ID: 1022481237

View in Genome Browser
Species Human (GRCh38)
Location 7:30744369-30744391
Sequence GGAGTTGCCAGAGCGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022481237_1022481242 15 Left 1022481237 7:30744369-30744391 CCCCACCTCGCTCTGGCAACTCC 0: 1
1: 0
2: 1
3: 17
4: 242
Right 1022481242 7:30744407-30744429 ACACCCTGCCCAACTGTGCATGG No data
1022481237_1022481244 18 Left 1022481237 7:30744369-30744391 CCCCACCTCGCTCTGGCAACTCC 0: 1
1: 0
2: 1
3: 17
4: 242
Right 1022481244 7:30744410-30744432 CCCTGCCCAACTGTGCATGGCGG 0: 1
1: 0
2: 2
3: 24
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022481237 Original CRISPR GGAGTTGCCAGAGCGAGGTG GGG (reversed) Intronic
900088153 1:908517-908539 GGAGGTGACAGAGGGAGGGGAGG + Intergenic
900177625 1:1297816-1297838 ACAGTTGCTATAGCGAGGTGTGG - Exonic
901436282 1:9249111-9249133 GGAGTTGCCAGAAAGGGGAGAGG - Intronic
902334335 1:15746545-15746567 GGAGTTGCCAGGGCTAACTGAGG + Intronic
902551485 1:17222215-17222237 GGAGTGGCCACAGTGGGGTGGGG - Intronic
903283678 1:22264296-22264318 GGAGCTGCCATGGCCAGGTGGGG - Intergenic
903455473 1:23484149-23484171 GGAGCTGCCGGAGCGGGGCGCGG + Exonic
906740859 1:48182481-48182503 GGATGTGCCAGAGTGAGATGGGG + Intergenic
911972441 1:104454725-104454747 GGAGCTCCCAGAGGGAGGGGTGG - Intergenic
912099956 1:106192358-106192380 GGAGTTTCCAGAGGGAGGGGTGG + Intergenic
914865843 1:151428084-151428106 GGAGATGGCAGAGCCAGGTTGGG - Intronic
916633150 1:166638354-166638376 GGAGCTTCCAGAGGGAGATGCGG + Intergenic
920173523 1:204086106-204086128 GGAGTGGCCTGGGCCAGGTGTGG + Intronic
920273954 1:204790051-204790073 GAAGTTGACAGAGAGAGATGGGG + Intergenic
920888663 1:209959751-209959773 GTAGTTGCCAGGGCTAGGGGAGG + Intronic
922720761 1:227899199-227899221 GGAGTGGCCAGAGCAGGGGGAGG + Intergenic
922797591 1:228348388-228348410 GGAGTTGCCATAAAGGGGTGTGG + Intronic
923102445 1:230827176-230827198 GGCCTTGCCAGAGCGTGATGTGG - Intergenic
1064746208 10:18481013-18481035 GGAATTGCCACAGAGAGGGGTGG - Intronic
1065070815 10:22022132-22022154 GGAGATGGCAGAGAGAGGAGCGG + Intergenic
1065179045 10:23106709-23106731 GGAGTGGCCAGAACCTGGTGAGG - Intronic
1066357071 10:34695184-34695206 GGAGTGGCCAGGGCCGGGTGTGG + Intronic
1066429520 10:35337508-35337530 GGAGCGGCCAGAGCTGGGTGGGG + Intronic
1069835292 10:71304255-71304277 GGGGTGGGCAGAGCCAGGTGTGG + Intergenic
1071318705 10:84429802-84429824 TAAGTGGCCAGAGCGAAGTGGGG - Intronic
1074429071 10:113377946-113377968 GGAGGTGCCAAAGGAAGGTGCGG + Intergenic
1074553178 10:114464103-114464125 GGAGTTGCCGGAGCGGCGTGGGG - Intronic
1075656155 10:124162550-124162572 GGAGTTGCCACGGTGGGGTGGGG - Intergenic
1075808074 10:125204498-125204520 GGAGATGCCAGGGTGGGGTGGGG + Intergenic
