30541571 CTGAGGATTTTAAAGTGGAATGG - Intronic
1082894080 11:58171645-58171667 CTCAGGCTATAAAATTGGAATGG - Intronic
1084435854 11:69139091-69139113 CTAATGTTCCTAAATTGGAAAGG - Intergenic
1085329392 11:75635294-75635316 CTCATTTTATTAAAGTGAAAAGG + Intronic
1086891759 11:92266596-92266618 CTGAGGCTGTTAGAGTGGAAAGG - Intergenic
1087800441 11:102497813-102497835 CTCAGAATTTTAAAATGGAATGG + Intronic
1088083014 11:105942990-105943012 CTCAGACTCTCAAAGTGGGAAGG - Intronic
1088303140 11:108380370-108380392 GTCAGGTACTTAACTTGGAAAGG + Intronic
1088533389 11:110834791-110834813 GTCAGGTTCTGAAAGCGGACTGG - Intergenic
1089966824 11:122660181-122660203 CTGAAGTTCATATAGTGGAATGG - Intronic
1090445957 11:126764926-126764948 CTCTGGTTTTTCAAGTGCAAGGG + Intronic
1092977406 12:13758544-13758566 TATAGGTTCTTAAAATGGAATGG + Intronic
1096000337 12:48124563-48124585 CTCAGGATCAGAAGGTGGAAGGG - Intronic
1097090158 12:56498482-56498504 CTAAGGCTTTTAATGTGGAATGG + Intergenic
1098154314 12:67581577-67581599 CTCAGGAAATTAAAGAGGAATGG - Intergenic
1099308162 12:80983865-80983887 CTCAGGTGCTTAAAAGGTAAAGG - Intronic
1099588842 12:84559259-84559281 CTCTGACTCTTAAAATGGAATGG - Intergenic
1100813088 12:98359791-98359813 CTCAGGCTTTTAATGTGTAAGGG + Intergenic
1103574042 12:121863861-121863883 TTCAGGTTCAGGAAGTGGAAGGG - Intergenic
1103677607 12:122668473-122668495 CTCAGGTCCTGAAAGTGCAGGGG + Intergenic
1112656266 13:101454944-101454966 TTCAGGTTCTGATATTGGAAAGG + Intronic
1113271848 13:108683236-108683258 CTGAGTTGCTTAAAGTGGGAAGG - Intronic
1118087267 14:62431992-62432014 CCCAGGATTTTAAAGTAGAAAGG + Intergenic
1118632323 14:67717070-67717092 CTGAAGTTTTTAAAGGGGAAGGG - Intronic
1119061684 14:71481225-71481247 CTCAGGTTCTCAAAGTGCTAGGG - Intronic
1124155846 15:27224687-27224709 CTCAGGTATTTAAGATGGAAAGG + Intronic
1127651810 15:61016342-61016364 CTGTGGTTCTTAAAATAGAATGG + Intronic
1128657956 15:69476306-69476328 CCCAGCTTCTTCAAGTGTAAAGG + Intergenic
1131619160 15:94048809-94048831 CACAGGTTTTTTAAGTGGGAGGG - Intergenic
1132039659 15:98514250-98514272 CACAGTTTCTTAAAGGGGAAAGG + Intronic
1132967633 16:2667737-2667759 CTAAGGCTTTTAATGTGGAACGG + Intergenic
1134306415 16:13037165-13037187 CCCAGATTCTGAAAGCGGAAAGG + Intronic
1136684179 16:31984357-31984379 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1136784807 16:32927909-32927931 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1136884976 16:33925897-33925919 CTCAGGGTCTTGGGGTGGAAGGG - Intergenic
1138035370 16:53600038-53600060 CTTAGGATCATTAAGTGGAAAGG - Intronic
1138065013 16:53931634-53931656 TTCATGTTCTTAAAGTTGAAAGG - Intronic
1139375023 16:66491483-66491505 CTCAATTTCTTAAACTGAAATGG - Intronic
