ID: 1022481891

View in Genome Browser
Species Human (GRCh38)
Location 7:30749688-30749710
Sequence CCAGTGCCTCCTGCTGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 467}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022481891_1022481896 -4 Left 1022481891 7:30749688-30749710 CCTCTGGCAGCAGGAGGCACTGG 0: 1
1: 0
2: 2
3: 46
4: 467
Right 1022481896 7:30749707-30749729 CTGGAGGCCTTGCGTTAGGAGGG No data
1022481891_1022481895 -5 Left 1022481891 7:30749688-30749710 CCTCTGGCAGCAGGAGGCACTGG 0: 1
1: 0
2: 2
3: 46
4: 467
Right 1022481895 7:30749706-30749728 ACTGGAGGCCTTGCGTTAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 76
1022481891_1022481897 -3 Left 1022481891 7:30749688-30749710 CCTCTGGCAGCAGGAGGCACTGG 0: 1
1: 0
2: 2
3: 46
4: 467
Right 1022481897 7:30749708-30749730 TGGAGGCCTTGCGTTAGGAGGGG No data
1022481891_1022481894 -8 Left 1022481891 7:30749688-30749710 CCTCTGGCAGCAGGAGGCACTGG 0: 1
1: 0
2: 2
3: 46
4: 467
Right 1022481894 7:30749703-30749725 GGCACTGGAGGCCTTGCGTTAGG 0: 1
1: 0
2: 0
3: 12
4: 180
1022481891_1022481899 17 Left 1022481891 7:30749688-30749710 CCTCTGGCAGCAGGAGGCACTGG 0: 1
1: 0
2: 2
3: 46
4: 467
Right 1022481899 7:30749728-30749750 GGGCATCCTCTATCCATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022481891 Original CRISPR CCAGTGCCTCCTGCTGCCAG AGG (reversed) Intronic
900123829 1:1060757-1060779 TCAGTGCCGCCTTCTTCCAGTGG - Intergenic
900458706 1:2789975-2789997 CGAGTGCCTGCTGCTGGCAGGGG - Intronic
900470778 1:2853956-2853978 CCAGCACCGCCTCCTGCCAGGGG + Intergenic
900475963 1:2876522-2876544 CCTGTGCCAGCTGCTGCCAGTGG + Intergenic
900608393 1:3533943-3533965 CTGGTGCCTCCTGCTTCCTGTGG - Intronic
901201634 1:7470569-7470591 CTAGTGCCTCCTGCATTCAGAGG - Intronic
901243036 1:7705620-7705642 CCAGTGCCGCCTCCTTCCCGCGG + Intronic
901512109 1:9722577-9722599 CCAGCCCCTCCTGCTTCCACAGG - Exonic
901923790 1:12553438-12553460 CCACTGGCTCCAGCTCCCAGAGG + Intergenic
902329880 1:15726064-15726086 CCTGTGCCACCTGCTTCCAAGGG - Intronic
902385573 1:16073647-16073669 GCAGTGCCCGCCGCTGCCAGGGG + Intergenic
902447103 1:16474409-16474431 CCAGCGCCTCCACCTGCCACTGG + Intergenic
902633484 1:17719751-17719773 ACAGAGCCTCCTGCTGGCTGGGG + Intergenic
903753193 1:25642816-25642838 TCACTGCTTCCTGCAGCCAGCGG - Intronic
903860532 1:26361797-26361819 CTAGTGCCCCCTGGTGCCATTGG + Exonic
903926334 1:26833442-26833464 CCAGTGCCGCCTCCTCCTAGAGG - Intronic
904172586 1:28601885-28601907 CCAGAACCTCCTGATGCCAGTGG - Intronic
904788373 1:32999187-32999209 CCAGAGCCTCGTGCTGCCTTTGG - Intergenic
905209140 1:36361454-36361476 CCAACTCCTCCTGCTACCAGGGG + Intronic
905511237 1:38522140-38522162 CCAGTCTCTCCTGCTACCTGTGG - Intergenic
905632783 1:39527928-39527950 CCTGAGCCCCCTGCTGCCATAGG + Intergenic
905900786 1:41580977-41580999 CCAGCACTTCCTGTTGCCAGTGG + Exonic
906149115 1:43577495-43577517 CCAGTCCCTCCTGCTGCCCTGGG + Intronic
907185618 1:52607003-52607025 CCAGTGGCTTCTGCTGCCCAGGG - Intronic
908356255 1:63327132-63327154 CCAGACCCTCAAGCTGCCAGCGG + Intergenic
909473216 1:76053071-76053093 CCAGCTCCTGCTGCTGCCAGAGG - Intergenic
910166212 1:84329956-84329978 CCACTGCCTCCTGCTCTCATAGG - Intronic
910364845 1:86453768-86453790 CCAGGGCCTCCTCATTCCAGGGG - Intronic
912380249 1:109243705-109243727 CCCATGCCTGCTGCAGCCAGGGG - Intergenic
912757707 1:112338126-112338148 CCAGTGTGTAGTGCTGCCAGGGG + Intergenic
913615872 1:120558880-120558902 CCACGTCCTCCGGCTGCCAGCGG + Intergenic
914429876 1:147611602-147611624 TGCGTGCCTCCTGCTGCCAGAGG - Exonic
914574407 1:148952022-148952044 CCACGTCCTCCGGCTGCCAGCGG - Intronic
915367001 1:155322209-155322231 CCAGGGCCTGCTGAAGCCAGTGG - Exonic
915427777 1:155841738-155841760 CCACTGCATCCAGCTGCCAGAGG - Intronic
916167655 1:161978146-161978168 CCTGTCTCGCCTGCTGCCAGGGG - Intergenic
916171327 1:162003516-162003538 CCAGTGCAGCCTGTCGCCAGTGG - Intronic
917035390 1:170742720-170742742 CCAGGGCATGCTGCTGCAAGAGG + Intergenic
918174959 1:182035555-182035577 TAACTGCCTCCTGCTGACAGGGG + Intergenic
918232299 1:182547572-182547594 CCACCGCACCCTGCTGCCAGTGG - Intronic