1076598857 10:131644209-131644231 GGAGTTCCCAGAACCACGTGAGG - Intergenic
1076844883 10:133065250-133065272 GGAGTGGCCAGCCCGAGGAGGGG - Intergenic
1077235833 11:1481678-1481700 GGAGTAGCCAGAGCCAGGCAGGG + Intronic
1078106846 11:8363139-8363161 GGAGTAGCCAGAGAGAGGGAAGG + Intergenic
1079322452 11:19462754-19462776 GGAGTAGACAGAGTGAGGTTGGG - Intronic
1079542396 11:21592129-21592151 GGAGAGGCCAGAGTGAAGTGAGG + Intergenic
1080277973 11:30524333-30524355 GGAGAGGCCAGAGAGAAGTGTGG + Intronic
1081230968 11:40585277-40585299 GGAGATGCCAGAGTGATGTAGGG - Intronic
1082071196 11:47941118-47941140 GGACTTGCCAGAGGCAGGGGAGG + Intergenic
1082809616 11:57471539-57471561 GGAGATGCCACAGGCAGGTGAGG + Intronic
1083627994 11:64081796-64081818 GGAGCTGCCGGAGAGAGGTCCGG + Intronic
1085520160 11:77133034-77133056 GGAGTTCCCAGACCTATGTGGGG + Intronic
1086183917 11:83990521-83990543 GGAGGTGTCAGTGAGAGGTGGGG + Intronic
1089130107 11:116205576-116205598 GAAGGTGGCAGAGGGAGGTGAGG - Intergenic
1090034575 11:123237658-123237680 GGATTGGCCAGAGCCAGGTGGGG - Intergenic
1092194865 12:6543090-6543112 GGAGGAGACAGAGAGAGGTGAGG + Intronic
1093484910 12:19641929-19641951 GGAGTAGCCAGAGAGAGATGAGG - Intronic
1095094480 12:38138429-38138451 GGAGTTCCCAGAGGGGTGTGGGG - Intergenic
1096473654 12:51895210-51895232 GGAGTTGCTAGAGTGAAGTCCGG - Intergenic
1096585503 12:52617173-52617195 GGAGTTTTCAGATGGAGGTGGGG - Intronic
1096810264 12:54164725-54164747 GGAGCTGCCAGAAGGAGGTGTGG - Intronic
1098145126 12:67489934-67489956 GGAGCTCCCAGAGGGAGGGGTGG + Intergenic
1098889184 12:75991487-75991509 GGAGTTGAGGGAGGGAGGTGGGG - Intergenic
1100411430 12:94323037-94323059 GGAGCTCCCAGAGGGAGGGGTGG - Intronic
1100604920 12:96143743-96143765 GCAGTTCCAAGAGAGAGGTGGGG - Intergenic
1102014365 12:109637957-109637979 GGACAAGCCAGAGCCAGGTGTGG + Intergenic
1102468822 12:113147637-113147659 GAAGTTGCCAGAGGCTGGTGTGG + Intergenic
1109097311 13:58134451-58134473 GGAGTTCCCAGAGGGAGGGTTGG - Intergenic
1110391389 13:74978786-74978808 GGAACTGCCAGATGGAGGTGGGG + Intergenic
1112014998 13:95324310-95324332 GGAGTTGCCAGGGCCAGGTGAGG - Intergenic
1113862798 13:113500834-113500856 GGACTAGCCAGAGAGAGATGTGG + Intronic
1113942638 13:114026364-114026386 GGTTTTGCCAGAGCGAGGGAAGG - Intronic
1114337068 14:21700685-21700707 GGAGGCGCCAGAGAAAGGTGAGG + Intergenic
1116432373 14:44861429-44861451 GGAGTTGCTAGAACAATGTGTGG - Intergenic
1117868684 14:60175454-60175476 GGAGATGTCAGAGAGAGTTGTGG + Intergenic
1118324997 14:64774606-64774628 GGAGGTGCCCGAGGGAGGAGGGG + Intronic
1118916857 14:70114942-70114964 GGACTTTGCAGAGCCAGGTGGGG + Intronic
1119019575 14:71096998-71097020 GGAGATGCCGGTGCGGGGTGGGG - Intronic
