ID: 1022481854

View in Genome Browser
Species Human (GRCh38)
Location 7:30749451-30749473
Sequence CCAGGTAATTCCTTGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 1, 2: 18, 3: 150, 4: 478}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022481854_1022481860 1 Left 1022481854 7:30749451-30749473 CCACCCAACAAGGAATTACCTGG 0: 1
1: 1
2: 18
3: 150
4: 478
Right 1022481860 7:30749475-30749497 CTGAAGAGCAAATAGTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022481854 Original CRISPR CCAGGTAATTCCTTGTTGGG TGG (reversed) Intronic
900763775 1:4489768-4489790 CCAGGAAAGCACTTGTTGGGTGG - Intergenic
901747371 1:11383160-11383182 CCAGATAATTCTTTGTTGTAGGG - Intergenic
902108117 1:14054955-14054977 CCAGGTAGTTCTTTGCTGTGGGG + Intergenic
902142139 1:14365593-14365615 GCAGGTAATTCCTTGTGGTGGGG + Intergenic
902171193 1:14612667-14612689 CCAGATAATTCTTTGTTGTGGGG + Intronic
902178459 1:14669361-14669383 TCAGATAGTTCCTTGTTGTGGGG - Intronic
902184302 1:14713609-14713631 CCAGGTAAGTCTTTGCTGTGAGG - Intronic
902269667 1:15294369-15294391 CCAGATAATTGTTTGTTGTGGGG + Intronic
902365118 1:15968069-15968091 CCAGATAAGTCTTTGTTGTGGGG - Intronic
902888221 1:19422304-19422326 CCGGGTGATTCTTTGTTGTGGGG - Intronic
903607131 1:24583300-24583322 CCAGGTAATTCTTTGGTGTGAGG - Intronic
904269740 1:29342174-29342196 CCAGATAATTTCTTGTTGAGGGG - Intergenic
904399875 1:30249040-30249062 CCAGGTCATTCCTTTTGGGCAGG + Intergenic
904527733 1:31146796-31146818 CCTGGCAATTCCAGGTTGGGTGG + Intergenic
905077842 1:35289637-35289659 CCAGGTAATTCTTTGTTGTGGGG + Intronic
905138045 1:35815708-35815730 CTGGGTAATTCTTTGTTGTGGGG + Intronic
905292717 1:36933819-36933841 CCAGGTAAGTCCTGGGTGTGTGG + Intronic
905784143 1:40739440-40739462 CCAGATAATTCTTTGTTGTGAGG + Intronic
906203216 1:43972935-43972957 CCAGATAATTCTTTGTTGTGGGG + Exonic
906259096 1:44372843-44372865 CTGGATAATTCCTTGTTAGGGGG - Intergenic
906905859 1:49891509-49891531 CCAGATAATTCTTTGTTGTGGGG - Intronic
907190767 1:52646213-52646235 CCAGATAATTCTTTGTTGTGAGG - Intronic
907976128 1:59433138-59433160 CCAGATAATTCTTTGTTGTGGGG + Intronic
908191889 1:61712203-61712225 CTGGGTAATTCATTGTTGTGGGG - Intronic
908838908 1:68258446-68258468 CTTGTTAATTCCTTGTTGGATGG + Intergenic
909071937 1:71005160-71005182 ACAGGTAATTCTTTGTTGTGAGG - Intronic
909532750 1:76699799-76699821 CCAGGAAGTTCTTCGTTGGGGGG + Intergenic
909767730 1:79378246-79378268 CCTGGTAATTCCTAATTGAGAGG - Intergenic
909892864 1:81029605-81029627 CAAGATAATTCCTTGTTATGGGG - Intergenic
909954877 1:81767501-81767523 CCAGATAATTCTTTGTTTGTGGG - Intronic
909989968 1:82211536-82211558 CCAGATAATTCTTTGTTGTAGGG - Intergenic
910423498 1:87096597-87096619 CCAGATAATTCTTTGTTGTGGGG + Intronic
910456879 1:87407116-87407138 CAAGCTATTTCCTCGTTGGGGGG + Intergenic
910509603 1:87988844-87988866 CTAGATAATTCTTTGTTGTGAGG - Intergenic
910564257 1:88625577-88625599 CCAGACAATTCTTTGTTGTGGGG - Intergenic
910764720 1:90770202-90770224 CCAGATAATTCTTTGTTGTGGGG + Intergenic
911167440 1:94736741-94736763 CCAGATAATTCTTTGTTGATGGG + Intergenic
911577070 1:99590475-99590497 CCAGATAATTATTTGTTAGGGGG - Intergenic
911711027 1:101073278-101073300 CCAGATAATTCTTTGTTGTGCGG + Intergenic
911881116 1:103239151-103239173 CCAAGTAATTCTTTGTTGTCTGG - Intergenic
912923479 1:113892178-113892200 CCAGATAATTCTTTGTTGTGAGG - Intergenic
913335631 1:117706994-117707016 CCAGATAATTCTTTGTGGTGAGG + Intergenic
913370001 1:118087832-118087854 CTAGATAATTACTTGTTGTGGGG + Intronic
913700754 1:121372316-121372338 CCAGATAATTAATTGTTGTGGGG + Intronic
914041302 1:144052778-144052800 CCAGATAATTAGTTGTTGTGGGG + Intergenic
914136782 1:144907708-144907730 CCAGATAATTAATTGTTGTGGGG - Intronic
914762838 1:150612854-150612876 CCAAGTAATTCTTTGTTGCAGGG - Intronic
915926149 1:160021181-160021203 CCAGATAATTCTTTGTTGTGGGG + Intergenic
916125656 1:161568649-161568671 CCAGATAATTCTTTGTTGTGGGG + Intergenic
916135571 1:161650480-161650502 CCAGATAATTCTTTGTTGTGGGG + Intronic
916198188 1:162244669-162244691 CCAGATAATTCTTCGTTGTGGGG + Intronic
916502249 1:165396990-165397012 CCAGATAATTCTTTGCTGTGGGG + Intergenic
917043145 1:170828721-170828743 CCAGATAATTCCTTGTTGTGAGG + Intergenic
917131884 1:171751540-171751562 TCAGGGAATTCCTTGGTGGCTGG - Intergenic
917137902 1:171805318-171805340 CCAGGTCATTCATTGATGAGAGG + Intronic
917286586 1:173427427-173427449 CCAGCTAATTCTTTGTTGTGGGG - Intergenic
917466987 1:175288360-175288382 CCAGCTAATTCTTTGTTGGCGGG - Intergenic
917833821 1:178923650-178923672 ACAGATAATTCTTTGTTGGGGGG - Intergenic
917960284 1:180138207-180138229 CCAGATAATTCTTTGTGGTGGGG + Intergenic
918314356 1:183310700-183310722 CCAGATGATTCTTTGTTGTGGGG - Intronic
918318661 1:183344634-183344656 ACAGATAATTCTTTGTTGTGGGG + Intronic
919198626 1:194321486-194321508 CTAGGTACTGCCTTTTTGGGGGG - Intergenic
919458395 1:197846890-197846912 CCAAGGAATCCCGTGTTGGGTGG + Intergenic
919522481 1:198605713-198605735 TCCGGTAATTCTTTGTTGTGAGG - Intergenic
919712803 1:200745153-200745175 CCAGATAATTCTTTGTTGTTGGG + Intronic
920488173 1:206391049-206391071 CCAGATAATTAGTTGTTGTGGGG + Intronic
920509453 1:206540159-206540181 TCAGATAATTCTTTGTTGTGGGG - Intronic
920723062 1:208406653-208406675 CCTGATAATTCTTTGTTGTGGGG + Intergenic
921094648 1:211875845-211875867 CCAGGGAATTCTTTGTTGTGGGG - Intergenic
921700149 1:218259880-218259902 CCAGATAATTTTTTGTTGTGGGG + Intergenic
921734254 1:218608915-218608937 CTAGATAATTCTTTGTTGTGGGG - Intergenic
922082195 1:222308273-222308295 TCAGGTAATTCTTTGCTGTGGGG - Intergenic
922088830 1:222376390-222376412 CCAGATAATTTCCTGTTGTGGGG + Intergenic
922638622 1:227203379-227203401 CCAGATAATGCTTTGTTGGAGGG - Intronic
923042471 1:230329106-230329128 CCAGCTAATTTTTTTTTGGGGGG + Intronic