1203087468 16_KI270728v1_random:1191915-1191937 CTCAGGGTCTTGGGGTGGAAGGG + Intergenic
1144655975 17:17036921-17036943 CTCTGGTTCTGAGAGTGGACTGG - Intergenic
1146347174 17:32067498-32067520 CACAAGTCCTTAAAGTGCAAGGG - Intergenic
1147243432 17:39105615-39105637 CTCTGGTTGTTAAGGTGAAAGGG - Intronic
1147390424 17:40106005-40106027 ATCTGGTTCTAAAAGTAGAAGGG + Intergenic
1149350387 17:55780813-55780835 CTCAGGATCTTAAAAGGAAAAGG + Intronic
1153088953 18:1321821-1321843 ATGAGGTTCTTAGAGGGGAAAGG + Intergenic
1153465643 18:5385428-5385450 CTTAGAATCCTAAAGTGGAATGG - Intergenic
1153730234 18:8003854-8003876 CTAAGTTTCTTTAAGTAGAATGG - Intronic
1153996944 18:10451129-10451151 CTTAGGTGCTAAAAGGGGAATGG + Intergenic
1155912377 18:31518945-31518967 CTAAGGTTCTGAAAATGAAATGG + Intronic
1161617731 19:5281558-5281580 CTCAAGTTCTGGATGTGGAAGGG - Intronic
1163403257 19:17107369-17107391 CCCAGGGTCTCAAAGTGGCACGG + Intronic
1165007011 19:32815462-32815484 CAGAGGTTTTTAAACTGGAAAGG - Intronic
1165235680 19:34419591-34419613 CTCAGCTTCTCAAAGTGCTAGGG + Intronic
1166165419 19:40984359-40984381 CTCAGGTTCTGACAGTGGAATGG - Intergenic
1168115474 19:54219726-54219748 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168121278 19:54253875-54253897 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168124786 19:54277407-54277429 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168132819 19:54332033-54332055 CTCAGTTTCTCCAAGTGTAAAGG - Intergenic
1168181502 19:54665301-54665323 CTCAGTTTCTCCAAGTGTAAAGG + Intronic
925894235 2:8459001-8459023 GTGATGTTCCTAAAGTGGAAGGG - Intergenic
927179966 2:20438439-20438461 CTCAGGGTCCTCAACTGGAAAGG - Intergenic
928182772 2:29081062-29081084 CTCAGGCTCTGAAATTGGAGCGG + Intergenic
929868660 2:45739532-45739554 GTCAGGTTTTTAAAAAGGAAGGG - Intronic
930982983 2:57550549-57550571 CTCTGGTTCTTAAGTTAGAAGGG - Intergenic
931138851 2:59434982-59435004 CTCAGGTTCTTCAATAGAAAAGG + Intergenic
931565817 2:63614715-63614737 ATGAGGTTCTTCAAGTGAAAAGG - Intronic
931755616 2:65371619-65371641 CTATGTTTCTTAAAGTGTAACGG + Intronic
932171991 2:69565756-69565778 CCCAGGTTCTTACCGTGGAGAGG - Intronic
932380677 2:71278874-71278896 CCCAGGTTCTAAATTTGGAATGG + Intronic
932877861 2:75472417-75472439 CTCACATCCTTTAAGTGGAAGGG - Intronic
933046891 2:77550328-77550350 CTCAGGTTCGTAAACTTGAGTGG + Intronic
935493832 2:103753639-103753661 ATCAGGGTCTTAAAATGAAAGGG + Intergenic
936558751 2:113518407-113518429 CACAGGATATTAAAGTGGAAAGG + Intergenic
936762950 2:115808408-115808430 CTCAGCTTCTACAAGAGGAATGG + Intronic
940377552 2:152972534-152972556 CTCTGGTTCTTACAATGAAAAGG + Intergenic
940835069 2:158511972-158511994 CTCAGTTTTTTAAAGTGTTATGG + Intronic
