ID: 1022481887

View in Genome Browser
Species Human (GRCh38)
Location 7:30749665-30749687
Sequence AATGAATCCAAACTCCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022481887_1022481896 19 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481896 7:30749707-30749729 CTGGAGGCCTTGCGTTAGGAGGG No data
1022481887_1022481890 -6 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481890 7:30749682-30749704 TTCATTCCTCTGGCAGCAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 236
1022481887_1022481893 3 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481893 7:30749691-30749713 CTGGCAGCAGGAGGCACTGGAGG 0: 1
1: 0
2: 3
3: 71
4: 620
1022481887_1022481895 18 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481895 7:30749706-30749728 ACTGGAGGCCTTGCGTTAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 76
1022481887_1022481894 15 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481894 7:30749703-30749725 GGCACTGGAGGCCTTGCGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 180
1022481887_1022481897 20 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481897 7:30749708-30749730 TGGAGGCCTTGCGTTAGGAGGGG No data
1022481887_1022481889 -9 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481889 7:30749679-30749701 GGATTCATTCCTCTGGCAGCAGG No data
1022481887_1022481892 0 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481892 7:30749688-30749710 CCTCTGGCAGCAGGAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022481887 Original CRISPR AATGAATCCAAACTCCCCTT TGG (reversed) Intronic
901957296 1:12795814-12795836 AAGGAATTCAAACTCTCCTCAGG - Exonic
901965315 1:12861597-12861619 AAGGAATTCAAACTCTCCTCAGG - Exonic
901973695 1:12928071-12928093 AAGGAATTCAAACTCTCCTCAGG - Intronic
901980708 1:13031948-13031970 AAGGAATTCAAACTCTCCTCAGG - Exonic
901988726 1:13095334-13095356 AAGGAATTCAAACTCTCCTCGGG + Intergenic
901993087 1:13131433-13131455 AAGGAATTCAAACTCTCCTCGGG - Intergenic
902001381 1:13196983-13197005 AAGGAATTCAAACTCTCCTCAGG + Exonic
902011483 1:13273696-13273718 AAGGAATTCAAACTCTCCTCAGG + Intergenic
902020617 1:13342688-13342710 AAGGAATTCAAACTCTCCTCAGG + Exonic
902276943 1:15346617-15346639 AATGCATCCAAACTAGCTTTTGG + Intronic
904265515 1:29316483-29316505 AATGAATACAAACACCCCAAGGG - Intronic
906931754 1:50176956-50176978 AGTGAGTCAAAACTCTCCTTTGG - Intronic
907488982 1:54796805-54796827 AATGGTTGCAAACTCCTCTTGGG + Intronic
908202994 1:61816943-61816965 AAGGAATCAAAATTCCCTTTAGG - Intronic
911207697 1:95108958-95108980 AATGATTCCAAAGTCCACATGGG - Intergenic
913133049 1:115859964-115859986 AATGAATATTAACTCCCTTTTGG + Intergenic
915788286 1:158640012-158640034 AATGACTCCTCACTCTCCTTGGG - Intronic
916047711 1:161013215-161013237 AATTCATCCAAACTTCCCTCTGG + Intronic
924517124 1:244775456-244775478 AATCAACCAAAACTCCCTTTGGG - Intergenic
1064398036 10:14996758-14996780 AATAAATGCAACCTCCCTTTAGG - Intergenic
1065629459 10:27662705-27662727 TATGAAACTAAACTCCCATTAGG - Intergenic
1065707757 10:28486814-28486836 AAAGAATCTCAACTCCCATTCGG + Intergenic