923054826 1:230418095-230418117 CCAGATAATTCTTTGCTGGTGGG - Intronic
923628492 1:235633796-235633818 CCAGGTGACTCCTGGTTGAGAGG - Intronic
923899425 1:238309745-238309767 CTGGGTAATTCTTTGTTGTGGGG + Intergenic
1063276763 10:4577726-4577748 ACAGATAATTCTTTGTTGTGGGG + Intergenic
1063409103 10:5823156-5823178 CCAGGTCATTCTTTGTCGTGGGG + Intronic
1063539011 10:6913339-6913361 CCAAATAATTCCTTGTTGTCAGG + Intergenic
1064429760 10:15260751-15260773 CCAGGTAGTTCTTTGTTTGGGGG + Intronic
1065337080 10:24663828-24663850 CCAGATAATTCTTTGTTGTGGGG + Intronic
1065393693 10:25211362-25211384 CCAGGAAGTCCATTGTTGGGAGG + Intronic
1065500734 10:26379783-26379805 CCAGCCTATTCCATGTTGGGAGG - Intergenic
1067446582 10:46352713-46352735 CCAGATAATTTTTTTTTGGGGGG - Intergenic
1068315441 10:55336029-55336051 CCAGATAGTTCTTTGTTGTGGGG + Intronic
1068780412 10:60913701-60913723 CTGGGTAATTCTTTGTTGTGGGG - Intronic
1069765186 10:70851466-70851488 CCAGATAATTCTGTGTTTGGTGG - Intronic
1070127290 10:73632620-73632642 CCAGCTAATTTTTTTTTGGGGGG - Intronic
1070158371 10:73850561-73850583 CCAGGTACTTCCTTGTTGTGAGG - Intronic
1070195588 10:74153366-74153388 CCAGATAATTCTTTGTTGTGGGG - Intronic
1071599833 10:86953679-86953701 CTAGATAATTCCTTGTGGTGGGG - Intronic
1071839410 10:89453803-89453825 CCAGGTAATTATTTGTTGTGGGG + Intronic
1071954662 10:90744561-90744583 TTAGGTACTTCTTTGTTGGGGGG + Intronic
1072016185 10:91349106-91349128 CCAGGTCATTCTTTGTTGTAGGG - Intergenic
1072354307 10:94591517-94591539 CCAGATAATTCTTTCTTAGGAGG + Intronic
1072566632 10:96621799-96621821 CCAGGTAATTCCTTACTGTGTGG + Intronic
1072894101 10:99350853-99350875 CCAGGTAATTCTTTGCGGAGGGG + Intronic
1074614159 10:115049607-115049629 CCAGATAATTCTTTGTTGTCGGG - Intergenic
1075329607 10:121563985-121564007 CCAGATAATTCTTTGTTATGGGG + Intronic
1075972448 10:126666121-126666143 CTAGGTAGTTCTTTGTTGCGGGG + Intronic
1077279992 11:1739695-1739717 CCAGGGAAGACCTTGTGGGGTGG + Intronic
1077420428 11:2447441-2447463 CCAGGTACCTCCATGTGGGGTGG + Intronic
1077651939 11:3980779-3980801 CCAGATAGTTCTTTGTTGTGGGG + Intronic
1078489627 11:11757145-11757167 CCAGATAATTCCTTATTGTGAGG + Intergenic
1079021225 11:16910736-16910758 CCAGATTATTCTTTGTTGTGGGG - Intronic
1079468816 11:20758682-20758704 CTAGATAATTCTTTGTTGTGGGG + Intronic
1080101554 11:28465765-28465787 CTAGATAATTCTTTGTTGTGGGG + Intergenic
1081531979 11:43968165-43968187 CTAGATAATTCTTTGTTGTGGGG - Intergenic
1083362700 11:62122228-62122250 CCGGGTAATTCCTTGCTGTGGGG + Intergenic
1084282402 11:68106843-68106865 CCAGGTCATTCTTTGCTGAGGGG + Intronic
1084479178 11:69408678-69408700 CCAGGGCTTTCTTTGTTGGGAGG + Intergenic
1084622681 11:70283886-70283908 CCAGATAATTCTTTGTTGAGGGG - Intronic
1085058053 11:73419465-73419487 CCAAATAATTCTTTGTTGTGGGG - Intronic
1085107595 11:73859106-73859128 CCAGATAATTCTTTGTTGTAGGG - Intronic
1085782749 11:79424279-79424301 CCAGATAATTCTTTGTTGTAGGG - Intronic
1086072640 11:82816059-82816081 CCAGTTAATTCTTTGTTACGGGG + Intergenic
1086270337 11:85055799-85055821 CAAGTTAATTCCTTATTGGTGGG - Intronic
1086346157 11:85899419-85899441 CCAGATAATTCTTTGTTGTGAGG + Intronic
1086468517 11:87080270-87080292 CCAGGTAATACCTTACTGGGAGG + Intronic
1086498363 11:87426843-87426865 CCAGATAATTCTTTGTTGTGGGG - Intergenic
1087721471 11:101670669-101670691 CCAGATAATTCTTTGTTGTGGGG - Intronic
1088101436 11:106160418-106160440 CCAAGTAAGTCATGGTTGGGTGG - Intergenic
1089215001 11:116829937-116829959 CCAGGTAATGCCCTCTGGGGAGG + Exonic
1089519539 11:119054759-119054781 CTAGGTAATTCTGTGTTGTGGGG + Intronic
1090239533 11:125172229-125172251 CCAGGTAAGGCCTTGTTGTTTGG + Intronic
1090347279 11:126081749-126081771 CCAGATAATTCCATGTGGTGGGG + Intergenic
1090447605 11:126777255-126777277 CCAGATAATTCCTGATTGTGGGG - Intronic
1090469528 11:126967877-126967899 CAGGGTAATTCTTTGTTGTGAGG - Intronic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091200443 11:133776290-133776312 CCAGATAATTATTTGTTGTGTGG + Intergenic
1091354328 11:134924034-134924056 CCTGGTACTTCCTTGGTAGGAGG - Intergenic
1091588788 12:1830923-1830945 GCAGGTGATCCCTTGGTGGGAGG - Exonic
1091636427 12:2200492-2200514 CCAGATGATTCTTTGTTGTGGGG - Intronic
1092840308 12:12534046-12534068 CCAGGTAATTCCTTTGTGACAGG + Intronic
1094095828 12:26703479-26703501 CCCGATAATTCTTTGTTGGGAGG + Intronic
1094261623 12:28507319-28507341 CCAGATAATTCTTTGTTGTGGGG + Intronic
1094372873 12:29757294-29757316 CCAGATAATTCTTTGTTGTAGGG + Intronic
1095455970 12:42386162-42386184 CCAGTTAATTCTTTGTTGTTGGG + Intronic
1095780402 12:46052481-46052503 CCATGTAATTGTGTGTTGGGGGG - Intergenic
1096970271 12:55659895-55659917 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1097099581 12:56577634-56577656 CCAGCTAATTTTTTGGTGGGGGG + Intronic
1097903500 12:64896906-64896928 CCAGATAATTCTTTGTTGTTGGG - Intergenic
1098102463 12:67032568-67032590 CCAGATAATTCTTTGTTGATGGG + Intergenic
1098240296 12:68460398-68460420 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1098423813 12:70336009-70336031 CCAGGTAATTCTTTGTAGAGAGG + Intronic
1098552036 12:71773391-71773413 ACAGATAATTCTTTGTTGTGAGG - Intronic
1098851029 12:75596259-75596281 CAAGGTAATTCTTTGTTGTTGGG + Intergenic
1099029352 12:77505973-77505995 CCAGGTAATTCTTTGTTGTTGGG - Intergenic
1099484606 12:83213302-83213324 CCAGATAATTCCTTGTTGTGAGG + Intergenic
1099587307 12:84534211-84534233 CCAGGTATTTCTTTATTGCGGGG + Intergenic
1099673467 12:85726106-85726128 TCATGTAATTCTTTGTTGTGGGG + Intergenic
1099888598 12:88562051-88562073 CCATGTATATTCTTGTTGGGAGG - Intronic
1100483057 12:94998000-94998022 ACAGCTAATTCTTTGTTGTGAGG - Intronic
1100654302 12:96624183-96624205 CCAGGTAGTTCTTTGTTGTGGGG + Intronic