918250734 1:182700545-182700567 CCTGTGTCTTCTGCCGCCAGAGG - Intergenic
919030423 1:192235284-192235306 TCAGTGCCTCCTGCTGTCAAGGG + Intergenic
919986844 1:202681451-202681473 TGAGTGCTCCCTGCTGCCAGCGG - Intronic
920371366 1:205481313-205481335 CAAGTCCCCACTGCTGCCAGGGG - Intergenic
920647142 1:207812043-207812065 ACACTGCCATCTGCTGCCAGGGG - Intergenic
921511859 1:216041459-216041481 CCAGTGGATCTTGCTGCCATGGG - Intronic
922447436 1:225709248-225709270 CCAGTAGCTCCGGCAGCCAGCGG + Intergenic
922911123 1:229218018-229218040 CCACTGCCTCCTCCAGGCAGTGG - Intergenic
923300335 1:232634280-232634302 ACAGTGCTTCCTCTTGCCAGGGG - Intergenic
923419939 1:233802866-233802888 GAAGTGCTTCCTGCTCCCAGGGG + Intergenic
1063020371 10:2120887-2120909 CGAGGGCCTCCTGCAGCCAGTGG - Intergenic
1063239577 10:4153925-4153947 CCTGTGCCCCTGGCTGCCAGGGG - Intergenic
1066657747 10:37711486-37711508 GCAGTGCCTGCAGGTGCCAGAGG + Intergenic
1067741429 10:48898553-48898575 CCAGTGACCCCTCCTGCAAGAGG + Intronic
1067848234 10:49739456-49739478 GTAGCGCCTTCTGCTGCCAGGGG + Intronic
1068557758 10:58477912-58477934 CCTGTGCCTCCTGTGGCCAAAGG + Intergenic
1068769564 10:60805585-60805607 CCAGAGCCTAGTGCTGCCATGGG + Intergenic
1069143891 10:64864058-64864080 CAAGTGCTTCCTGTTGCCTGAGG - Intergenic
1069547287 10:69337878-69337900 CTGGTGCCTCCTGCTGCGACCGG + Intronic
1069778334 10:70939618-70939640 CCTGTGCCTCCAGCAGCCACTGG - Intergenic
1070727796 10:78803891-78803913 CCAAGGCCTTCTTCTGCCAGAGG + Intergenic
1070742259 10:78910920-78910942 CCCGGGGCTCCTGATGCCAGTGG + Intergenic
1070830986 10:79417979-79418001 TGGGTGCCTCCTGCTCCCAGTGG - Intronic
1071454367 10:85833155-85833177 CCAATGCCACCTGCTGACACTGG - Intronic
1072543532 10:96416575-96416597 CCAGTGTTTCCTGCTGCCCAAGG + Intronic
1072745405 10:97936031-97936053 GCACTGCCCCCTGCTGCCACAGG - Intronic
1072892431 10:99335880-99335902 CCAGAGCCTCTTGCTGTCTGTGG - Intronic
1073284674 10:102380490-102380512 CCACTGCCACCTGCAGTCAGAGG + Exonic
1076182090 10:128417856-128417878 CCAGTGCCGCCTGCAGAGAGTGG + Intergenic
1076520504 10:131078102-131078124 CCTGTGCCTCCTGGCCCCAGTGG + Intergenic
1076887229 10:133268353-133268375 CCAGTGTGTCCTGCTGCGTGGGG + Intronic
1078001190 11:7497461-7497483 CCAGTGCCTCCTTCTGGAAGAGG - Intronic
1078073132 11:8132077-8132099 CCAGGGCCCTTTGCTGCCAGAGG + Intronic
1078448989 11:11426311-11426333 CCAGTGGTGCCTGCAGCCAGAGG + Intronic
1078852441 11:15177205-15177227 CCAGCCCCTTCTCCTGCCAGAGG - Intronic
1079309951 11:19356410-19356432 CCAGTGCCTCATGCTGCGGCTGG - Intronic
1079367434 11:19821523-19821545 CCAGTGTCTGCTGCTGCATGGGG + Intronic
1081597471 11:44468881-44468903 CCAGTGGCTCTTGGTGACAGTGG - Intergenic
1081806972 11:45896175-45896197 CTGGTGCCTCCTGCTTCCATAGG + Intronic
1082013419 11:47466813-47466835 TCAGTGCCTCCTGCCAACAGAGG + Intronic
1083143263 11:60739013-60739035 CCAGGGCCCCGTGCTGCCAAAGG + Intronic
1083314320 11:61804912-61804934 TCAGTGCCTGCTGGTTCCAGTGG - Intronic
1083335696 11:61920386-61920408 CCAGTGTCTTCTGCTGCCTGAGG - Intergenic
1083363927 11:62130010-62130032 CCAGTGCCAGCTGGTGCCTGTGG + Exonic
1083681097 11:64352231-64352253 GCAGGGCCTGCTGCTGCCCGCGG - Exonic
1085341209 11:75732753-75732775 CCAGTGCCTCTGGTTGACAGGGG + Intronic
1085458232 11:76677862-76677884 GCTGTGCTTCCTGCTGGCAGAGG + Intergenic
1086669786 11:89532335-89532357 CCAGGGCATGCTGCTGCAAGGGG - Intergenic
1087574625 11:99975229-99975251 CCAGAGCATGCTGCTGCAAGGGG - Intronic
1088848664 11:113688206-113688228 CCACTGCCTCATGCTTCCTGGGG - Exonic
1090208732 11:124900363-124900385 CCAGAGGCTCCTGCAGCCCGAGG + Intergenic
1090384091 11:126346587-126346609 CCAAGGCATCATGCTGCCAGAGG + Intergenic
1090645564 11:128764501-128764523 CCAGTGCTATCAGCTGCCAGTGG + Intronic
1091665556 12:2416096-2416118 CCAGTGCCTCCTTCTCAGAGAGG + Intronic
1091695802 12:2627434-2627456 CCACCGCCGCCAGCTGCCAGTGG + Intronic
1092279835 12:7090676-7090698 CGAGTGCCTCCTGATGCCCTCGG + Intronic
1092530021 12:9336242-9336264 GCAGCTCCTCCTGCTCCCAGAGG + Intergenic
1093642407 12:21542579-21542601 ACAGTGCATTCAGCTGCCAGGGG + Exonic
1094005363 12:25743302-25743324 CCCGTGCCTCCTACAGCAAGTGG + Intergenic