1073100172 10:101002342-101002364 AATGAATCTCAATTCCCCCTGGG - Exonic
1074370162 10:112894330-112894352 AATGAAAACAAACTCCCTATGGG + Intergenic
1077576574 11:3387895-3387917 AATAAAATCAACCTCCCCTTAGG - Intergenic
1078648966 11:13169513-13169535 AAGGAATCCAAATTCCACCTGGG + Intergenic
1080912204 11:36613673-36613695 ACTGAACCCAAACTTGCCTTGGG + Intronic
1085352628 11:75809610-75809632 AAGAAATCCAAACTCCACTGTGG + Intergenic
1086314058 11:85571107-85571129 AATGAATATAAACTGTCCTTAGG - Intronic
1089683250 11:120131219-120131241 AATGAATCCACGCTCACCTGGGG - Intronic
1091860136 12:3773928-3773950 AATGAATACAAACACCCACTTGG + Intergenic
1092433179 12:8424899-8424921 AATAAAATCAACCTCCCCTTAGG - Intergenic
1095582608 12:43817321-43817343 ATTGAATAAAAACTCCTCTTGGG + Intergenic
1101345078 12:103879128-103879150 AGTGACTCCAAACTCCACATGGG + Intergenic
1105746794 13:23384685-23384707 TCTGAATCCCAACTCCCCTTGGG - Intronic
1105866156 13:24461580-24461602 AGAGAATGCAAACTCCCCTTGGG - Intronic
1107178901 13:37433081-37433103 AATTTTTCCAAACTCCCCTAGGG - Intergenic
1108052873 13:46463480-46463502 AATAAATGCAACCTCCCCTTAGG + Intergenic
1108669996 13:52676535-52676557 AATAAATCCCAACTCCCTCTAGG - Intronic
1109417327 13:62058969-62058991 GAAGAATCCAATCTCCACTTCGG - Intergenic
1109425514 13:62161833-62161855 AATAAATCCAGACTCCCCAATGG + Intergenic
1109538671 13:63745164-63745186 AATAAATGCAACCTCCCATTAGG + Intergenic
1109545164 13:63834603-63834625 AATAAATGCAACCTCCCATTAGG - Intergenic
1109840711 13:67914277-67914299 AATAAAAGCAACCTCCCCTTAGG + Intergenic
1112918597 13:104581636-104581658 AGTGAATCCAACCTACCCTTGGG - Intergenic
1113610079 13:111638230-111638252 CAGGTATCCAAACTCACCTTTGG - Intronic
1115900462 14:38141312-38141334 GATAAATCCATCCTCCCCTTTGG + Intergenic
1117301424 14:54432623-54432645 ACAGAAACAAAACTCCCCTTTGG + Intronic
1117858404 14:60060880-60060902 AAGTCATCCAAACTCCCATTAGG - Intronic
1118556023 14:67023365-67023387 AATGAATAAAAAATCACCTTTGG + Intronic
1120318430 14:82927869-82927891 AAAGAATCCAAACCCACCATTGG + Intergenic
1121322903 14:93002963-93002985 AATGAAGACACACACCCCTTAGG + Intronic
1122248775 14:100423738-100423760 TAAGAATCCAAACACCCCTTAGG - Intronic
1124400962 15:29347019-29347041 CATGAATCCAAACTTTTCTTTGG - Intronic
1125069527 15:35535385-35535407 AAAGATTCCAAAGTCCCCTAAGG + Intronic
1128693067 15:69739924-69739946 AAAGAATCCAAACTCCAGCTTGG - Intergenic
1129034834 15:72642660-72642682 ACTGGAGCCATACTCCCCTTGGG - Intergenic
1129215048 15:74094556-74094578 ACTGGAGCCATACTCCCCTTGGG + Intergenic
1129390323 15:75217060-75217082 ACTGGAGCCAGACTCCCCTTGGG - Intergenic
1129503794 15:76064097-76064119 AAGGAATCCAGAGTCTCCTTTGG - Intronic
1129732186 15:77938902-77938924 ACTGGAGCCAGACTCCCCTTGGG + Intergenic
1132249976 15:100328678-100328700 AATGCCTCAAAACTCTCCTTAGG + Intronic
1134773315 16:16829874-16829896 AATGACTCCAAACTCCTTCTTGG - Intergenic
1136998947 16:35211957-35211979 AATGAAACCAAACTTACCATTGG + Intergenic
1138910131 16:61386596-61386618 TAGGAATCCAAGCTCCCCTCTGG - Intergenic