1100682044 12:96935569-96935591 CTGGGTAATTCTTTGTTGTGAGG + Intronic
1100942163 12:99735624-99735646 CCAAGCCTTTCCTTGTTGGGAGG - Intronic
1101377722 12:104185143-104185165 TCAGGCAATTCTTTGTTGTGGGG - Intergenic
1101651760 12:106683579-106683601 CCAGGTTCTTCCTTGTTTGCTGG + Intronic
1101811237 12:108109836-108109858 CCAGATAATTCTTTGTTGCTGGG + Intergenic
1102183953 12:110933398-110933420 CCAGGTCATTCTTTGCTGTGGGG + Intergenic
1102483349 12:113239269-113239291 CCAGGTAAGCCCTAGCTGGGGGG - Intronic
1102637131 12:114334301-114334323 CCAGATAATTCTTTGTGGTGGGG + Intergenic
1102706746 12:114887687-114887709 CCACGTAATTCTTTGTTGTGGGG - Intergenic
1102910887 12:116713072-116713094 CCAGGTAATTCTGTGTCGTGGGG + Exonic
1103000863 12:117384497-117384519 CCAGATAATTCTTTGTGGTGGGG - Intronic
1103025478 12:117570399-117570421 CCAGATAATTCTTTGTTGTGGGG - Intronic
1103287753 12:119816948-119816970 CCAGATAATTCTTTGCTGTGGGG - Intronic
1103299372 12:119916400-119916422 CTAGATAATTCCTTGTTGTGGGG + Intergenic
1104426026 12:128678774-128678796 TCAGATAATTCTTTGTTGTGAGG - Intronic
1106014161 13:25852327-25852349 CCAGATAATTCTTTGTCTGGGGG - Intronic
1106801518 13:33261308-33261330 CCAGGTAATTGTTTTTTGTGGGG - Intronic
1107182125 13:37473157-37473179 CCAGATAATTCTTTGCTGAGGGG + Intergenic
1107595166 13:41956136-41956158 CCAGATAATTTTTTGTTGTGAGG + Intronic
1108766759 13:53640531-53640553 CTGGGTAATTCTTTGTTGTGGGG - Intergenic
1108784239 13:53874870-53874892 TCAGGTAAATCTTTGTTGTGGGG - Intergenic
1109274033 13:60284781-60284803 CCAGATAATTATTTGTTGTGGGG + Intergenic
1111664448 13:91249415-91249437 CCCGATAATTCTTTGTTGTGGGG + Intergenic
1111683719 13:91476104-91476126 CCAGGTAATTATTTGTTGTGAGG + Intronic
1112314762 13:98351138-98351160 CCTGGTACTTCCTTGTGGAGTGG + Intronic
1112677226 13:101716038-101716060 CTGGATAATTCCTTGTTTGGGGG - Exonic
1115165948 14:30448777-30448799 TCAGATAATTCATTGTTTGGGGG - Intergenic
1115183431 14:30656424-30656446 CCTGATCATTCTTTGTTGGGGGG + Intronic
1115788757 14:36856010-36856032 CCAGATAATTCTTTGTTGCAAGG - Intronic
1116459056 14:45149937-45149959 CCAGATAATTCTTTGTTGTGGGG - Intronic
1116481848 14:45400647-45400669 CCAGATATTTCTTTGTTGTGAGG + Intergenic
1116758669 14:48982587-48982609 CCAGGTAATTCTTTGTTGTGGGG + Intergenic
1117141246 14:52792379-52792401 CCAGGTAATTCTTTGTTGTGCGG - Intergenic
1117295393 14:54374521-54374543 CCAGGTAATTATTTGCTGTGAGG - Intergenic
1118177160 14:63452367-63452389 CCAGATAATTCTTTATTGTGGGG + Intronic
1118432556 14:65734869-65734891 CCAGAGAATTCTTTGTTGTGAGG + Intronic
1118673927 14:68162009-68162031 CTGGGTAATTCTTTGTTGTGAGG - Intronic
1118987991 14:70773193-70773215 ACAGGTAATTCCTTCCTTGGGGG - Intronic
1119624872 14:76164291-76164313 CCAGATAATTCTCTGTTGTGGGG + Intronic
1120175308 14:81287663-81287685 CCAGTTTATTCCATGTTGGTGGG + Intronic
1120267383 14:82268501-82268523 CCAGATAATTCCTTGTTGTGAGG + Intergenic
1120876336 14:89379379-89379401 CCGGGTAATTCTTTGCTGTGTGG + Intronic
1121080564 14:91104465-91104487 CCAGATAATTCCATGTTGTGGGG - Intronic
1121175460 14:91887618-91887640 CCTGGAAATTCCTGGTTGGGGGG - Intronic
1121265651 14:92600780-92600802 CCGGGTCATTCCTTGTCGTGTGG + Intronic
1121525662 14:94617271-94617293 CCCAGTCATTCCATGTTGGGAGG + Intronic
1124576417 15:30912827-30912849 CTAGGTAATTCTTTGTTGTCAGG - Intronic
1124584169 15:30990274-30990296 CCAGATAATTCATAGTTGGACGG - Intronic
1125080239 15:35664276-35664298 TCAGATAATTCCTTGTTGTGAGG + Intergenic
1125449773 15:39796115-39796137 CCAGATAATTCTTTGTTGTGAGG + Intergenic
1125473627 15:40028542-40028564 CCAGAAAATTCTCTGTTGGGGGG - Intronic
1125770579 15:42162897-42162919 CCAGATGATTCCTGGTTTGGGGG + Intronic
1125816678 15:42591083-42591105 CCATATAATTCTTTGTTGTGGGG + Intronic
1126006814 15:44265851-44265873 CTAGATAATTCTTTGTTGTGCGG + Intergenic
1126369026 15:47926353-47926375 CCAGATAATTCTTTGTTGCAGGG - Intergenic
1126936710 15:53717725-53717747 ACAGATAATTCTTTGTTGTGGGG - Intronic
1127354617 15:58186344-58186366 CCAAATAATTACCTGTTGGGAGG - Intronic
1127381465 15:58434174-58434196 CCAGACAATTCATTGTTGTGAGG - Intronic
1127395557 15:58541625-58541647 CCAGAGAATTCCTTGTTGTGGGG - Intronic
1128390467 15:67179429-67179451 CCAGATAATTCTTTGTTGGGTGG - Intronic
1128636910 15:69308454-69308476 CCAGATAATTCTTTGTCGTGTGG + Intronic
1128855662 15:71011950-71011972 CCAGATAATTCTTTGTTGTGGGG + Intronic
1129342563 15:74895818-74895840 CTAGGTAATTCTTTATTGTGGGG - Intronic
1129347086 15:74928904-74928926 CCAGATAATTCTTTGTTGTAGGG - Intronic
1130001871 15:80054810-80054832 GCTGGTAATTCTTTGTTGAGGGG + Intergenic
1130759505 15:86803905-86803927 CCAAGTAATTCTTTATTGCGAGG - Intronic
1130920007 15:88335879-88335901 CTGGGTAATTCCTGGTTGTGGGG - Intergenic
1131091912 15:89629888-89629910 CCAGATAATTCTTGGTTGTGGGG + Intronic
1131752314 15:95523487-95523509 CTAAGTAATTCCGTGTTGTGGGG - Intergenic
1131973374 15:97915302-97915324 CCAGATACTTCTTTGTTGTGGGG - Intergenic
1132011929 15:98283804-98283826 CCTGATCATTCCTTGTTGTGGGG + Intergenic
1132052733 15:98622132-98622154 CCAGCTAATTCCTTGTGGCAAGG - Intergenic
1132930353 16:2455815-2455837 CCTGCTCATTCCGTGTTGGGAGG + Intronic
1133474844 16:6110871-6110893 CCAGGTAATTCTTTGTGGTGGGG - Intronic
1133523587 16:6582071-6582093 CCCAATAATTCTTTGTTGGGTGG - Intronic
1133607883 16:7406022-7406044 CCAGGTAATTCTTTGTTGTGGGG - Intronic
1133997191 16:10757462-10757484 CCAGATAAGTCTTTGTTGGGGGG + Intronic
1134027260 16:10963887-10963909 CTGGGTAATTCCCTGTTGTGGGG - Intronic
1134068618 16:11246575-11246597 CCAGCTAATTTTTTTTTGGGGGG + Intergenic
1134423514 16:14116644-14116666 CTGGGTAATTCTTTGTTGGTGGG + Intronic
1134507466 16:14819839-14819861 CCAGACAATTCTTTGTTGGGTGG - Intronic
1134544871 16:15100497-15100519 CCAGATACTTCTCTGTTGGGTGG + Intronic