941103861 2:161330107-161330129 TTCAAGTTCTTAGAATGGAAGGG + Intronic
941149878 2:161901261-161901283 CTCAGATTCTTAGAATGAAAAGG + Intronic
941711241 2:168715553-168715575 CTAAGGTTTTTACAGTGGAAAGG + Intronic
942044936 2:172094824-172094846 CTCGGCTTCTTAAAGTCGCAGGG - Intergenic
943566558 2:189523670-189523692 CTCATTTTCTTAAATTAGAAGGG + Intergenic
944064110 2:195601437-195601459 CTCAGGTTCTCAAAACTGAACGG - Intronic
944889997 2:204107681-204107703 ATCAGGTTCTTAAAGAGGTCTGG + Intergenic
945471253 2:210229919-210229941 ATCAGGTGCTTAGAGTGCAATGG + Intergenic
945862418 2:215139103-215139125 TTCAGGCTCTTATAGTGAAAGGG + Intergenic
948306056 2:236947762-236947784 CTCGGGTGCTTTCAGTGGAAAGG - Intergenic
1171058596 20:21933176-21933198 CTGAATTTCTGAAAGTGGAATGG + Intergenic
1172213796 20:33219843-33219865 CTCAGCCTCTTAAAGTGCTAGGG - Intronic
1173123401 20:40314867-40314889 CTGAGGTTGTAAAAGTGCAAAGG - Intergenic
1174469560 20:50746562-50746584 TTCAGGGTGTTAAAGTGTAAAGG - Intronic
1182760274 22:32717127-32717149 CTCAGTTTCTTCATGTGTAAAGG - Intronic
1183146866 22:36000940-36000962 CTCAGTTTCCTAAACTGAAAGGG - Intronic
1183815442 22:40296292-40296314 CTCAATTTCTTATAGTGGAGGGG - Intronic
949645084 3:6084023-6084045 CCCAGGTTTTTCAAATGGAAAGG - Intergenic
950330869 3:12155138-12155160 CTGAGGTTCTAAAAGAGGCATGG - Intronic
953056726 3:39393406-39393428 CTGAGGTACTTAAAGTTAAAAGG - Intronic
954526515 3:51276591-51276613 CTCAAATTCTTCATGTGGAATGG + Intronic
954961964 3:54573988-54574010 TGCAGGTTCTTAAAGTGCAGGGG + Intronic
955484485 3:59421983-59422005 ATCAGGTTTCTAAAGAGGAAAGG + Intergenic
957780045 3:84807284-84807306 CTCAGAAACTTGAAGTGGAAGGG - Intergenic
959096585 3:101963286-101963308 GTCAAGTTGTTAAAGAGGAAAGG - Intergenic
959678455 3:109065064-109065086 CTCAGGTGGTAATAGTGGAAGGG - Intronic
959928919 3:111957124-111957146 CTCAGCTTCTGAAGTTGGAATGG + Intronic
961221625 3:125205514-125205536 AACAGGTCTTTAAAGTGGAAAGG + Intronic
964971229 3:162565054-162565076 ATCAGTTTCTTAAAGTTGAAAGG - Intergenic
967120029 3:186374501-186374523 CTCAGGGACTGAAGGTGGAAGGG - Intergenic
967404392 3:189099684-189099706 CTCAATTGCTTAAAATGGAAAGG + Intronic
967563013 3:190939518-190939540 CTAAGGTTCTGAAAGTAGATGGG - Intergenic
968990790 4:3910206-3910228 GTCAGGATCTAAGAGTGGAAAGG - Intergenic
970113984 4:12672137-12672159 CTCAGTTTCTTCATGTGAAATGG + Intergenic
970116756 4:12705953-12705975 CTCTGGTTCTGAAGATGGAAGGG - Intergenic
970743990 4:19273232-19273254 GTCAAGTTGATAAAGTGGAATGG + Intergenic
972954877 4:44376816-44376838 GTCAGGTTCTTAAATTGAAAAGG + Intronic
976001916 4:80384771-80384793 CTGAGGTGCTTAAATTAGAAAGG - Intronic
976466855 4:85379943-85379965 CTCAAGTTCTTAAAGTGTACAGG + Intergenic