1122153183 14:99735506-99735528 GGAGTTGGCAGAGTGGAGTGTGG + Intergenic
1122620793 14:103056844-103056866 GGCGCTGCCAGAGCGAGAGGAGG + Intronic
1202859261 14_GL000225v1_random:71618-71640 GGAGTGGTCAGGCCGAGGTGGGG + Intergenic
1123496835 15:20834776-20834798 AGAGTTCCCAGAGAGAGGGGTGG - Intergenic
1123554067 15:21408368-21408390 AGAGTTCCCAGAGAGAGGGGTGG - Intergenic
1123590314 15:21845733-21845755 AGAGTTCCCAGAGAGAGGGGTGG - Intergenic
1124965503 15:34429958-34429980 GGGGTTGCCAAAGTGAGGAGTGG + Intronic
1125202655 15:37113652-37113674 AGAGTGGGCAGAGCGAGGTCTGG + Intergenic
1126466086 15:48962819-48962841 TGAGGTGCCAGGGCGGGGTGGGG + Exonic
1127930560 15:63594326-63594348 GGAGTAGCCATAGGAAGGTGAGG + Intronic
1129306360 15:74666675-74666697 GTAGTTGCCAGGGGGAAGTGGGG + Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1202962415 15_KI270727v1_random:135564-135586 AGAGTTCCCAGAGAGAGGGGTGG - Intergenic
1132731020 16:1362115-1362137 GGAGCCGGCAGAGCAAGGTGGGG + Exonic
1132903935 16:2272559-2272581 GGGGTTTCCTGAGTGAGGTGGGG - Intergenic
1135967664 16:27049300-27049322 GGCGTTGCCAGAGCCAGGATGGG - Intergenic
1136061083 16:27726888-27726910 AGAGGTCCCAGAGGGAGGTGGGG + Intronic
1139938811 16:70590405-70590427 GGAGGTGCCTGTGCGAGGTGGGG + Intronic
1141198971 16:81882775-81882797 GGATGAGCCAGAACGAGGTGGGG - Intronic
1142317627 16:89358209-89358231 GCTGATGCCAGAGTGAGGTGTGG - Intronic
1142890641 17:2940452-2940474 GGAGTTGCCATGGCGAGAGGGGG + Intronic
1143163334 17:4885382-4885404 GGACTTGCCTGAGCCAGCTGTGG - Intronic
1143293200 17:5848805-5848827 GGGATTGCTAGATCGAGGTGTGG + Intronic
1143461643 17:7108160-7108182 GGGGTGGCCAGAGAGAGGTGGGG - Intronic
1143491239 17:7286383-7286405 GGTGTTGACGGAGTGAGGTGGGG - Intronic
1143993249 17:10985175-10985197 GGAGTTGGGAGAGCAAGGGGAGG - Intergenic
1144773891 17:17774512-17774534 GCAGTGGCCAGAGCGGGGTCCGG - Intronic
1146217001 17:30985132-30985154 GGATCAGCCAGAGAGAGGTGGGG - Intronic
1147374979 17:40017883-40017905 GGAGAGGCCAGAGGGAGGTCGGG + Intergenic
1148330445 17:46810935-46810957 GGAGATGCCAGAGCGGGCTCTGG - Intronic
1148547578 17:48529550-48529572 GGAGGTGACAGAGCTGGGTGAGG + Exonic
1148823234 17:50373098-50373120 GCAGTAGTCAGAGCGGGGTGAGG - Intronic
1151329835 17:73400302-73400324 GGAGGTGGCAGAGCACGGTGGGG - Intronic
1154454849 18:14511149-14511171 AGAGTTCCCAGAGAGAGGGGTGG - Intronic
1156251161 18:35353557-35353579 GCAGGTGCAAGAGAGAGGTGGGG - Intergenic
1159517726 18:69479179-69479201 GTATTTGCCAGAGGGAGGAGAGG + Intronic
1160735720 19:661567-661589 GGAGTGGAAAGAGAGAGGTGTGG - Intronic
1162514278 19:11138778-11138800 GCGGCTGCCAGAGGGAGGTGGGG + Intronic
1162814273 19:13183820-13183842 GGAGTTCCCACAGGGAGCTGAGG + Intergenic