1134695165 16:16218594-16218616 CCAGACAATTCTTTGTTGGGTGG - Intronic
1134788408 16:16965590-16965612 CCGGGTAATTCCCTGTGGTGGGG - Intergenic
1134976666 16:18576054-18576076 CCAGACAATTCTTTGTTGGGTGG + Intergenic
1135053809 16:19213978-19214000 CCAGACCATTCCTTGTTGAGGGG + Intronic
1135362501 16:21827214-21827236 CCAGATACTTCTCTGTTGGGTGG + Intergenic
1135389341 16:22076493-22076515 CCAGATAATTCTTTGTTGTGGGG - Intronic
1136002478 16:27305337-27305359 CCAGATAATTCTTTGCTGTGGGG - Intergenic
1138197388 16:55061517-55061539 CCAAATAATTCCTTGTTGTGGGG + Intergenic
1138347654 16:56329919-56329941 CCACGTAACTCTTTGTTGTGGGG - Intronic
1138693865 16:58793132-58793154 CTGGGTAATTCCTTGTAGTGGGG + Intergenic
1139254748 16:65530191-65530213 CGAGATAATTCCTTGCTGGGAGG - Intergenic
1139551849 16:67677847-67677869 ACAGGTACTTCCTGGTTGGAGGG + Intronic
1140742652 16:77955370-77955392 CCAGATAACTCTTTGTTGTGGGG - Intronic
1140820438 16:78658034-78658056 CCAGGAGATTCTTTGTTGGGGGG + Intronic
1142842213 17:2641915-2641937 CCAAATAATTCCTTATTGTGGGG + Intronic
1143281488 17:5757939-5757961 TCTGGTAATTCATTGTTGCGTGG + Intergenic
1145053626 17:19683322-19683344 CCAGATAACTCTTTGTTTGGTGG - Intronic
1146244827 17:31270687-31270709 CCTGGCAATTGCTTTTTGGGTGG + Intronic
1146479079 17:33189226-33189248 CCAGATAATTCTTTGTTAGGGGG - Intronic
1146720111 17:35118274-35118296 ACAGGTAATTATTTGTTGGGGGG - Intronic
1147640663 17:41996994-41997016 CCAGATTATTCTTTGTTGTGGGG - Intronic
1147887428 17:43693548-43693570 CCGGGTAATTCTTTGTTGTGGGG + Intergenic
1148205569 17:45777648-45777670 CCAGATAATTCTGTGTTGTGAGG + Intergenic
1148505966 17:48127341-48127363 CCAGATAATTCCATGTTGTTGGG - Intergenic
1149382655 17:56109365-56109387 CCAGATAATTCTTTGTTGTGAGG + Intergenic
1149825021 17:59820329-59820351 CCAGATAATTACTTGTTATGGGG + Intronic
1150723852 17:67635990-67636012 CCAGATAATTCTTTGTTGTGAGG - Intronic
1150913121 17:69409934-69409956 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1150933363 17:69609640-69609662 TCAGATTATTCCTTGTTGTGGGG + Intergenic
1151275656 17:73032145-73032167 CCAGATAATTCTTTGTTGTCAGG - Intronic
1151485865 17:74399447-74399469 CCAGATCATTCCTTGTTGTAGGG - Intergenic
1153512440 18:5870214-5870236 CCAAATAATTCTTTGTTGGGTGG + Intergenic
1153522076 18:5962850-5962872 CCAGGTAATTCTTTGCTGTGAGG + Intronic
1153675567 18:7453406-7453428 TCTGGTGATTCCTTGTTGGAGGG + Intergenic
1154935157 18:21047400-21047422 CCAGATAATTCTTTGTTGTTGGG - Intronic
1155330320 18:24709321-24709343 CCAGGTAATTCTTTAGTGAGTGG + Intergenic
1155367050 18:25059006-25059028 CCAGATAATTCATTGTTGTGCGG + Intergenic
1156042756 18:32841948-32841970 CCAAGTAATTCCCTGTTGTTAGG + Intergenic
1156232185 18:35164376-35164398 CAAGCCACTTCCTTGTTGGGTGG + Intergenic
1156425695 18:37009628-37009650 CCAGATAATTCTTTGTTCTGTGG - Intronic
1157882865 18:51338364-51338386 CCAGATAATTCTTTCTTGTGAGG + Intergenic
1159022708 18:63156335-63156357 TCAGGTAATTCTTTGTTGTGGGG + Intronic
1159103825 18:63983155-63983177 CCAGATAATTCTTTGTTATGGGG - Intronic
1159754823 18:72351347-72351369 CCAGGTATTTCCTTCTTGCCAGG - Intergenic
1160107034 18:75987780-75987802 CTGGGTAATTCTTTGTTGAGGGG + Intergenic
1160329981 18:77982527-77982549 CCAGGGAATTCCCTGTTAGCAGG + Intergenic
1160814048 19:1027209-1027231 CCAGGAAATTCCTGTTTGTGGGG - Intronic
1164478101 19:28590592-28590614 CCAGATAATTCTTTGTGGTGGGG + Intergenic
1164487702 19:28674637-28674659 CCAGATAATCCCTTGTTGTGGGG + Intergenic
1165502045 19:36197308-36197330 CCAGCTAATTTCTTTTTTGGGGG - Intronic
1167044987 19:47044592-47044614 CCAGGTGATTCTGTGTTGGAGGG + Intronic
1168452234 19:56475628-56475650 CCAGATAGTTTTTTGTTGGGAGG - Intronic
1168495928 19:56850823-56850845 CCAGGCTTTTCTTTGTTGGGAGG + Intergenic
925407301 2:3614127-3614149 CCAGCTAATTTTTTTTTGGGGGG + Intronic
926701482 2:15807111-15807133 CCAGGTAATTCTTTGTTGTGGGG + Intergenic
926831156 2:16963567-16963589 CCAGGTGATTCTTTGTTGTATGG + Intergenic
927618227 2:24622284-24622306 TCAGATAATTCTTTGTTGTGGGG + Intronic
927792312 2:26019983-26020005 CCAGCTAATTTCTTTTTAGGCGG - Intergenic
928013763 2:27635231-27635253 GCAGGTAATTGATTGTTGGTGGG + Exonic
928621195 2:33089529-33089551 CCAGGTAATTCTCTGTTGTAGGG - Intronic
928773778 2:34733919-34733941 CTAGATAATTCTTTGTTGTGGGG + Intergenic
929134969 2:38614934-38614956 CCAGATAATTCTTTGCTGAGAGG + Intergenic
930459031 2:51646236-51646258 CCATGTAATCTATTGTTGGGTGG + Intergenic
930693268 2:54386160-54386182 CCAGTTAATTCTTTGTTGTGGGG - Intergenic
930782427 2:55235907-55235929 CCAGGTAATTCTTTGTTGTGGGG + Intergenic
931091656 2:58893110-58893132 CCAGCTAATTTTTTTTTGGGGGG + Intergenic
931226030 2:60333071-60333093 TCAGATAATTCTTTGTTGTGGGG - Intergenic
931756782 2:65381828-65381850 CCAAGTAATTCCCTGTTGCAAGG - Intronic
931777066 2:65549918-65549940 ACAGGTAATTCTTTATTGTGGGG - Intergenic
931939754 2:67239090-67239112 CCAGATAATTCTTTATTGTGAGG - Intergenic
932011594 2:67983426-67983448 CCAGATAATTCTTTGTTTTGGGG + Intergenic
932019761 2:68072228-68072250 TCAGGTAATACCTTTTTGGCAGG - Intronic
932112612 2:69014226-69014248 CCTGGTAATTCTTTGTGGTGGGG + Intronic
932813190 2:74841386-74841408 CCAGGTAATTTTTTGTTGTGGGG - Intronic
932860522 2:75286716-75286738 CCAGATAATTCTTTGTTGTGAGG - Intergenic
932909342 2:75789487-75789509 CCAGATAATTCTTTGTTGTGGGG + Intergenic
932909534 2:75791374-75791396 CCAGATAATTTTTTGTTGTGAGG - Intergenic
933687756 2:85157001-85157023 CCAGATAATTCTTTGTTGTGAGG - Intronic
933842580 2:86299302-86299324 CCAGACAATTCTTTGTTGTGAGG + Intronic
934656876 2:96120984-96121006 CCTGGTAATTCTTTATTGTGGGG - Intergenic
934959464 2:98657084-98657106 CCAGATAATTTTTTGTTGTGGGG - Intronic
935036255 2:99377404-99377426 CCAGATAATTCTTTGTTGTTGGG + Intronic