1095986422 12:48002496-48002518 CCAGTCGCTCCTCCTCCCAGAGG - Intronic
1096533260 12:52255127-52255149 GCAGTGTATTCTGCTGCCAGAGG + Intronic
1099730085 12:86489450-86489472 CCCTTTCCTCTTGCTGCCAGAGG + Intronic
1102578271 12:113870961-113870983 CAGGGGCCTCCTGCTGCCATTGG - Intronic
1103948587 12:124540246-124540268 CCAGTGTCTCCTCCTGCAGGGGG - Intronic
1104597605 12:130130776-130130798 CCTGTGCCTCCTGACGCCACAGG - Intergenic
1104739083 12:131159499-131159521 CCTGTGCATTCTGCTGCCATGGG - Intergenic
1105858222 13:24389596-24389618 CGTCTACCTCCTGCTGCCAGTGG - Intergenic
1106224035 13:27771671-27771693 CCAGTGTCTTCAGCTGCCGGTGG + Intergenic
1110004517 13:70249591-70249613 CAAGTACATCCTGCTTCCAGGGG - Intergenic
1110533399 13:76623119-76623141 CAACTGCCCCCTGCTTCCAGGGG + Intergenic
1112174966 13:97013069-97013091 CCAATGGCTTCTGCTGCCATTGG + Intergenic
1112549828 13:100409178-100409200 CCACCGCCTGCTGCTCCCAGGGG - Intronic
1112953067 13:105026414-105026436 CCAGGGCCTCATGCAGCCTGTGG + Intergenic
1113632567 13:111898065-111898087 CCAGAGCTTCCTGCTGCCCGAGG - Intergenic
1113853288 13:113430083-113430105 CCAGTGCCACCTGCTCCGTGAGG - Intronic
1113965789 13:114152918-114152940 CCTGGGCTTCTTGCTGCCAGTGG + Intergenic
1114084398 14:19228982-19229004 GCAGGTCCTCCTGCTCCCAGAGG - Intergenic
1114557117 14:23568368-23568390 CTAGGGCTTCCTGCTCCCAGGGG + Exonic
1116130292 14:40847712-40847734 CCAATTCCACCTTCTGCCAGGGG - Intergenic
1116914272 14:50507232-50507254 CAAGGCCATCCTGCTGCCAGGGG + Intronic
1118457876 14:65961190-65961212 GCACTGCCTCCTGCTGGCCGAGG - Intronic
1118780572 14:69005116-69005138 CTAGAGGCTCCTGCTGCCACAGG + Intergenic
1118965941 14:70585476-70585498 CCTGGGCCTCATGCTGCCCGTGG - Intronic
1119548045 14:75487674-75487696 CCAGTGTCCTCTGGTGCCAGTGG - Intergenic
1119548076 14:75487854-75487876 CCAGTGTCCTCTGGTGCCAGTGG - Intergenic
1119548106 14:75488034-75488056 CCAGTGTCCTCTGGTGCCAGTGG - Intergenic
1119703582 14:76770765-76770787 CCAGCTCCTCCTTCTGCCAGTGG + Intronic
1120770949 14:88379996-88380018 CCAGTGCCTCCAGCCCACAGTGG + Intergenic
1121919626 14:97868648-97868670 CCAGTCCCAGCCGCTGCCAGAGG - Intergenic
1122118087 14:99537520-99537542 CCAGTACCTGCTCCTGCCTGTGG - Intronic
1122118794 14:99540925-99540947 CCAGTGAGTCCTGGTCCCAGTGG - Intronic
1122143573 14:99676131-99676153 CCAGCGCCTCTGACTGCCAGGGG - Exonic
1122473303 14:101987090-101987112 CCAGAGCCTGCGGCTGCCAGCGG + Intronic
1122783697 14:104154413-104154435 CCAGGGCCTCCTGCGGCCACAGG + Intronic
1122873482 14:104651980-104652002 CCAGTGGCTCCTGCTGTCGAGGG + Intergenic
1122937549 14:104967057-104967079 CCAGCTGCACCTGCTGCCAGGGG - Intronic
1122941365 14:104982888-104982910 CCTGGCACTCCTGCTGCCAGAGG + Intergenic
1202896003 14_GL000194v1_random:10826-10848 GCAGGTCCTCCTGCTCCCAGAGG - Intergenic
1125828055 15:42692509-42692531 CCAGTGGCGCCTGCTGCCGAGGG - Exonic
1125957592 15:43800881-43800903 CTATTGCCTCCTCCTGCCAACGG - Intronic
1127113740 15:55702842-55702864 CCTCTGCCTCTTGATGCCAGTGG + Intronic
1128329675 15:66747369-66747391 CCAGAGCCTCCTGCTGACGGAGG - Intronic
1129457641 15:75684093-75684115 TCAGTGGCTCCTGCTGACCGGGG + Intronic
1129657782 15:77536053-77536075 CCAGCGACCCCTGCAGCCAGGGG + Intergenic
1131060575 15:89401400-89401422 CCAGTGCCTCCTCCTCCAGGAGG + Intergenic
1131133141 15:89912769-89912791 GCAGAGCGTCCGGCTGCCAGGGG - Exonic
1132142838 15:99409270-99409292 CCCGTGTCCCCAGCTGCCAGAGG + Intergenic
1132200499 15:99951127-99951149 CCAGTGACCCCTGCTGCCTTTGG + Intergenic
1132408064 15:101556605-101556627 TCAGTGATTCCTGCTGTCAGTGG - Intergenic
1132761196 16:1509357-1509379 CCAAGGCCTCCTGCAGCCTGGGG - Intronic
1133064645 16:3197507-3197529 CCAGAGCCACCTGCTGCTGGGGG + Intergenic
1133064659 16:3197597-3197619 CCAGAGCCACCTGCTGCTGGGGG + Intergenic
1133245095 16:4443314-4443336 CCAGTTCCTCCTCCAGCCTGGGG - Intronic
1133454796 16:5932693-5932715 CCAGAGCCTCCTGACCCCAGTGG - Intergenic
1134134535 16:11670038-11670060 CCTGGGCCTCCAGCAGCCAGTGG - Intronic
1135006967 16:18834278-18834300 GCAGTGCCACCTGGTGCCACAGG - Exonic
1135304337 16:21355516-21355538 CCTGTGGCACCTGCTGCCAGGGG + Intergenic