1139198401 16:64948357-64948379 AATGAATCCAGACACCATTTAGG + Intronic
1144258261 17:13491177-13491199 AATGAAAGCAAGCTCCCCTTGGG + Intergenic
1144665069 17:17096805-17096827 AATGAATCCAAGCTCCCTTGTGG - Intronic
1146089824 17:29865637-29865659 AATGAAACCAAACCCCATTTGGG - Intronic
1147503499 17:40989672-40989694 GATGAATCCAAAATCACATTTGG - Intergenic
1151124900 17:71833933-71833955 AATAAATGCAAACTCCCCAAAGG + Intergenic
1156712361 18:39962469-39962491 AAAGAAAACAAACTCCCCTCGGG - Intergenic
1157102501 18:44743362-44743384 ATTGAATCCAATTTCCCCCTTGG - Intronic
1157686772 18:49649099-49649121 AATGAATCCTAAATTTCCTTTGG + Intergenic
1158207752 18:55012612-55012634 AATGATTGCAAAGTTCCCTTAGG + Intergenic
1159797751 18:72865557-72865579 ACTGTATCTAAACTACCCTTAGG + Intronic
1160025183 18:75210398-75210420 CGTGCATCCAAACTACCCTTGGG - Intergenic
1161909308 19:7180855-7180877 ACAGAATCCAAACTCCTCATCGG - Intronic
1161916828 19:7234586-7234608 AATGATTCCAAAACCCCCCTGGG - Intronic
1162379447 19:10323007-10323029 TATGACTCCATACTCCCCCTCGG + Intronic
1167001624 19:46748569-46748591 AATGAATCCAAATTCTCTTCAGG - Exonic
928102259 2:28445928-28445950 AATGAAGCCTAACTCCCCTCTGG + Intergenic
928223059 2:29421101-29421123 ATTGGAGCCAATCTCCCCTTTGG - Intronic
933209124 2:79545669-79545691 AATGAATCCATACACCCACTAGG + Intronic
936727701 2:115341469-115341491 AGTGAATCCAAACAGACCTTGGG - Intronic
937593958 2:123650525-123650547 AATGCATCCAAACTCCAGTATGG + Intergenic
940352727 2:152707022-152707044 TAAGAATCCAAACTGCCCCTTGG + Intronic
940671325 2:156672005-156672027 AAGGAATACAAAATTCCCTTAGG - Intergenic
940873256 2:158877869-158877891 AATAAATGCAACCTCCCCTTAGG + Intergenic
942714227 2:178872526-178872548 TAGGAATTCAAACACCCCTTGGG - Intronic
944727941 2:202490806-202490828 AATTAATCTAAACTCCCCTTAGG + Intronic
945220008 2:207473761-207473783 AATGAAACCAAATTTCCCATAGG + Intergenic
946656209 2:221950812-221950834 AATGAATGCAAACTGCCTTCTGG - Intergenic
947417405 2:229911283-229911305 AATTAATCCAAACTGCAATTAGG + Intronic
1171358024 20:24565699-24565721 AATAAATCCAGACTCCCTGTGGG + Intronic
1173654500 20:44690277-44690299 TATTAATCCAAACTCCCAATTGG - Intergenic
1173775789 20:45705030-45705052 AATTAATCAAAACTTCCTTTGGG - Intronic
1174789685 20:53465828-53465850 AATGAATACAAACTCTTCTTAGG + Intronic
1175483742 20:59329839-59329861 AAAGCATCCAAACTTCCTTTGGG - Intergenic
1178248120 21:30973709-30973731 AATACATCCAAACTCCCTTCTGG + Intergenic
1178925060 21:36767908-36767930 AAAGAATACAAACTTTCCTTTGG + Intronic
954640109 3:52092845-52092867 GAGGAAACCAAACTGCCCTTGGG - Intronic
955302411 3:57794553-57794575 AATGAATACAAACTTTCTTTTGG - Intronic
955556024 3:60138301-60138323 AATAACTCCAAACTCTCTTTGGG - Intronic
957708205 3:83817555-83817577 AAACAATCCAAACTTTCCTTTGG + Intergenic
959666993 3:108933459-108933481 AATGGAGCCAAACTCCCTTAAGG - Intronic
961274336 3:125715416-125715438 AATAAAAGCAACCTCCCCTTAGG + Intergenic
961877142 3:130031619-130031641 AATAAAATCAACCTCCCCTTAGG - Intergenic