935620993 2:105129408-105129430 CCATATAATTCTTTGTTGTGGGG - Intergenic
936065220 2:109326218-109326240 ACAGCTGATTCCTTGTTGGGTGG - Intronic
937330269 2:121022288-121022310 CCAGTGAATTCCCTGTTGTGGGG - Intergenic
937347978 2:121139130-121139152 CCAGGTAATTCTTTGTTGTGGGG - Intergenic
938773543 2:134521489-134521511 CCAGATAATTCTTTGTTGTCAGG - Intronic
938793506 2:134698081-134698103 CCAGATAATTCTTTGCTGTGAGG + Intronic
939372968 2:141326719-141326741 CCAGATAATTCCTTGTTGTGGGG - Intronic
939715607 2:145579977-145579999 ACAGGTAATTCTTTGTTGTAGGG + Intergenic
941069927 2:160944450-160944472 CTAGATAATTCTTTGTTGTGAGG - Intergenic
941575704 2:167227339-167227361 CCAGGTAATTCCTTTGCTGGTGG + Intronic
941744659 2:169074042-169074064 CCAGGTAATTATTTGTTGTGGGG - Intronic
942131437 2:172884175-172884197 TGAGGTAGTTCCTTGCTGGGAGG + Intronic
942206889 2:173628279-173628301 CCAAATAATTCCTTGTTTGGGGG - Intergenic
942414709 2:175746555-175746577 GCTGGTAATTCTTTGTTGTGGGG - Intergenic
942891151 2:180990313-180990335 CCAGATAATTCTTTATTGTGGGG - Intronic
943271233 2:185808003-185808025 GTAGGTGATTCCTTGGTGGGTGG - Exonic
943576264 2:189634163-189634185 CCAGATAATTCTTTGCTGCGGGG - Intergenic
944213602 2:197231698-197231720 CCAGATAATTCTTTGCTGTGGGG - Intronic
947037647 2:225877414-225877436 CCATGTAATTGCTTATGGGGAGG + Intergenic
947868411 2:233417933-233417955 CCAAATAATTCTTTGTTGTGAGG - Intronic
947970056 2:234316189-234316211 CCAGGTATTTCCTTTTATGGAGG + Intergenic
1169462674 20:5809823-5809845 CTAGATAATTCTTTGTTGGGTGG - Intronic
1169977583 20:11347501-11347523 CCAGATAATTCTTGGTTGTGAGG + Intergenic
1170584176 20:17721908-17721930 CCAGATAATTCTTTGTTGTGGGG + Intronic
1170746162 20:19100686-19100708 CTGGATAATTCCTTGTTGTGGGG - Intergenic
1172041652 20:32050927-32050949 CCAGGTAATTCTTTGTTGCGGGG - Intergenic
1173196201 20:40914761-40914783 CTAGATAATTCCTTGTGTGGGGG + Intergenic
1173246890 20:41343137-41343159 CCAGATAATTCTTTGCTGGGGGG - Intronic
1173659952 20:44726429-44726451 GCAAGTAATTATTTGTTGGGGGG + Intronic
1174548241 20:51342555-51342577 CCAGATAATTCTTTGTTGTGGGG - Intergenic
1174712202 20:52718933-52718955 CCAGGTGATTCTTGGTTGTGGGG - Intergenic
1175042809 20:56071720-56071742 CCAGATAATGCTTTGTTGTGGGG - Intergenic
1175052442 20:56167773-56167795 CCAAATAATTCTTTGTTGTGGGG - Intergenic
1175105687 20:56613188-56613210 CCAGATAATGCTTTGTTGTGGGG + Intergenic
1175266361 20:57705890-57705912 CCCGGTAATTCTTTGTTGGGGGG - Intronic
1175346014 20:58276711-58276733 GCAGGTAAGTCTTTGTTGGTGGG + Intergenic
1175613329 20:60370514-60370536 CCAGATTATTCTTTGTTGTGAGG - Intergenic
1175678494 20:60967414-60967436 CCAGGTAATTCTGGGTTGCGGGG + Intergenic
1177190330 21:17844539-17844561 CCACATAATTCCTTGTTGTGGGG + Intergenic
1177413453 21:20762212-20762234 TCAGGTAATTCTTTGTTGTTGGG - Intergenic
1177714599 21:24822786-24822808 CCATGTAATTCTTTGTTTTGAGG - Intergenic
1178581204 21:33839923-33839945 CCAGATCATTCTTTGTTGCGGGG - Intronic
1178696595 21:34797964-34797986 CCAAATAATTCTTTGTTGGGGGG - Intronic
1178849862 21:36204214-36204236 CCAGGTAAGTCTTTGTTGTCGGG - Intronic
1179623349 21:42633032-42633054 CCAGGTCATTCTTTGCTGTGGGG + Intergenic
1181446788 22:22982817-22982839 CCAAATAATTCCTTGTTGTGAGG + Intergenic
1182220609 22:28755784-28755806 CCAGATAATTCTTCGTTTGGGGG + Intronic
1182649100 22:31836261-31836283 CCAGATAATTCTTTGTTGTGGGG - Intronic
1182720249 22:32392521-32392543 CCGGAGAATTCTTTGTTGGGAGG + Intronic
1183024750 22:35056512-35056534 ACAGGTAATTGCTGTTTGGGGGG - Intergenic
1183111199 22:35649831-35649853 CCAGGTGATCCCTGGTTGTGGGG + Intronic
1183148365 22:36016608-36016630 CCAGGTAACACCTTGGTGTGTGG - Intronic
1183769592 22:39912600-39912622 CCAGTTAAGTCCTTGTTGTGGGG - Intronic
1183805909 22:40210839-40210861 CTGGGTAATTCTTTGTTGTGGGG + Intronic
1184308764 22:43627698-43627720 CCAGGTAACTCCTAGGTGAGGGG - Intronic
949294639 3:2507239-2507261 CCAGATAATTCGTTGCTGTGGGG + Intronic
949499957 3:4670383-4670405 CTTGGTAATTCTTTGTTGTGGGG + Intronic
949732820 3:7133490-7133512 CTAGGTAATGCTTTGTTGTGGGG - Intronic
950826135 3:15823416-15823438 CTAGGCATTTCTTTGTTGGGAGG - Intronic
950920009 3:16684683-16684705 CTGGGTAATTCTTTGTTGTGAGG - Intergenic
951505663 3:23442356-23442378 CCAGACAAGTCCTTTTTGGGGGG - Intronic
951585445 3:24210555-24210577 ACAGATAATTCTTTGTTGTGGGG - Intronic
951624983 3:24649906-24649928 CCAGACAATTCTTTGTTGTGGGG - Intergenic
951671713 3:25190604-25190626 CCAGGTGATTCCTTGAGGTGTGG + Intronic
952223936 3:31354250-31354272 CCAGGTAATTCTTTGTTTTGAGG - Intergenic
952674820 3:36015292-36015314 CCAGATCATTCTTTGTCGGGGGG + Intergenic
953167660 3:40479713-40479735 CCAGATAATTCTTTGTTTGGGGG + Intronic
953234247 3:41092294-41092316 CCAGATAATTCTCTGTTGTGTGG - Intergenic
954084452 3:48233114-48233136 CCAGGTATATCCTTTTTGAGAGG + Intergenic
954193270 3:48979818-48979840 CCAGGTCCTTCCCTGTTGGCTGG - Intronic
955558539 3:60163694-60163716 CCGGGTGATTCTTTGTTGTGGGG + Intronic
955709656 3:61764964-61764986 CCAGATAATTCTTTATTGTGGGG - Intronic
956089642 3:65652385-65652407 CCAGATAATTCTTTGTTGTTGGG + Intronic
956228178 3:66983130-66983152 CCAGATAATTCTTTGTTGTGGGG + Intergenic
956334022 3:68143518-68143540 CCAGATAATTCCTTGTCGTGGGG + Intronic
956488086 3:69742330-69742352 CCAGATAATCCTTTGTTGTGGGG - Intronic
956587266 3:70878122-70878144 CCAGGTAATTCTTTAATGGAGGG + Intergenic
956596181 3:70970039-70970061 TCAGGTAGCTCCTTTTTGGGTGG + Intronic
956729897 3:72186980-72187002 CCAGATAATTCTGTGTTGTGGGG - Intergenic
957007544 3:74967958-74967980 CTGGGTAATTCTTTGTTTGGGGG + Intergenic
957137317 3:76305936-76305958 TCTGATAATTCTTTGTTGGGAGG + Intronic
957446523 3:80318927-80318949 CCAGGTATTTCCTAGTTTGTAGG - Intergenic