979292399 4:118992190-118992212 CACAGGTTTTTTATGTGGAAGGG + Intronic
979506303 4:121501639-121501661 CTCAGCACCTTGAAGTGGAAGGG - Intergenic
979603043 4:122607185-122607207 CTCAAGTTCTGAAAGTGGGAAGG + Intergenic
980763042 4:137261864-137261886 CTCAGGTTCTTGAAGTATAGTGG + Intergenic
981031183 4:140127280-140127302 CTCAGGTTCTTGCAGGGGAGGGG + Intronic
981096958 4:140791909-140791931 CTCAGATTGTCAAAGTGGCAGGG - Intergenic
981284530 4:143000358-143000380 CTCGGGATGCTAAAGTGGAAGGG + Intergenic
981660081 4:147156849-147156871 ATCAGGTTCTGAAAGGGGAAAGG + Intergenic
986529212 5:8717204-8717226 CTCAAGTGCTTTAAGTGGAAAGG - Intergenic
987797436 5:22647220-22647242 CTCAGGTTCTTTAGCAGGAAAGG + Intronic
988128150 5:27070051-27070073 CCCAGGTTTCTGAAGTGGAAAGG - Intronic
991376530 5:65973825-65973847 TTTAGGTTTTTAAAGGGGAAAGG + Intronic
992608577 5:78487490-78487512 CTCACTTTCTTAAAGTGCTAAGG + Exonic
993560246 5:89397896-89397918 GTGAGGTACTTAAAGTAGAAAGG - Intergenic
995212850 5:109560329-109560351 AGCAGGGTATTAAAGTGGAAAGG + Intergenic
997781720 5:136666362-136666384 TTCCAGTTCTTAAAGTGGAAGGG + Intergenic
998670558 5:144348537-144348559 CTCAAGTTCTCAAACTTGAAAGG - Intronic
999173768 5:149617389-149617411 CTCAGGTTATTAAAACAGAAAGG + Intronic
1000804763 5:165776428-165776450 CTCAGGAGTTAAAAGTGGAAAGG + Intergenic
1001171923 5:169427477-169427499 CACAGATTCTTAACGTGGAAAGG + Intergenic
1003919848 6:10822800-10822822 CTCAAGTTCTTAAAGGGCAGAGG + Intronic
1004231415 6:13837043-13837065 GTCATGTTCTTAAAGGGAAAAGG - Intergenic
1004581980 6:16963205-16963227 CACAGGTACAGAAAGTGGAAGGG - Intergenic
1006013437 6:31061672-31061694 CTCAGGTTCTCCAAGTGTAAGGG - Intergenic
1006187121 6:32187898-32187920 CTCAGGGTCTTGGAGAGGAATGG + Intronic
1006968884 6:38019423-38019445 CTCATTTTCTTAATGTGAAAAGG - Intronic
1010438853 6:75869276-75869298 CTTAAGTTATTAAAATGGAATGG - Intronic
1011951922 6:92977621-92977643 CTCAGGTACTTGGTGTGGAAAGG + Intergenic
1013039658 6:106421080-106421102 CTCAGATTCTCAAAGTGGGATGG - Intergenic
1014078018 6:117259110-117259132 CCCAGGTTTTAAAAGCGGAATGG - Intergenic
1015795911 6:137010983-137011005 CTCAGCTTCTCAAAGTGTTAGGG - Intronic
1022166681 7:27772001-27772023 CTCAGATTCTAAAAGTATAATGG + Intronic
1022380807 7:29858128-29858150 TTTTGGTTCTTAAAGTGAAATGG + Intronic
1022480770 7:30741649-30741671 CTCAGGTTCTTAAAGTGGAAAGG - Intronic
1022662981 7:32383765-32383787 CTCAGTTTCTGACACTGGAAAGG + Intergenic
1023089751 7:36606906-36606928 CTCAGGTTGTTTAAGAAGAAAGG + Intronic
1025027943 7:55533616-55533638 CTCAGCTTCTTCAGATGGAAGGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1029011588 7:97267648-97267670 CTGAGTTTCTTATAGTGGAGAGG - Intergenic