962448015 3:135485761-135485783 ACTGAATCCAGACTCCTCTGTGG + Intergenic
963552312 3:146739700-146739722 AATGAGTGCAAACTACACTTTGG + Intergenic
966891296 3:184409426-184409448 ACTGAATCCACACTCTCCTCAGG - Intronic
970514774 4:16817473-16817495 AATTAATTCAAACTGGCCTTAGG - Intronic
972819181 4:42679955-42679977 AATCACTCAAAACTCCTCTTTGG + Intergenic
973279434 4:48342637-48342659 TATGAATCAGCACTCCCCTTTGG + Intronic
976403837 4:84638970-84638992 AATGAATCCAAACACAACTGTGG - Exonic
977460556 4:97320089-97320111 AAGGAATAAAAACTCTCCTTTGG - Intronic
978237742 4:106479980-106480002 AATGAATTCAAACTATGCTTTGG - Intergenic
978284076 4:107053940-107053962 AATGAATCAAAGCTCTACTTTGG + Intronic
978752555 4:112267910-112267932 GATGCATCAAAACTGCCCTTTGG + Intronic
984309454 4:178038264-178038286 AATGAAACCAATTTTCCCTTAGG - Intergenic
984779360 4:183510159-183510181 CATGAAACCATACTCCTCTTTGG - Intronic
986109131 5:4693473-4693495 AATGAATAGAAACTTCCATTTGG + Intergenic
992074238 5:73176286-73176308 AATGAGTCCAAATCCCTCTTAGG - Intergenic
996277811 5:121688862-121688884 TATAAATCCAAACTCCTCCTAGG - Intergenic
997542545 5:134676072-134676094 AATAAAGCCAAACTTCCTTTGGG + Exonic
998524070 5:142826560-142826582 GAAGAATCCTAACTCCCCTACGG - Intronic
998754407 5:145360209-145360231 CTTGAATCCAAAGTACCCTTGGG - Intergenic
1002115205 5:176956257-176956279 AATGAAAACAAATTCCCTTTTGG + Intronic
1004311590 6:14550898-14550920 TATGGATCCAAAGTCCCCTTGGG + Intergenic
1015577186 6:134684300-134684322 AATAAATTCAAACTTCCTTTTGG - Intergenic
1020312214 7:6876759-6876781 AATAAAATCAACCTCCCCTTAGG - Intergenic
1020851325 7:13357320-13357342 AATTATTCCAAATTCCCTTTTGG - Intergenic
1022481887 7:30749665-30749687 AATGAATCCAAACTCCCCTTTGG - Intronic
1022512029 7:30942515-30942537 AATGAATCTTAAATCCACTTTGG - Intronic
1024083011 7:45871819-45871841 AATGAAACCAAATTCCCATTTGG + Intergenic
1024115867 7:46192492-46192514 AATCAATTAGAACTCCCCTTGGG + Intergenic
1026878590 7:73893972-73893994 CATCATTCCAAACTACCCTTGGG - Intergenic
1037894175 8:22640924-22640946 AATGTGTCCAAACTCCTCTCAGG - Intronic
1038895579 8:31778046-31778068 CGTGAATCCCAACTCACCTTGGG - Intronic
1042259535 8:66843673-66843695 AATGAACCCAAACCCACATTAGG + Intronic
1046070763 8:109250408-109250430 AATGAAGCCAAACACCTTTTAGG - Intronic
1048352992 8:133631006-133631028 AATGATTCCATAGTCCCCCTGGG - Intergenic
1050035764 9:1434307-1434329 AATGAATCCTGGCCCCCCTTTGG - Intergenic
1050161800 9:2727067-2727089 CCTAAATCCAAACTCCCTTTAGG + Intronic
1051800681 9:20930017-20930039 AGTGATTCCCAACACCCCTTAGG - Intronic
1054880915 9:70143762-70143784 CTTGCATCCAAACACCCCTTGGG - Exonic
1057161691 9:92893664-92893686 AATGAATAGATACTCCCCTGTGG - Intergenic
1189748215 X:44191683-44191705 AATGAAACCAATTTTCCCTTAGG - Intronic
1192725774 X:73751139-73751161 AAGGAATTCAAACTTCTCTTAGG - Intergenic
1194995498 X:100587550-100587572 AATGAATCATAACTCCCCACTGG - Intronic
1197845592 X:130798718-130798740 AAAGGTTCCAAACTGCCCTTGGG + Intronic
1198024368 X:132690831-132690853 AAGGAGTTCAAACTCCTCTTTGG + Intronic