958819859 3:98960900-98960922 CCAGATAATTCCTTGTTGTGAGG - Intergenic
958896961 3:99840110-99840132 CCTGGTAACTCTTTGTTGTGGGG - Intronic
959399722 3:105884993-105885015 CAGGGTCATTCCTTGTTGTGGGG - Intergenic
959896240 3:111609990-111610012 CCAAATAATTCTTTGTTGTGAGG - Intronic
960086301 3:113595169-113595191 CCAGATAATTCTTTGTTGTTGGG + Intronic
960466319 3:118000141-118000163 CCAGATAATTCTTTGTTGTATGG + Intergenic
960546620 3:118922213-118922235 CCAGATAATTATTTGTTGCGAGG + Intronic
961733601 3:128985982-128986004 CCAGATAATTCCTCGCTGTGGGG - Intronic
962099428 3:132326207-132326229 CTAGATAATTCTTTGTTGTGGGG - Intronic
962250102 3:133830822-133830844 CCAGACAATTCCTTGTTATGAGG + Intronic
962301670 3:134249506-134249528 CCAAGGACTTCCTTTTTGGGGGG + Intronic
962948647 3:140197742-140197764 CCAGATAATTCTTTGGTGTGGGG - Intronic
963323791 3:143838459-143838481 CGAGCGAGTTCCTTGTTGGGAGG + Intronic
963392744 3:144689066-144689088 CTAGATAATTCTTTGTTGTGAGG - Intergenic
963711320 3:148750900-148750922 CCAGATAGTTCTTTGTTGTGTGG - Intergenic
963902576 3:150746510-150746532 CCTGATAATTCGTTGTTGTGGGG + Intronic
964156802 3:153595455-153595477 CCAGATAATTCTTTGTTGTCAGG - Intergenic
964380188 3:156090878-156090900 CCAGTTAATTCTTTGTTGTGAGG - Intronic
965096821 3:164239957-164239979 CCAGATAATTCTTTATTGTGAGG - Intergenic
965146913 3:164916590-164916612 CCAGATAATTCTTTGTTTGGAGG + Intergenic
965411947 3:168343160-168343182 CCAGATAATTCTTTGTTGCGGGG + Intergenic
965570814 3:170170426-170170448 CCAGATAATTCTTTGTTGTCAGG - Intronic
965622126 3:170652315-170652337 CCAGATAATTCTTTGTTGTAGGG + Intronic
966049544 3:175597610-175597632 CCAAGTAATTCTTTGTTGTAGGG + Intronic
966323755 3:178731357-178731379 CTAGATAATTCCCTGTTGTGAGG + Intronic
966570329 3:181434788-181434810 CCAGATAAGTCTTTGTTGTGAGG + Intergenic
966830200 3:184001635-184001657 CCACATAATTCTTTGTTGTGGGG - Intronic
967479608 3:189958535-189958557 CCAGATAATTATTTGTTGGGGGG + Intronic
967574151 3:191070692-191070714 CCAGATAATTATTTGTTGTGAGG + Intergenic
969170116 4:5355577-5355599 CCAGATAATCCCTTGTTATGGGG + Intronic
970105754 4:12581412-12581434 CCAGGTAATTAATTGTTGTGAGG - Intergenic
970624046 4:17857623-17857645 CCAGATAATTCTTTGTTTTGGGG + Intronic
972241465 4:37197891-37197913 CCTGGTATTTTCTAGTTGGGTGG - Intergenic
972284863 4:37638299-37638321 CCAGGTAGTTCTTTGCTGTGCGG - Intronic
972289442 4:37677972-37677994 TCAGGTATTTCTTTTTTGGGGGG - Intronic
972831120 4:42814672-42814694 CCAGATAATTATTTGTTGCGGGG + Intergenic
972994435 4:44863117-44863139 TCAGATAGTTCCTTGTTGTGGGG + Intergenic
973005871 4:45006375-45006397 CCAGATAATCCTTTGTTGAGGGG - Intergenic
973588119 4:52412672-52412694 CCAGATAATGCCTTGTGGTGGGG - Intergenic
973700647 4:53533800-53533822 CCAGATAATTCTTGGTTGTGGGG - Intronic
974061434 4:57039541-57039563 CCAGATAATTATTTGTTGTGCGG - Intronic
974658059 4:64850247-64850269 CCAAATAATTCTTTGTTGTGTGG + Intergenic
975336518 4:73182812-73182834 CCAGATAATTCTTTGTTGTTTGG + Intronic
975599324 4:76082904-76082926 CCATATAATTCTTTGTTGTGTGG - Intronic
975651860 4:76601343-76601365 CCAGGTAATTCTCTACTGGGGGG - Intronic
975989316 4:80240751-80240773 CCAGACAATTCTTTGTTGAGGGG - Intergenic
976759646 4:88534363-88534385 CCAGTTAATTCTTTGTCGTGAGG - Intronic
977212081 4:94230532-94230554 CCAGATAATTCTTTGTTGTGAGG + Intronic
977564086 4:98563919-98563941 CCAGGTAATTCTTTGTGGTGGGG - Intronic
977682598 4:99812438-99812460 CCAGGTAATTCTTTATTGTGGGG + Intergenic
977837614 4:101663520-101663542 CCAGATAATTCTTTATTGGGAGG + Intronic
978232919 4:106422845-106422867 CCAAATAATTCTTTGTTGTGGGG + Intergenic
979225899 4:118284131-118284153 CCAGGTAATTATCTGTTGTGAGG + Intronic
979438112 4:120719113-120719135 CCAGATAATTCTTTGGTGTGAGG + Intronic
980732572 4:136842197-136842219 CTGGGTAATTCTTTGTTGTGGGG + Intergenic
980772635 4:137396607-137396629 CCAGATAATTCTTTGTTATGAGG + Intergenic
982028033 4:151271589-151271611 CCAGATGATTCTTTGTTGTGGGG - Intronic
982289877 4:153768913-153768935 GTAGTTAATTCCTTGTTGGCTGG - Intergenic
985246896 4:187988116-187988138 CCAAGTAATTCCATGTAGGAAGG + Intergenic
986023742 5:3830333-3830355 CCAGATACTTCCTTGCTGCGTGG + Intergenic
986302241 5:6486907-6486929 CCAGGTAATTCTTTGCTGTAGGG - Intronic
986580796 5:9263723-9263745 CCATGTGATTCCATGGTGGGAGG + Intronic
986727531 5:10610407-10610429 CCAGATAATTCTTTATTCGGGGG - Intronic
986732184 5:10643240-10643262 CCAGATAATTCTTTGTTGTGGGG + Intronic
986927809 5:12779559-12779581 CCAGGTAATTAATTTTTGGCAGG - Intergenic
987192146 5:15489444-15489466 CTGGATAATTCTTTGTTGGGAGG - Intergenic
988414731 5:30931707-30931729 CCAGATAATTCTTTGTTGTGAGG + Intergenic
988557811 5:32253205-32253227 CCAGATAATTCTTTGTTGTGGGG - Intronic
988639410 5:33024906-33024928 CCAAATAATTCTTTGTTGTGGGG - Intergenic
988711190 5:33777037-33777059 CTAGGTTTTTCTTTGTTGGGAGG - Intronic
989034297 5:37153566-37153588 CCAGTTAATTCTTTGTTGTGGGG - Intronic
989458681 5:41671024-41671046 CCTGATAATTCCTTGTTGTCAGG + Intergenic
989761422 5:45021034-45021056 CCAGATAATTCTTTGTTGTTGGG + Intergenic
990449461 5:55921018-55921040 CCAGATAATTCTTTGTTGTGAGG - Intronic
991075713 5:62534675-62534697 TCAGGTAATTCTTTGTTGTGAGG + Intronic
991530095 5:67605289-67605311 CCAGACAATTCTTTGTTGTGGGG - Intergenic
991979190 5:72214061-72214083 CCAGATAGCTCCTTGTTGTGAGG + Intergenic
992766810 5:80008678-80008700 GCAGTTAATTCTTTGTTGTGAGG + Intronic
992992927 5:82303544-82303566 CCACATGATTCCTTGTGGGGTGG + Intronic
993330743 5:86596996-86597018 TCAGGTAGTTCTTTGTTGAGGGG - Intergenic
993811918 5:92490669-92490691 CCGGATAATTCTTTGTTGTGGGG + Intergenic
994672638 5:102780889-102780911 TCAGGTAATTCTTTGTTGTGGGG + Intronic
995355386 5:111231342-111231364 CCAGGAAATTCCTTGTTGTGGGG + Intronic