1135420797 16:22304452-22304474 GCAGTGCCCTCTGCAGCCAGGGG + Intronic
1136275974 16:29179757-29179779 CCAGAGCCTCCTGTGGCCCGAGG + Intergenic
1136301081 16:29334646-29334668 CCTGTGGCACCTGCTGCCAGGGG + Intergenic
1136590926 16:31217158-31217180 CCTGTGGCTCCTGCTGGGAGGGG + Exonic
1137488582 16:48912116-48912138 CCAGAGCTGCCTGCTTCCAGTGG - Intergenic
1137603305 16:49770901-49770923 CCATGGCCTCCTGCTGCCGTGGG - Intronic
1137727785 16:50668772-50668794 CCAGTTCCACCTGCTGGTAGGGG - Intronic
1138109327 16:54311170-54311192 CCACTGCCTCCTTCTGGGAGTGG + Intergenic
1139370994 16:66469403-66469425 CCAGAGGCTCCTGCAGGCAGCGG + Intronic
1141345672 16:83243153-83243175 CCAGGGCCTCGAGCTGCCTGGGG + Intronic
1141406926 16:83802813-83802835 CCAGCCCCTCCTCGTGCCAGCGG + Intergenic
1141468964 16:84225704-84225726 CCAGGTCCTCCTCCTGCCTGTGG + Intronic
1141876503 16:86828704-86828726 GCAATGCCTCCAACTGCCAGCGG - Intergenic
1142062783 16:88041383-88041405 CCTGTGGCACCTGCTGCCAGGGG + Intronic
1142263860 16:89054658-89054680 CCAGAGCCTCCTCCAGCCTGGGG - Intergenic
1142315768 16:89344046-89344068 CCCGCCCCTCCTGCTCCCAGCGG + Intronic
1144782972 17:17817098-17817120 CCAGTGGCTGCTGCCCCCAGTGG - Exonic
1144892476 17:18501897-18501919 CCACTTCCTGCTGCTGTCAGTGG - Intergenic
1145139738 17:20442391-20442413 CCACTTCCTGCTGCTGTCAGTGG + Intergenic
1145269726 17:21398341-21398363 CCAGTGCCTCCTCTGGCCACTGG + Intronic
1145868358 17:28255100-28255122 CCACTGCCTCCTGCCCTCAGAGG - Intergenic
1146926659 17:36750348-36750370 CCATTGTCCCCAGCTGCCAGAGG + Intergenic
1146938347 17:36826306-36826328 CCAGTGCCCCCTCCTGCCCCAGG - Intergenic
1147318560 17:39632704-39632726 CCAGTACCTCCTGCTGGCTCTGG - Intronic
1147691130 17:42315363-42315385 CAAGTGCCTCCTGGTGCCTGCGG - Exonic
1148019099 17:44541923-44541945 CTAGGGCCTCCTGCTCCCAGAGG + Intergenic
1148053243 17:44779490-44779512 CCAGTTCCACCTGGTGGCAGGGG - Intronic
1148242999 17:46012506-46012528 CCAGTGCCCCCAGATGCCAGGGG - Intronic
1150173374 17:63023152-63023174 CCAGTGTTGCATGCTGCCAGTGG - Intronic
1150291150 17:63983195-63983217 CCAGTGCCATCTGTGGCCAGTGG + Intergenic
1151219683 17:72603228-72603250 CCTGTGCCTCCTCCTCACAGGGG - Intergenic
1151273307 17:73013606-73013628 CCTGGGCCACCTGCTGCCCGTGG - Intronic
1151507558 17:74539548-74539570 CCAATGGCTCCTGCTGTCACAGG + Intergenic
1151509096 17:74547393-74547415 CCAATGGCTCCTGCTGTCACAGG + Intergenic
1151746652 17:76015192-76015214 CCGGGGCCTCCTGGTGTCAGGGG - Intronic
1151779449 17:76234026-76234048 GCTGTGCCTGCGGCTGCCAGAGG - Intronic
1151802350 17:76385614-76385636 CCCGCGGCTCCCGCTGCCAGGGG - Exonic
1152149729 17:78591451-78591473 CCTGTGCCTCCTGCTGCTGCAGG + Intergenic
1152219007 17:79050665-79050687 GCACTGCATCCAGCTGCCAGCGG + Intergenic
1152246691 17:79188227-79188249 CCTCTGCCTCCCTCTGCCAGGGG + Intronic
1152351165 17:79784711-79784733 ACAGTCCCTCTTGCTGGCAGGGG - Exonic
1152572456 17:81126793-81126815 CAAGGGACTCCTGCTGCCCGGGG - Intronic
1152586122 17:81190248-81190270 CCTGTGCCATCTGCTGCCACAGG - Intronic
1152704414 17:81835281-81835303 CCGGTGCCTCCTCCTGCCCTCGG - Intergenic
1155504054 18:26515830-26515852 GCAGTGCCGTCTGCTGCCACAGG - Intronic
1157107493 18:44788261-44788283 CCCCTGCCTCCTGCTGCTGGAGG - Intronic
1157495467 18:48154078-48154100 GCAGTGTGTTCTGCTGCCAGAGG - Intronic
1160603234 18:80030529-80030551 CCAGTGGCTCCAGCCTCCAGTGG + Intronic
1160685953 19:436683-436705 CGTGTGCCTCCTGCCGCCACAGG - Exonic
1160830288 19:1101422-1101444 CCAGTCCTTCCTGGAGCCAGGGG + Intergenic
1161238150 19:3208061-3208083 CCACCGCCTCCTGCCGCAAGGGG + Exonic
1161256628 19:3313524-3313546 GCAGTCCCTCCTGCTACCTGCGG + Intergenic
1161308989 19:3583585-3583607 CCAACGCCTCCTGGTGCCTGGGG + Intergenic
1161807592 19:6454052-6454074 GCAGTGTCTCCTGCTGCCCCAGG + Exonic
1161945722 19:7435370-7435392 GCCCTGCCTCCTGCTTCCAGAGG - Intronic
1162684726 19:12372668-12372690 TCAGTGCCTCCTGCTTAAAGTGG - Intergenic
1163423299 19:17226984-17227006 CCAGTCCCTGCAGCTGCCACAGG - Exonic
1163463735 19:17454743-17454765 CCAGCCCCTCCTGCCCCCAGAGG + Intronic
1163525192 19:17816687-17816709 CCAATGCCACCTGCAGCCTGTGG - Exonic