1163594322 19:18211983-18212005 GGAGGTGCCAGGTCTAGGTGTGG - Intronic
1163645718 19:18487981-18488003 GTTGTGGCCAGAGTGAGGTGGGG - Intronic
1164820801 19:31249754-31249776 GGACCTGCCAGAGGGAGGGGCGG - Intergenic
1165331009 19:35141250-35141272 GGCGGGGCCAGAGAGAGGTGGGG - Intronic
1165942802 19:39423637-39423659 GGAGCAGGCAGAGCCAGGTGAGG + Exonic
1166995272 19:46716999-46717021 GGCGTTGCCGGAGCGGGGTTGGG + Exonic
1168239121 19:55080525-55080547 GGAGCAGCCAGGACGAGGTGGGG + Intronic
1168536171 19:57172280-57172302 TGAGATGCCAGAGCAAGGTAGGG + Intergenic
1168682663 19:58327190-58327212 GGGGCGGCCAGAGCGAGATGCGG + Intronic
924988093 2:288850-288872 GGGGAGGCGAGAGCGAGGTGAGG - Intronic
926512512 2:13800059-13800081 GGAGTTGGGAGAGGGAAGTGGGG + Intergenic
927516552 2:23675016-23675038 GGAGTGGCCAGAGCCAGAGGTGG - Intronic
928739535 2:34333845-34333867 GGGGTTGAGAGAGAGAGGTGGGG + Intergenic
928844837 2:35658294-35658316 GGAGTTGGCAGAGGGAGAAGTGG - Intergenic
930305103 2:49666877-49666899 GGAGCTCCCAGAGGGAGGGGTGG - Intergenic
930525652 2:52525977-52525999 GTAGTTGCCAGAGGTAGGTGGGG - Intergenic
930574527 2:53130029-53130051 GTAATTGCCAGAGCTAGTTGTGG - Intergenic
930585955 2:53267583-53267605 AGAGTTCCCAGGGGGAGGTGTGG + Intergenic
932661547 2:73657533-73657555 GTGGTTGCCAGGGCGAGGCGGGG - Intergenic
935880231 2:107558078-107558100 GGTGGTGCCAGAGGCAGGTGTGG - Intergenic
936750467 2:115635225-115635247 CGAGTTCCCAGAGGGAGGGGTGG - Intronic
937098004 2:119248221-119248243 TGAGTTGCCAGAGGGAGGAAGGG - Intronic
938114284 2:128592580-128592602 GTAGTTGTCAGAGCTAGGGGCGG + Intergenic
939644641 2:144682439-144682461 GGAGTGACCAGAGCTGGGTGGGG + Intergenic
943069967 2:183129003-183129025 GGAGATGTCAGAGTGTGGTGGGG + Intronic
943304501 2:186242891-186242913 TGAGTTGTCAGAGCCAGTTGAGG + Intergenic
944502861 2:200379671-200379693 GGATTTGCCAGCGGGTGGTGGGG + Intronic
944932308 2:204532262-204532284 GGAGTTGCTAGGGCTAGGCGCGG - Intergenic
945917512 2:215719674-215719696 GAAGTAGCCATAGCCAGGTGAGG - Intergenic
946688317 2:222293115-222293137 GGAGTTGCCAGAGGGACAGGCGG - Intronic
948835870 2:240625709-240625731 GGGGTTCTCAGAGCGAGGTGAGG + Intronic
1169617412 20:7464510-7464532 GGAGGTGTAAGGGCGAGGTGAGG - Intergenic
1170760458 20:19244560-19244582 CCTGTTGCTAGAGCGAGGTGAGG + Intronic
1172429175 20:34876196-34876218 GGAGTGACCAGAGTGGGGTGGGG - Intronic
1172697988 20:36835492-36835514 GGAGCTGGCAGAGCAAGTTGGGG + Intronic
1173900922 20:46588304-46588326 GGAGTGCCCAGAGTGAGGGGAGG + Intronic
1175458785 20:59135294-59135316 GAAGTTGGCAGAGCTGGGTGTGG + Intergenic
1175591966 20:60200491-60200513 TGAGTTGCCAGGGTGAGGAGCGG - Intergenic
1176819316 21:13642159-13642181 AGAGTTCCCAGAGAGAGGGGTGG + Intergenic