995733707 5:115274279-115274301 CTAGATAATTCTTTGTTGTGGGG - Intronic
996541506 5:124634214-124634236 CCAGATAATTCTTTGCTGTGGGG - Intergenic
997203341 5:132026191-132026213 CTTGGTAACTCCTTGTTGGCAGG + Intergenic
997783114 5:136679742-136679764 CCAGATAATTCTTTGTTGGGAGG + Intergenic
998378069 5:141704228-141704250 CCAGGGAATTGCCTGTTGGGAGG + Intergenic
998394965 5:141812374-141812396 CCAGGTGCTTCTTTGTTGTGCGG + Intergenic
998509767 5:142701894-142701916 CCAGGTAATTCTTTGTTATGGGG - Intergenic
998585288 5:143420704-143420726 CCGGGTAATTCTTTGTTGTGGGG - Intronic
998921060 5:147068826-147068848 CCAGGTAATTTTATGTTGGCAGG - Intronic
999417400 5:151410835-151410857 CCAGATAATTCTTGGTTGGGAGG + Intergenic
999622513 5:153487337-153487359 CCAGATAATTCTTTTTTGTGGGG + Intergenic
999647646 5:153735084-153735106 CCAGATAATTCTTTGTGGTGGGG - Intronic
999862498 5:155663516-155663538 CCAAATAATTCTTTGTTGTGAGG - Intergenic
1000090725 5:157927703-157927725 CCAGATAATTCTTTGCTGTGAGG + Intergenic
1000484378 5:161821885-161821907 CCTGGTACTTCCTTAATGGGAGG + Intergenic
1000631021 5:163590863-163590885 CCAAGTAGTTCCATGTTGAGAGG + Intergenic
1000811151 5:165863577-165863599 ACAGATGAATCCTTGTTGGGTGG - Intergenic
1000919124 5:167117726-167117748 GCAGGTAATTCTTTGTTGTGGGG + Intergenic
1001366559 5:171147157-171147179 TCAGATAATTCTTTGTTGTGGGG - Intronic
1002954544 6:1848915-1848937 CCAGATAGTTCTTTGTTGTGGGG + Intronic
1003055140 6:2811337-2811359 CCGGATAATTCTTTGTTGTGGGG + Intergenic
1003586275 6:7391783-7391805 CCAGATAATTCTTCGTTGTGGGG - Intronic
1003896465 6:10612470-10612492 CCAGGTAATTCTTTGTCGTGGGG - Intronic
1003962633 6:11223115-11223137 CCAGGTCATTCTTTGTGGTGGGG - Intronic
1004162716 6:13229191-13229213 CCAGATAATTCTTTGGTGTGGGG + Intronic
1005093193 6:22080921-22080943 CCAGATAATTCTGTATTGGGGGG - Intergenic
1005609998 6:27514637-27514659 CCAGGTCATTCTTTGTGGTGGGG - Intergenic
1005676403 6:28159945-28159967 CCAGATCATTCTTTGTTGTGGGG - Intergenic
1006705032 6:36012508-36012530 CCAGATAATTCTTTGTTGTTGGG + Intronic
1006715839 6:36119769-36119791 CTGGGTAATTCCTCGTTGTGGGG - Intergenic
1007503089 6:42313608-42313630 CAAGGGAATTCCTTGTTCTGGGG - Intronic
1007757018 6:44106271-44106293 CCAGGGAGTTCTTTGTTGTGCGG + Intergenic
1008048417 6:46874965-46874987 TCAGATAATTCTTTGCTGGGTGG - Intronic
1008391138 6:50953068-50953090 CCAGATGATTCTTTGTTGTGGGG + Intergenic
1008606666 6:53146685-53146707 CCAGATAATTCTTTGTTGTGGGG + Intronic
1008709864 6:54211761-54211783 CTGGGTAATTCTTTGTTGTGTGG - Intronic
1009053729 6:58310884-58310906 CAGGATAATTCTTTGTTGGGAGG - Intergenic
1009237396 6:61139665-61139687 CAGGATAATTCTTTGTTGGGAGG + Intergenic
1009653395 6:66506403-66506425 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1010152772 6:72754604-72754626 CCTGATAATTCTTTGTTGTGTGG - Intronic
1012331210 6:97990179-97990201 CCAGATAATTCTTTGTTGTAGGG - Intergenic
1013877676 6:114854342-114854364 CCAGGCAATTCTTTGTTGTTTGG - Intergenic
1015639508 6:135315950-135315972 CCAGAGAATTCTTTGTTGAGGGG + Intronic
1016656542 6:146524750-146524772 CCAGATAATTCCTTGTTGTATGG - Intergenic
1017256598 6:152340419-152340441 CCAAATAATTCTTTGTTGTGGGG + Intronic
1017605332 6:156127210-156127232 CCAGATGATTCTTTGTTGGGGGG - Intergenic
1018404158 6:163459450-163459472 CCAGGTAATTCTTTGTTGGGGGG - Intronic
1018570044 6:165200144-165200166 CCAGGTCTTTCTTTGTTGGTAGG - Intergenic
1020375843 7:7485474-7485496 CCAGTTAATTACTTTTTAGGGGG + Intronic
1021234004 7:18120258-18120280 CCACATAATTCTTTGTTGTGGGG - Intronic
1021248631 7:18295888-18295910 CCAAATAATTCTTTGTTGTGGGG - Intronic
1021367167 7:19794205-19794227 CCAGGCTTTTCTTTGTTGGGAGG - Intergenic
1021514385 7:21467100-21467122 CCAGGTAATTCTTTGTTTTTGGG + Intronic
1021829351 7:24588092-24588114 CCAGATAATTCTTTGTTGTGGGG - Intronic
1021882552 7:25108686-25108708 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1022054874 7:26719966-26719988 CCAGACAATTCTTTGTTGTGGGG + Intronic
1022481854 7:30749451-30749473 CCAGGTAATTCCTTGTTGGGTGG - Intronic
1023108594 7:36787841-36787863 CCAGATAATTCTTTGTTGAGCGG + Intergenic
1023507150 7:40911611-40911633 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1023583740 7:41707452-41707474 CCAGGTAATTTCTTGTTGTTGGG - Intergenic
1023618055 7:42040958-42040980 CCAGATAATTCTTTATTGTGGGG - Intronic
1024370736 7:48580851-48580873 CCAGGGGATTCCTTTCTGGGTGG + Intronic
1024678951 7:51663229-51663251 CCAGGTAATTCTTTGTTATGGGG - Intergenic
1027596525 7:80181040-80181062 CCAGCTCATTCCTTTGTGGGAGG + Intronic
1028243181 7:88445916-88445938 ACAGATAATTCTTTGTTGTGGGG - Intergenic
1028960866 7:96748866-96748888 CCAGATGATTCCTTATTGTGGGG + Intergenic
1029061144 7:97799129-97799151 CTGGGTAATTCTTTGTTGTGGGG - Intergenic
1029690781 7:102179860-102179882 CCCGGTACCTCCATGTTGGGTGG + Intronic
1029946667 7:104540466-104540488 CCAGATAATTCTTTGTTGTGGGG - Intronic
1030007436 7:105133003-105133025 CCTGGGAAATGCTTGTTGGGTGG - Exonic
1030327451 7:108235801-108235823 CCAGATAAGTCTTTGTTGTGTGG - Intronic
1030490037 7:110220808-110220830 CCACGTAATTCTTTGTTTGGGGG - Intergenic
1031148646 7:118026909-118026931 CCAGGTATCTCATTGGTGGGAGG + Intergenic
1031167221 7:118243872-118243894 CCAGACAATTACTTGTTGTGGGG - Intergenic
1031505697 7:122579311-122579333 CAGGGTAATTCTTTGTTGGCAGG - Intronic
1031984839 7:128157394-128157416 CCAGATAATTCTTTGTCGTGGGG + Intergenic
1032043358 7:128580736-128580758 CCAGGTAATTCTTTTTTGCAGGG - Intergenic
1034587672 7:152109948-152109970 CCAGATAATTCTTTGTTGTAGGG + Intronic
1035190641 7:157164967-157164989 ACAGATAATTCTTTGTTGGGGGG + Intronic
1036685921 8:10910199-10910221 CCAAGTCATTCTTTGTTGTGAGG - Intronic
1039258388 8:35743852-35743874 CAAGATAATTTCTTGTTTGGGGG - Intronic