1163536039 19:17877093-17877115 CCAATGCCTCCTGCTCCAGGAGG + Intronic
1163815129 19:19460515-19460537 CCTGTGCCTCCTGAGGACAGTGG + Intronic
1163862061 19:19747828-19747850 CCTGTGCCTCCTGCTGGGTGGGG - Intergenic
1164320170 19:24137373-24137395 CCAGTGCCCCCTGCACCCAATGG - Intergenic
1164609442 19:29622203-29622225 CCCGCGGCTCCTGCTACCAGGGG - Intergenic
1165361904 19:35341891-35341913 CGGGTGCCTACTGGTGCCAGGGG + Exonic
1165448919 19:35871325-35871347 CCTGTGCCTCCTGATGCCTCCGG - Exonic
1166219025 19:41353590-41353612 CCCGCGCCTCCGGCTCCCAGCGG + Exonic
1166230689 19:41424530-41424552 CCAGAGACTCCTGCTGCTTGCGG - Exonic
1166518038 19:43461738-43461760 TCAGTGGCTCCTGTTGCCAGGGG - Exonic
1166535889 19:43574600-43574622 ACTCTGCCTCCTGCAGCCAGTGG - Intronic
1166895239 19:46018492-46018514 CCCGTCCCTCCTGCTGCCCCTGG + Exonic
1166919185 19:46217108-46217130 TCAGTGCTGCCAGCTGCCAGGGG - Intergenic
1167309615 19:48729365-48729387 CGGGTGCCTCCTGCTGCGGGAGG - Exonic
1167396550 19:49233171-49233193 CCAGTTCCTCCTGCTGTCAAAGG - Intergenic
1167606259 19:50482406-50482428 CCTCTGCCTTCTGCTGGCAGAGG + Exonic
924958500 2:11791-11813 TCAGTGTCCCCAGCTGCCAGCGG - Intergenic
925663234 2:6224631-6224653 CCTGCTCCTCCTCCTGCCAGTGG - Intergenic
927147285 2:20174544-20174566 CCAGTGCCTCCAGCTTGCACAGG + Intergenic
927998549 2:27504162-27504184 CCCGTGCCTCCCTCTACCAGTGG + Intronic
929213928 2:39390578-39390600 CCAGTGCCTCTTGCTGAAATGGG - Intronic
931652683 2:64482762-64482784 GCAGTGCCACCTGCTTCCAAAGG - Intergenic
932127498 2:69157147-69157169 ACAGTGCCTACTGCTGAAAGAGG - Intronic
932410922 2:71547298-71547320 CCAGTGCCTCCTCCTGCACCTGG + Intronic
932447378 2:71789084-71789106 CAAGTGCCTTCGGATGCCAGGGG - Intergenic
934083858 2:88492908-88492930 ATAGTGACTCCTGCTCCCAGTGG + Intergenic
934176850 2:89584578-89584600 CCAGTGCTTCCTCCTGCGTGAGG - Intergenic
934573290 2:95385177-95385199 CCAGGCCCTCCTGCTGGCTGAGG + Exonic
935279425 2:101504768-101504790 CGAGTGCCTGATGCTGGCAGTGG - Intergenic
935546809 2:104408362-104408384 CCAGTCTCTCCAGCTGCCAGGGG + Intergenic
937815971 2:126251247-126251269 CCAGCTCCTGCTGCTGCCTGGGG - Intergenic
938036445 2:128038661-128038683 CCAATGCCTCCTCCTCCTAGGGG - Intergenic
938065760 2:128281153-128281175 CAGGTGCCTCCGTCTGCCAGAGG - Intronic
938170263 2:129069704-129069726 ACAGAGCTTCCTGCTGACAGAGG - Intergenic
938492189 2:131767117-131767139 GCAGGTCCTCCTGCTCCCAGAGG + Exonic
938495378 2:131795226-131795248 GCAGGTCCTCCTGCTCCCAGAGG - Exonic
942705060 2:178761970-178761992 CCAGTGCCACCTACTGGTAGAGG - Intronic
943258578 2:185629263-185629285 TAACTGCCTCCTGCTGACAGAGG + Intergenic
945052832 2:205841746-205841768 CCTTTGCCTACTGCTGTCAGTGG - Intergenic
945290458 2:208121750-208121772 GCAGTACCTGCTGATGCCAGGGG - Exonic
945818186 2:214631287-214631309 CCAGTGTCTCCTCCTGGCAGGGG - Intergenic
947139828 2:227010483-227010505 CCAGGGCCTCCTGGTCCCATTGG - Exonic
947151318 2:227118733-227118755 CCAGGGCCTCCTGGACCCAGAGG - Exonic
947543095 2:230991786-230991808 TCAGTCCCTCCTGCTGCCCCTGG - Intergenic
947988041 2:234465491-234465513 CCAGAGCCGCCTGCTGACTGGGG - Intergenic
948321770 2:237075770-237075792 CCAGTGACCCCTGCTCCAAGAGG + Intergenic
948403749 2:237702532-237702554 TCAGTTCCTGCTGCTGCCCGCGG - Intronic
948528396 2:238587600-238587622 TCAGAGCTTCCTGCTGCAAGTGG + Intergenic
948752686 2:240141622-240141644 CCATTGCCTCCTGTAGCCACAGG - Intronic
948761635 2:240195676-240195698 CCAGTACAAGCTGCTGCCAGGGG + Intergenic
948924846 2:241088781-241088803 CCAGGCCCTCCCGCTGCCCGTGG - Exonic
949007966 2:241660972-241660994 CCAGTGCTACCTGCACCCAGAGG - Intronic
1168968919 20:1917561-1917583 CCAGTCCCTCCTACTCCCATAGG - Intronic
1170211383 20:13849154-13849176 CCAGTGCGTCCTCTTGACAGAGG + Intergenic
1171173817 20:23036575-23036597 GCAGGGCTTCCTGCTGGCAGGGG - Exonic
1171293032 20:23993532-23993554 CCTGAGCCTGCTGCTGCCACGGG + Intergenic
1173615504 20:44400714-44400736 CCAGTCCATTCTGCTCCCAGGGG + Intronic
1173846680 20:46192923-46192945 CCTGAGCCTCCTGCTCCCACTGG - Intronic
1174050384 20:47763528-47763550 CCAGTGCCTCCTTCTGCCTCTGG - Intronic
1174239254 20:49119783-49119805 CCAGAGCCTCCTGGGGCCAGTGG + Intronic