1178914025 21:36697221-36697243 GGAGGTGCCAGAGCGGGCTCAGG + Intergenic
1179491174 21:41742466-41742488 GGAGGTGCCACTTCGAGGTGGGG - Intronic
1179813175 21:43885154-43885176 GCAGTTGGCTGAGGGAGGTGGGG - Intronic
1179882926 21:44300806-44300828 GGACTTGGCAGAGCTGGGTGGGG + Intronic
1180802147 22:18636908-18636930 GAAGGTGCCTGAGCCAGGTGAGG - Intergenic
1180853385 22:19032460-19032482 GAAGGTGCCTGAGCCAGGTGAGG - Intergenic
1182163728 22:28150741-28150763 GGAGGTGCCAGTGCCAGGTGTGG + Intronic
1183217496 22:36490332-36490354 GGAGCTGCCAATGCCAGGTGTGG + Intronic
1184564670 22:45284982-45285004 GGAGCCGCCAGAGCGCGGGGCGG - Exonic
1185267258 22:49910915-49910937 GGAGATGCCACAGCCCGGTGGGG - Intronic
953571352 3:44074268-44074290 GGAGGTGACAAAGCCAGGTGAGG - Intergenic
954498554 3:50988399-50988421 GGAGCTGCCAGAGGGAGAGGTGG + Intronic
954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG + Exonic
955209322 3:56926185-56926207 GGAGTTGCCAGGCTGAGGAGAGG + Intronic
957668175 3:83263657-83263679 GTATTTACTAGAGCGAGGTGTGG + Intergenic
961696628 3:128709690-128709712 GAGGTAGCCAGAGGGAGGTGGGG - Intergenic
966180182 3:177181089-177181111 CGAGTTGTCAGAGTGAGCTGAGG - Intronic
966854668 3:184185911-184185933 GGAGTTCCGGGAGCGAGGGGTGG - Intronic
967575640 3:191088296-191088318 GGACTTGCCAAAGCCAGTTGTGG - Intergenic
967662447 3:192129824-192129846 GGAGTTGGCAGAGAGAGCTTGGG + Intergenic
968425058 4:517736-517758 GGAGTTGCCTGAGGCAGGTGTGG + Intronic
968504363 4:965115-965137 GGGGTGGCCAGAGGGAGGTCGGG - Intronic
968835839 4:2963743-2963765 GGAGTTGCGCGCGCGAGGCGAGG + Exonic
972162498 4:36244195-36244217 GGAGTTCGAAAAGCGAGGTGAGG + Exonic
973271119 4:48264289-48264311 GGAGTGGCCAGAGGGATCTGTGG - Intronic
974092085 4:57322019-57322041 GGACTTGACAGAGCCTGGTGTGG - Intergenic
974184672 4:58430756-58430778 AGAGTTCCCAGAGGGAGGAGTGG - Intergenic
974801697 4:66827376-66827398 GGAGGTACCAGAGAAAGGTGAGG - Intergenic
975106270 4:70572084-70572106 GGAGCTCCCAGAGAGAGGGGTGG - Intergenic
975496462 4:75040971-75040993 GGAGTTCCCAGTAGGAGGTGGGG - Intronic
977002319 4:91519324-91519346 GGAGTTTCCAGAGGGTGGGGTGG - Intronic
978885455 4:113761866-113761888 GGAGTCGCTAGAGGGAGGTGTGG - Intronic
984705788 4:182846200-182846222 GGACTTGCCAGCCCGTGGTGAGG - Intergenic
985851089 5:2389570-2389592 GGAGCACCCAGAGCGAGGGGAGG - Intergenic
986172190 5:5324160-5324182 GGAGTTGCCAGAGAGAAAGGGGG + Intergenic
986423071 5:7603392-7603414 GGAGATGCCAGTAAGAGGTGGGG - Intronic
986998667 5:13636409-13636431 GGATTTTTCAGAGGGAGGTGAGG + Intergenic
991135399 5:63176488-63176510 GGAGCTCCCAGAGGGAGGGGTGG - Intergenic
993083112 5:83327209-83327231 GCAGTTGCCAGGGCTGGGTGTGG - Intronic