1040631782 8:49222188-49222210 TCACATAATTCCTTCTTGGGAGG + Intergenic
1040824821 8:51609453-51609475 CCACATAATTCCATGTTGGGAGG + Intronic
1042163665 8:65923713-65923735 CCAGATAATTCTTTGTTGATGGG - Intergenic
1042477399 8:69264417-69264439 CCAGATAATTCTTTGTTGTTGGG + Intergenic
1042806069 8:72772287-72772309 CCAGATAATTCTTTGTTGTGGGG + Intronic
1042967326 8:74368783-74368805 CCAGATAATTCTTTGTTGTGTGG + Intronic
1043579636 8:81697425-81697447 TCAGGTAATTCTTTTTTGGGAGG + Intergenic
1043960067 8:86407401-86407423 CCAGGTAATTCTTTGTTGTAGGG + Intronic
1044349480 8:91146951-91146973 CCAGGTAATACTTTGTTATGGGG - Intronic
1044828928 8:96226062-96226084 CTAGATAATTCTTTGTTGTGGGG - Intronic
1045427885 8:102085171-102085193 CCAGGTAATTGTTTGTTGTGGGG + Intronic
1045458678 8:102407890-102407912 CCCCGTAATTCTTTGTTGTGGGG + Intronic
1045759521 8:105587770-105587792 CCAGATAATTCTTTGGTGTGGGG + Intronic
1046182321 8:110667294-110667316 GCAGATAATTCTTTGTTGTGGGG + Intergenic
1046421945 8:113997364-113997386 GTAGGTAATTCCTTGTTGTGAGG - Intergenic
1046617030 8:116489149-116489171 CCAGATAATTCTTTGTTGTGAGG + Intergenic
1046747325 8:117890433-117890455 CCAGAAAATTCTTTGTTGTGGGG - Intronic
1047079241 8:121442221-121442243 CCAGATAATTCTTTGTCGTGTGG + Intergenic
1047217175 8:122885727-122885749 CCAGATAACTCTTAGTTGGGGGG - Intronic
1047420703 8:124705801-124705823 CCAGATAATTCTTTGTCGTGGGG + Intronic
1047702683 8:127465443-127465465 CCAGATAATTCTTTGTTGTGAGG - Intergenic
1047813010 8:128430603-128430625 TCAGGTAATTCTTTGTTGTGAGG - Intergenic
1047813088 8:128431525-128431547 TCAGGTAATTCTTTGTTGTGAGG + Intergenic
1048871176 8:138800401-138800423 CCAGGTATTATCTTTTTGGGGGG + Intronic
1049249458 8:141580470-141580492 CCAGGTGATTCTTTGCTGAGGGG + Intergenic
1050144141 9:2547788-2547810 CAAGATAATTCTCTGTTGGGAGG + Intergenic
1050296407 9:4209721-4209743 CTAGCTAATTCTTTGTTGTGGGG + Intronic
1050554293 9:6775862-6775884 CTTGGTAATTCCTTGTTGTGGGG + Intronic
1051008342 9:12378202-12378224 CCAGCTAGTTCCTTGTTGTCAGG - Intergenic
1051038887 9:12782150-12782172 CCAGTTAATTCCTTGTCAGATGG + Intronic
1051133686 9:13893188-13893210 CTAGGTAACTTCTTGCTGGGTGG - Intergenic
1055196311 9:73598763-73598785 CCAGATAATTCTTTGTTTGGGGG - Intergenic
1055460953 9:76519787-76519809 CTAGATAATTCTTTGTTGTGGGG + Intergenic
1055650484 9:78402199-78402221 CCAGATAATTCTTTGTTGTGAGG - Intergenic
1057566154 9:96167670-96167692 GCAGGTAATTCTTTGTTGTGGGG + Intergenic
1057574282 9:96229279-96229301 CCAGATAATTCTGTGTTGGTTGG + Intergenic
1058060755 9:100493210-100493232 CCAGATAATTCTTTGTTGTAGGG - Intronic
1058445134 9:105048556-105048578 CCAGATAACTCCTGGTTGTGGGG - Intergenic
1058630582 9:106982362-106982384 CAGGATAATTCCTTGTTGTGGGG - Intronic
1058681912 9:107447415-107447437 CCAGATAATTCCTTGCTGTGGGG + Intergenic
1058753280 9:108060387-108060409 CCAGATAGTTCTTTGTTGTGGGG - Intergenic
1059280850 9:113132412-113132434 CCAGATAATTCTTTGCTGTGGGG - Intergenic
1059496484 9:114713884-114713906 CCAGATAATTACTAGTTGTGAGG - Intergenic
1059508625 9:114823104-114823126 CCAGATAATTCTTTGTTGTGGGG + Intergenic
1062532966 9:137009750-137009772 CCTGGTAAGTCCTGGGTGGGTGG - Exonic
1186100776 X:6154067-6154089 CCATATAATTCTTTGTTGTGGGG + Intronic
1186200602 X:7151897-7151919 CCAGCTACTTCATTGTGGGGAGG + Intergenic
1186226321 X:7402588-7402610 CCAGATAATTCCTTGCTGAGGGG - Intergenic
1186514945 X:10160002-10160024 CCAGATAACTCCTTGTGGTGAGG + Intronic
1186608234 X:11112905-11112927 CCAGCTGATTCTTTGTTGGGGGG - Intronic
1186633857 X:11380750-11380772 CCAAGTAATTCTCTGTTGTGGGG + Intronic
1186711654 X:12204244-12204266 CTGGGTAATTCTTTGTTGTGGGG - Intronic
1186796158 X:13048303-13048325 CCAGATAATTCTTTGTGGTGGGG - Intergenic
1186888949 X:13941189-13941211 CCAGATCATTCTTTGTTGTGGGG - Intergenic
1187033103 X:15508884-15508906 CTGGGTAATTCTTTGTTGTGAGG - Intronic
1187203380 X:17157637-17157659 CCAGATCATTCTTTGTTGTGGGG - Intergenic
1187247300 X:17564256-17564278 CCAGGTAATTCTTTGTTATTGGG + Intronic
1187335815 X:18380630-18380652 CTAAGTATTTCCTTTTTGGGGGG + Intergenic
1187796007 X:23005300-23005322 CCAGATAATTCTTTGTTGTGAGG - Intergenic
1187935637 X:24333081-24333103 CCAGATAATTCTTTGTTGTTAGG - Intergenic
1187971581 X:24664182-24664204 CCAGATAATTCTTTGTTGTAGGG - Intronic
1187978710 X:24731699-24731721 CCAAATAATTCTTTGTTGTGGGG - Intronic
1188188919 X:27149738-27149760 CTAGATAATTCTTTGTTGTGGGG + Intergenic
1188569870 X:31571712-31571734 CCAAATAATTCTTTGTTGTGGGG + Intronic
1188784805 X:34332583-34332605 CCAGATAATTCTTTGCTGTGAGG - Intergenic
1189096951 X:38150547-38150569 ACAGATAATTCTTTGTTTGGTGG - Intronic
1189137716 X:38565973-38565995 CAAGGCAATTCTTTGTTGTGAGG - Intronic
1189505643 X:41611148-41611170 CCAGATAATTCTTTGTTGTGGGG - Intronic
1189795568 X:44642772-44642794 CCATGTAATTCTTTGTGGTGGGG - Intergenic
1192258780 X:69490313-69490335 CCAGATAATTCTTTGTTGTGTGG - Intergenic
1192264242 X:69528104-69528126 TCAGATAATTCTTTGTTGTGGGG - Intronic
1192424053 X:71060150-71060172 CCAGGTAACTCCCTGAAGGGTGG - Exonic
1193134863 X:77959459-77959481 CCAGATCATTCTTTGTTGTGAGG + Intronic
1194819294 X:98486394-98486416 CTAGATAATTCTTTGTTTGGTGG + Intergenic
1195853124 X:109304827-109304849 CCAGATTATTCCTTGTTGTTGGG + Intergenic
1196055669 X:111352201-111352223 CCAGATAATTCTTTGTTGTAGGG - Intronic
1197109117 X:122751490-122751512 CAGGGTATTTCTTTGTTGGGAGG + Intergenic
1199504900 X:148550905-148550927 CCAAGTAACTCTTTGTTGTGAGG + Intronic
1200020861 X:153206230-153206252 CCATGGAATTCTTTTTTGGGAGG + Intergenic
1201330224 Y:12811323-12811345 CCAGATAATTCCTTTTGGGGAGG + Intronic
1201517993 Y:14839081-14839103 CCAGGTAACTCCTCCTTAGGGGG - Intronic
1201575753 Y:15459839-15459861 CCAGCTACTTCATTGTGGGGAGG + Intergenic