1174556265 20:51397697-51397719 CCAGGGCTTCCTTCTGCCATAGG + Intronic
1174615536 20:51832608-51832630 CCACTCCCTCCTGCTGCCTTTGG + Intergenic
1175013538 20:55764415-55764437 CCAGTGCTTGCTGATGCAAGGGG + Intergenic
1175768216 20:61605962-61605984 CCAGGGCCTCCTCATCCCAGGGG - Intronic
1175992819 20:62797852-62797874 CCACCACCTCCTGCTGCCACAGG - Intronic
1176026924 20:62990512-62990534 CCAGGGCCTCCTGCTGCTTTCGG - Intergenic
1176043808 20:63082242-63082264 CCAGTGATTCCTGCTGCCGAAGG - Intergenic
1176288948 21:5034157-5034179 CCAGCGCCCCTTGCAGCCAGAGG - Intronic
1176299918 21:5094758-5094780 TCACTGCCTGCTGCAGCCAGAGG + Intergenic
1176709478 21:10136925-10136947 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1178379564 21:32096545-32096567 CAAGTCCCTCCTGCTGGGAGTGG + Intergenic
1178499503 21:33114155-33114177 CCAGTGCCTCCACCTGCCTCCGG - Intergenic
1179857104 21:44167153-44167175 TCACTGCCTGCTGCAGCCAGAGG - Intergenic
1179868286 21:44229447-44229469 CCAGCGCCCCTTGCAGCCAGAGG + Intronic
1179908112 21:44434623-44434645 TCTGTGGCTCCTGCTGCCCGTGG + Intronic
1180155134 21:45973950-45973972 CCAGAGCCTGCGGCTCCCAGAGG + Intergenic
1180181797 21:46121428-46121450 GCAGCTCCTCCTGCTGCCTGTGG - Intronic
1180293574 22:10864220-10864242 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1180496379 22:15893635-15893657 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1180824092 22:18851247-18851269 CCTGAGCCTGCTGCTGCCATGGG + Intronic
1180985313 22:19900869-19900891 CCTTTGCCCCCTGCTCCCAGAGG + Intronic
1181049991 22:20233888-20233910 CCAGTGCCTGCTGAGGCCTGTGG + Intergenic
1181124518 22:20694401-20694423 CCTGAGCCTGCTGCTGCCACGGG + Intergenic
1181188646 22:21123301-21123323 CCTGAGCCTGCTGCTGCCACGGG - Intergenic
1181210553 22:21287192-21287214 CCTGAGCCTGCTGCTGCCACGGG + Intergenic
1181398957 22:22639699-22639721 CCTGAGCCTGCTGCTGCCACGGG - Intergenic
1181409608 22:22709904-22709926 TCAGTTCCTCCAGCTGCCTGTGG - Intergenic
1181419127 22:22785728-22785750 GCAGCTCCTCCTGCTCCCAGAGG - Intronic
1181501688 22:23319045-23319067 CCTGAGCCTGCTGCTGCCACGGG - Intergenic
1181650462 22:24256360-24256382 CCTGAGCCTGCTGCTGCCACGGG + Intergenic
1181706917 22:24654378-24654400 CCTGAGCCTGCTGCTGCCACGGG - Intergenic
1181981401 22:26769387-26769409 GCAGTGCCTTCTGCAGTCAGAGG + Intergenic
1182447260 22:30397143-30397165 CCAATGCCTCCTTCTGCCTGGGG - Exonic
1182464405 22:30505563-30505585 CCAGCGCTTCCTGCTGCTGGGGG + Exonic
1182550890 22:31100229-31100251 CCAGAGCTTCCTGCTCCCACGGG + Intronic
1182825614 22:33262412-33262434 ACTGGGCCTCCTGCAGCCAGGGG + Intronic
1183425922 22:37739384-37739406 CCGTTGCCTCCTGAAGCCAGGGG + Intronic
1183431581 22:37769145-37769167 CCTGGCCCTCCTGCTGGCAGCGG - Exonic
1183485111 22:38084318-38084340 CCTGTGCCTCCTGGAGCCTGGGG + Intergenic
1183676270 22:39300504-39300526 GAAGTGCATCCTGCTGCCGGTGG + Intergenic
1183898824 22:40990304-40990326 CCAATGCCACCTCCTCCCAGAGG - Intergenic
1184438852 22:44496883-44496905 CCAGTGCATCCAGCTTCCAACGG - Exonic
1184452613 22:44591881-44591903 GCAGGGCCTCCTGGTGCCAGGGG - Intergenic
1184668656 22:46001605-46001627 CCAGTGCCTCGCGCCGGCAGAGG - Intergenic
1185035837 22:48476501-48476523 CCAGGGTCTCCTGCAGCCACTGG + Intergenic
1185238353 22:49727420-49727442 CCAGTGCCTCCCTCTGCCTCTGG + Intergenic
1185293484 22:50040897-50040919 CCAGTTCTTCCTGGGGCCAGGGG - Intronic
1185416538 22:50713580-50713602 CCAGTGCCACCAGGTGACAGGGG - Intergenic
1203216393 22_KI270731v1_random:8238-8260 CCTGAGCCTGCTGCTGCCACGGG - Intergenic
1203274233 22_KI270734v1_random:77151-77173 CCTGAGCCTGCTGCTGCCACGGG + Intergenic
949506496 3:4733181-4733203 CCGGGTCCTCCTGCTGACAGTGG - Exonic
949865248 3:8541948-8541970 CCACTGCATCCAGCTGCCACTGG - Intronic
950024194 3:9809665-9809687 CCAGTACTTCCTGGTGCCACCGG - Intronic
950043962 3:9938009-9938031 CCGGGGCCTCCTGCTGCCTGAGG - Exonic
951178683 3:19632875-19632897 CCAGGGGCTCCTGCTGCAAAAGG + Intergenic
951340803 3:21484498-21484520 CCAGTGCCCCCTGCTGACAAAGG + Intronic
952342804 3:32459697-32459719 CCAGTGCCCCTTGCGGCCACCGG - Intronic
953875263 3:46662987-46663009 ACAATTCCTCCTGCAGCCAGGGG + Intergenic