1030969062 7:116031472-116031494 CTCAGGAACTTAAAATGGAAAGG + Intronic
1033978016 7:147126089-147126111 CTCATGATATTTAAGTGGAAGGG - Intronic
1034325077 7:150222371-150222393 CTCAGTTTCCTCACGTGGAAAGG - Intergenic
1034768124 7:153746878-153746900 CTCAGTTTCCTCACGTGGAAAGG + Intergenic
1036685107 8:10904363-10904385 CTCAGGTTCCAGAAATGGAACGG + Intronic
1037058864 8:14481630-14481652 CTCTGGTAGTTAAAGTGGAAGGG + Intronic
1039069426 8:33636191-33636213 CCCAGGCTCTTAAAATGTAAGGG - Intergenic
1040418403 8:47217168-47217190 CTCAGGTTCTGAAAGGGAGAAGG - Intergenic
1043577276 8:81672581-81672603 CTCAGGTTTTTAAAGAAAAAGGG - Intronic
1044260911 8:90119530-90119552 CTCAGTTTCCTAAACAGGAAAGG - Intergenic
1046296418 8:112225082-112225104 CTCAGGTTTTTAAAGTAACAAGG - Intronic
1047177080 8:122552122-122552144 CACAGGTTATTAAAGTAGATGGG + Intergenic
1047884685 8:129236251-129236273 CTCAGGCTATTAAAGAGGAAAGG + Intergenic
1047936665 8:129787255-129787277 ATCAGGTTCTTACAGTGGAAAGG - Intergenic
1048677077 8:136794761-136794783 CACGAGTTCTTAAAGTGGCAGGG + Intergenic
1049894099 9:97774-97796 CACAGGATGTTAAAGTGGAAAGG - Intergenic
1050749311 9:8918458-8918480 CTGATGTTCTAAAAGTGAAAGGG - Intronic
1052126086 9:24776016-24776038 TACAGATTCTTAAATTGGAAGGG - Intergenic
1052303118 9:26975274-26975296 CTCTGGTTTTTAAAGGGTAAAGG + Intronic
1053735325 9:41097858-41097880 CACAGGATATTAAAGTGGAAAGG - Intergenic
1054693054 9:68333539-68333561 CACAGGATATTAAAGTGGAAAGG + Intronic
1056157533 9:83853403-83853425 GTGAGGTTCTTAAAGTTGGAGGG - Intronic
1056302902 9:85260138-85260160 CTCAGCTTCTTAAAGTGCTGGGG + Intergenic
1056353011 9:85770694-85770716 GTGAGGTTCTTAAAGTTGGAGGG + Intergenic
1059266433 9:113036348-113036370 CTATGGTTCTTCAAGTTGAAAGG - Intergenic
1059493234 9:114687325-114687347 CTCAATTTCTTAAAGGGCAAAGG - Intergenic
1059934487 9:119295293-119295315 CTCAGACTCTGAAAGTGGACAGG + Intronic
1062104814 9:134749330-134749352 CTCAAGTTCTGTAAGTGCAAAGG - Intronic
1062720612 9:138041286-138041308 CTCAGTTTCTTAATCTGGAAAGG + Intronic
1186321442 X:8430231-8430253 CTCAGGTCCTTAAAATTAAAGGG + Intergenic
1189223079 X:39389397-39389419 CTGAGATTCTGAGAGTGGAAGGG - Intergenic
1189734432 X:44055138-44055160 CTCTGCTTCTGAAAGTGAAATGG + Intergenic
1191104285 X:56763014-56763036 CACAGGTTCTAAATGTGCAAAGG + Intergenic
1195096845 X:101510469-101510491 CTGAGGTACTTGGAGTGGAAGGG + Intronic
1195431277 X:104792138-104792160 CTGAGGTTCAGAAAGAGGAAGGG + Intronic
1196409112 X:115397161-115397183 CTCAGGAGGCTAAAGTGGAAAGG + Intergenic
1199713235 X:150487131-150487153 CAGAGGTTCTCAAAGTGGAAGGG - Intronic
1200763316 Y:7059458-7059480 CTCCTGTTCATACAGTGGAAGGG - Intronic
1200769193 Y:7107968-7107990 CTCCTGTTCATACAGTGGAAGGG + Intergenic