993226278 5:85169624-85169646 GGAGTTCCCAGAGGGAGGGTTGG - Intergenic
996691796 5:126348073-126348095 GGAGGGGCCAGAGAGTGGTGAGG - Intergenic
998750101 5:145311241-145311263 GGAGTTGCCAGGGCCAGGGAAGG + Intergenic
998897108 5:146811387-146811409 GGAGTAGCCAGATGGAGATGTGG - Intronic
1000327988 5:160186854-160186876 GGGATTGCAAGAGCCAGGTGTGG + Intergenic
1001445786 5:171781749-171781771 GGAGTTGGAAGTGAGAGGTGAGG + Intergenic
1004806103 6:19205379-19205401 GCAGTCGGCAGAGAGAGGTGGGG + Intergenic
1007771064 6:44192683-44192705 GGAGTGGCCAGAGAGAGAGGAGG - Intergenic
1016407843 6:143749049-143749071 GGAATTGCCTGATCAAGGTGAGG + Exonic
1016847230 6:148580522-148580544 GAAGTTGCCAGAAGGAAGTGAGG - Intergenic
1016897303 6:149066078-149066100 GGAGTGATCAGAGAGAGGTGAGG + Intronic
1017234892 6:152109050-152109072 GGAGAAGGCAGAGGGAGGTGGGG + Intronic
1017759478 6:157556867-157556889 GGAGAAGCCAGTGAGAGGTGGGG + Intronic
1018359558 6:163054079-163054101 GGACTTGCCAGTGAGAGGTCTGG + Intronic
1018426830 6:163690805-163690827 GGATTTGCCAGGGAGAGGTGGGG + Intergenic
1021466956 7:20955026-20955048 CTACTTGCCAGAGCCAGGTGTGG + Intergenic
1022469956 7:30676044-30676066 GGAGTTCCCAGAGCCAGCAGAGG + Intronic
1022481237 7:30744369-30744391 GGAGTTGCCAGAGCGAGGTGGGG - Intronic
1024165088 7:46722863-46722885 AGAGTTTCCAGAGGGAGGAGTGG + Intronic
1024165182 7:46723411-46723433 GGAGTTACCAGAGGCAGGGGCGG + Intronic
1024326229 7:48111362-48111384 AGAGTGGCCAGTGCGGGGTGAGG - Intergenic
1026221316 7:68399968-68399990 GGAGGTGCCATAGGGAGATGAGG + Intergenic
1026226034 7:68441940-68441962 GGAGTGGACAGAGCCATGTGTGG + Intergenic
1028086680 7:86644856-86644878 GGAGTTGTCGGTGCGAGGTAAGG + Exonic
1028774007 7:94658008-94658030 GAGGTGGCCAGAGAGAGGTGGGG - Intronic
1029203798 7:98856263-98856285 GGACTTGCCAGAGTCAGGGGAGG + Intronic
1030830238 7:114211036-114211058 CGAGTTCCCAGAGGGAGGAGTGG - Intronic
1031132144 7:117844758-117844780 CGGTTTGCCAGAGCGAGGGGAGG + Intronic
1033263111 7:139860598-139860620 GGAGTTGTCAGAGCGAGAGAAGG + Intronic
1033818594 7:145106241-145106263 GGAGTAGCCAGGGGGAGGTAGGG + Intergenic
1035391214 7:158506267-158506289 GGAGGTGCCAGACTCAGGTGGGG + Intronic
1035772720 8:2161703-2161725 GGAAGTCCCAGAGCAAGGTGTGG + Intronic
1037211873 8:16398718-16398740 GGGGTTGCCAGATTGGGGTGAGG - Intronic
1037726257 8:21484851-21484873 GGATTTGCCAGAGGGGAGTGAGG + Intergenic
1043229970 8:77788885-77788907 GGAGTTCCCAGAGGGAGGGGCGG - Intergenic
1045267867 8:100635669-100635691 GTAGTTGCCAGGGCGTGGTGGGG + Intronic
1045507531 8:102789167-102789189 GGAGTTGACAGAGCCAGCTGAGG + Intergenic
1049229930 8:141476740-141476762 GCTCTTGCCTGAGCGAGGTGGGG - Intergenic