954408027 3:50356233-50356255 CCAGAGCCTACTGCTTCCACAGG + Intronic
955062447 3:55505004-55505026 CCATTGCTTCCTGCTGCTACAGG - Intergenic
955339195 3:58111913-58111935 CCAGTGCCACCGGCTGGCAGAGG - Intronic
956259514 3:67323237-67323259 TCAGTTCCTCTTCCTGCCAGTGG + Intergenic
956386903 3:68729124-68729146 CCAGCCCCTCCTCATGCCAGAGG - Intergenic
956745407 3:72307176-72307198 CCAGGGTCTCCTGTTACCAGCGG + Intergenic
958067531 3:88563493-88563515 CCAGTGCATGCTGATGCAAGAGG + Intergenic
960135757 3:114103314-114103336 CGAGCGCCTGCTGCTGCCCGAGG - Intergenic
963173872 3:142278904-142278926 ACAGTGCCTGTTGCTGTCAGTGG + Intergenic
964408102 3:156370874-156370896 CCTGTGCCGCCTGCCGCCACTGG - Intronic
964408990 3:156378913-156378935 CCAGTGCCTCAAGCTGGCATGGG + Intronic
966947422 3:184786868-184786890 CCAGAGCCTGCTGCTGACATTGG - Intergenic
967966772 3:194966900-194966922 ACAGTGCCTGCCGCTGCCAGAGG + Intergenic
968088624 3:195886018-195886040 CCGGTGCCTCCTGCAGCCCCGGG + Intronic
968469369 4:771954-771976 CCAGGGCCTTCTGCTGCTAGAGG + Intergenic
968597723 4:1493909-1493931 CCAGTCACTCTTGCAGCCAGAGG - Intergenic
968658179 4:1787522-1787544 TGAGCGCCTCCTGCTGCCTGTGG + Intergenic
968845240 4:3037496-3037518 GCAGTACCTCATTCTGCCAGGGG - Exonic
968917189 4:3501716-3501738 CCGGTGCTTCCTCCTGCCACAGG - Intergenic
968963885 4:3759704-3759726 GCACTGCATCCTGCAGCCAGGGG + Intergenic
968965072 4:3765696-3765718 CCAGGGCCGCCTGCAGCCTGCGG - Intergenic
969119930 4:4900667-4900689 CCACTTCCTCCTGCTTCCTGGGG + Intergenic
969526734 4:7707651-7707673 CCAGTCCCTCCTGGAGCCTGGGG - Intronic
969570332 4:8004509-8004531 GCAGTGCCTCAAGCTGCCCGGGG + Intronic
970590887 4:17559866-17559888 CTAGTGCCTCCTATTGCCACTGG - Intergenic
970659155 4:18264810-18264832 CCAGGGCCTGCTGATGCAAGGGG + Intergenic
971368988 4:26000495-26000517 ACAGTGTGTCCTGCTGCAAGGGG - Intergenic
971609102 4:28699178-28699200 CTAGTGTCTGCTGCTGCCAATGG + Intergenic
975302556 4:72807795-72807817 CTAGTGCTTCCTCCAGCCAGAGG + Intergenic
975794142 4:77988239-77988261 CTAGTGCTTCCTCCAGCCAGAGG - Intergenic
976290766 4:83415181-83415203 CCATTGCCTTCTGCTCCCTGTGG - Intronic
976614129 4:87058860-87058882 CTAGTGGCTCCTGCCGGCAGAGG - Intronic
977054527 4:92174693-92174715 GCAGTGCCTCTTGATGCCATGGG + Intergenic
982459897 4:155656168-155656190 CAGGTGTCTTCTGCTGCCAGAGG - Intergenic
982500138 4:156143941-156143963 ACAGTGCATCATGTTGCCAGGGG + Intergenic
982520941 4:156416336-156416358 CCAGGGCCTTCTGATGCAAGAGG + Intergenic
983475655 4:168208734-168208756 CCAGTGACTCCTGTTGCTATGGG + Intergenic
983877781 4:172896976-172896998 CCAGTGCCTCTTGCTGCAGTTGG - Intronic
984277451 4:177627350-177627372 CCATTGCCTTCAGTTGCCAGAGG + Intergenic
985543873 5:499680-499702 CCAGTCACTCCTGCTCCCTGGGG + Intronic
985631893 5:1018156-1018178 CCCGTGGCTCCTTCTGGCAGAGG - Intronic
985906928 5:2846053-2846075 CCAGGGCCTCCAGCTTGCAGAGG - Intergenic
987586546 5:19863680-19863702 CCACTGCCACCTGCTGCCAGGGG - Intronic
988095681 5:26606197-26606219 CCAGTGACACCTGCTGAGAGAGG - Intergenic
990780537 5:59356922-59356944 CAAGTGCCTCCTGCTCCGTGCGG - Intronic
991965430 5:72086002-72086024 CTAGTGCCTCCTGTGTCCAGGGG - Intergenic
992316896 5:75565817-75565839 CCAATGCCTCCTGATGGCAGGGG - Intronic
992429150 5:76690846-76690868 CAAGTGCCACCTGTGGCCAGTGG + Intronic
992778948 5:80110840-80110862 CCAGTGCTCCCTGCTGCCAGTGG - Intergenic
993902918 5:93596523-93596545 CTAGGGCCTCCTGCTCCTAGAGG - Intergenic
995416867 5:111922459-111922481 TCAGTACCTCCTGGTGTCAGTGG - Intronic
997584865 5:135038245-135038267 CCATAGCCTCCTCCTCCCAGCGG + Intronic
997614835 5:135239241-135239263 CCTGTGCCTCCAGCAGCCACCGG - Intronic
998071026 5:139198190-139198212 CCTGGGCCTCCTCCTGCCGGCGG - Intronic
998405200 5:141870334-141870356 CCTCTCCCTCCTGCTGCCATGGG + Intronic
999319359 5:150603819-150603841 ACAATGCCTCCTGGGGCCAGAGG - Intronic
1000097970 5:157987548-157987570 CCTGGGCCTGGTGCTGCCAGTGG + Intergenic
1000211016 5:159105879-159105901 CCAGAGCCTCCTTCTACCAAGGG - Intergenic
1001091916 5:168748073-168748095 CCAGTGCCTCTGCCTGGCAGAGG - Intronic