1049708891 8:144054952-144054974 GCAGGGGCCAGAGCGGGGTGGGG + Intronic
1052205041 9:25828742-25828764 GGTGTTGCCACAGTGAGGTCTGG + Intergenic
1052311809 9:27075911-27075933 GGAGTTTCCAGGGGGAGGGGTGG - Intergenic
1053451643 9:38198585-38198607 GGAGTTGTCAGATGGAGGCGTGG + Intergenic
1059382258 9:113935472-113935494 GGTGTTTCCAGGGCCAGGTGGGG - Intronic
1060544865 9:124453765-124453787 GGCGTGGCCAGAGCTAGGCGTGG - Intronic
1060968901 9:127726935-127726957 GGGGTGACCAGAGCCAGGTGAGG - Intronic
1062103499 9:134740324-134740346 GGGGTCTCCAGAGCGAGCTGGGG - Intronic
1203528042 Un_GL000213v1:107411-107433 AGAGTTCCCAGAGAGAGGGGTGG - Intergenic
1185446142 X:258927-258949 GGGGTAGCTAGAGAGAGGTGGGG + Intergenic
1185446193 X:259142-259164 GGGGTAGCTAGAGAGAGGTGGGG + Intergenic
1185446240 X:259333-259355 GGGGTAGCTAGAGAGAGGTGGGG + Intergenic
1185446245 X:259353-259375 GGGGTAGCTAGAGAGAGGTGGGG + Intergenic
1185446268 X:259439-259461 GGGGTAGCTAGAGAGAGGTGGGG + Intergenic
1185446273 X:259459-259481 GGGGTAGCTAGAGAGAGGTGGGG + Intergenic
1185704779 X:2258591-2258613 GGAGGTCCCAGATCAAGGTGTGG - Intronic
1187417086 X:19102753-19102775 TCAGTTGGCAGAGAGAGGTGGGG - Intronic
1187646086 X:21348607-21348629 GGAGTTCCCAGAGGGAGGGTTGG + Intergenic
1188793780 X:34437720-34437742 GGAGTTCCCAGGGGGAGGGGCGG + Intergenic
1189568938 X:42274477-42274499 GGAGTGGGCAGAGAGAGGAGTGG - Intergenic
1190047383 X:47123595-47123617 GGATTTACCACAGAGAGGTGGGG + Intergenic
1190731637 X:53230305-53230327 GGAGTGGACAGAGCCTGGTGGGG - Intergenic
1191123267 X:56927440-56927462 GGAGCTCCCAGAGGGAGGGGTGG - Intergenic
1191149760 X:57208485-57208507 AGGGTTGCCAGAGCGATGTTTGG - Intergenic
1191877258 X:65809472-65809494 GGAGCTTCCAGAGAGGGGTGGGG + Intergenic
1191988690 X:67009434-67009456 GGAGCTGCCATAGGGAGGGGTGG + Intergenic
1192691121 X:73366117-73366139 GGAGGCACCAGAGAGAGGTGAGG - Intergenic
1193051970 X:77111418-77111440 AGAGTTTCCAGAGGGAGGGGTGG + Intergenic
1193295819 X:79830137-79830159 GGAGCTCCCAGAGGGAGGAGGGG - Intergenic
1195703117 X:107719719-107719741 GGAGGTGCCAGAGAGTGGTAAGG + Intronic
1195814402 X:108869313-108869335 GGAGTTGGCAGGGAGAGATGGGG + Intergenic
1196241385 X:113346590-113346612 GGAGCTCCCAGAGGGAGGGGTGG - Intergenic
1196528772 X:116759117-116759139 GGAGCTCCCAGAGGGAGGGGTGG + Intergenic
1196701183 X:118671034-118671056 GGAGTTGCTAGAACAATGTGTGG + Exonic
1198432267 X:136579285-136579307 GGAGCTGTCAGAGCGAATTGAGG - Intergenic
1199818169 X:151418822-151418844 GGAGTTGGCAGTGGGAGGTAGGG + Intergenic
1200172245 X:154085732-154085754 GTAGTTGCCAGAGGGTGGGGTGG + Intronic
1200222395 X:154397608-154397630 GGAGTGGGAAGGGCGAGGTGGGG + Intronic
1201935958 Y:19411283-19411305 GGAGCTCCCAGAGGAAGGTGGGG + Intergenic