1001429147 5:171645876-171645898 CCATTGTGTCCTGCAGCCAGGGG + Intergenic
1001986217 5:176076011-176076033 GCAGTGCCTGCCCCTGCCAGAGG + Intronic
1002047930 5:176552504-176552526 GCAGTGTGTCCTGCAGCCAGTGG + Intronic
1002230650 5:177762113-177762135 GCAGTGCCTGCCCCTGCCAGAGG - Intronic
1002261750 5:177998016-177998038 ACAATGCATCCTGCTGCCTGGGG + Intergenic
1002264684 5:178021635-178021657 GCAGTGCCTGCCCCTGCCAGAGG + Intronic
1002394845 5:178944606-178944628 TCAGTGCCTGCTTCTGCCTGAGG - Intronic
1002521763 5:179796283-179796305 CCAGCGCCACCAGCAGCCAGAGG - Exonic
1003145150 6:3504231-3504253 CCTGTGCCTCTTGGGGCCAGGGG - Intergenic
1003173426 6:3737749-3737771 CAAAGGCCTCCTGCAGCCAGAGG + Intronic
1003397507 6:5765695-5765717 CCAGCCCCTCCTGCTGTCATGGG + Intronic
1003515943 6:6818814-6818836 CCAGAGACTCCTGCTGTCGGGGG + Intergenic
1003774173 6:9340637-9340659 CCATTGACGCCTGCTCCCAGGGG + Intergenic
1005646007 6:27838955-27838977 CGTGCGCCTGCTGCTGCCAGGGG + Exonic
1005860574 6:29896880-29896902 GCAGTGCCTCCTGCTGCACATGG - Intergenic
1005987871 6:30885292-30885314 CCAGCGCTTCCAGCAGCCAGAGG + Intronic
1006372887 6:33656392-33656414 CCAGTGGCTCCTGGAGACAGTGG + Intronic
1006845677 6:37059824-37059846 GCAGAGCCTCCTGCTCCCTGTGG + Intergenic
1007726792 6:43921609-43921631 CCAGTGCAGCCTGTTCCCAGAGG + Intergenic
1007810175 6:44480073-44480095 CCAGTGCAGGCTGCTGCCAGAGG - Intergenic
1009292056 6:61894723-61894745 CCAGTGCCACCTGTAGCAAGAGG - Exonic
1010024655 6:71201293-71201315 CCAGTCCCTCCTGCCTGCAGAGG - Intergenic
1010481153 6:76355791-76355813 CCTGTGCCTTCTGCTGCTGGAGG + Intergenic
1011551103 6:88531604-88531626 CCAGTGCCTGAGGATGCCAGGGG - Intergenic
1011618190 6:89217239-89217261 CCAGTGCATTCTGCTTTCAGTGG + Exonic
1012987150 6:105887290-105887312 ACAGTGGCTTCTGCTGTCAGAGG - Intergenic
1013422549 6:109979304-109979326 ACCGGGACTCCTGCTGCCAGCGG + Exonic
1014954557 6:127599350-127599372 TCACTGCTTCCTGCTGACAGGGG + Intergenic
1015626529 6:135184396-135184418 TTAGTGCCTCCTGTTGACAGTGG + Intronic
1016798423 6:148143099-148143121 CCAGTCCCTTCAGCTCCCAGGGG - Intergenic
1016952498 6:149593916-149593938 CCATTGCCTCTGGGTGCCAGCGG - Intergenic
1016990428 6:149924643-149924665 CCCTTGCCTCCTGCTCCCATGGG - Intergenic
1017494777 6:154973915-154973937 GCAGAATCTCCTGCTGCCAGTGG + Intronic
1017696295 6:157019785-157019807 CCTGTATTTCCTGCTGCCAGCGG + Intronic
1018592593 6:165443375-165443397 CCAGTGCATGCTGATGCAAGGGG + Intronic
1018815239 6:167325451-167325473 CCAGTGCCTCCTGCATGCTGAGG + Intronic
1019083192 6:169450264-169450286 CCAGGGCTCCCTGCTGCCTGGGG - Intergenic
1019136179 6:169909353-169909375 CTACTTCCTCCTCCTGCCAGTGG + Intergenic
1019565978 7:1679343-1679365 CCAGAGCCTCCTGCAGGGAGGGG - Intergenic
1019612082 7:1941702-1941724 CCAGGGCCTCCTGCTGCAGGTGG - Intronic
1019725229 7:2598484-2598506 GCAGTGCCTGCTGCTGGGAGTGG - Exonic
1019743646 7:2688060-2688082 CCACTCCCTCCAGCTGCCCGCGG - Intronic
1022481891 7:30749688-30749710 CCAGTGCCTCCTGCTGCCAGAGG - Intronic
1023216733 7:37870645-37870667 CCTGGGCCTCATGCAGCCAGTGG + Intronic
1023718759 7:43071850-43071872 TAACTGCCTCCTGCTGACAGGGG + Intergenic
1023837996 7:44079732-44079754 CCAGAGCCTCCTGCAGGGAGGGG + Exonic
1023912628 7:44566506-44566528 CCAGTTCCTCCTGCTCTCCGTGG - Exonic
1024095310 7:45978150-45978172 TCAGAGCCTGCTGCAGCCAGGGG + Intergenic
1024219754 7:47278275-47278297 CTACTTCCTCCAGCTGCCAGCGG + Intronic
1024271444 7:47645276-47645298 GCAGTGCCTGCTGCTTCCTGTGG + Intergenic
1025157846 7:56625540-56625562 TAAGTGCTTCCTGCTGACAGGGG - Intergenic
1025198314 7:56948252-56948274 CCAGTGCTTCCAGCTGCCCTGGG - Intergenic
1025673635 7:63628681-63628703 CCAGTGCTTCCAGCTGCCCTGGG + Intergenic
1026584788 7:71647432-71647454 CCAGTTCCTCCTGCTCCTACAGG + Intronic
1027047355 7:74999935-74999957 CCAGTGCACCCAGCTGACAGGGG - Intronic
1028214798 7:88118334-88118356 CCCTTCTCTCCTGCTGCCAGAGG + Intronic
1029385636 7:100241694-100241716 CCAGTGCACCCGGCTGACAGGGG + Intronic
1030994040 7:116336003-116336025 GCTGTGCCTCCTGCTACCATAGG - Intronic
1032240359 7:130154638-130154660 GCAGTGCCTGCAGCTGCCTGGGG + Intergenic
1032471252 7:132180893-132180915 CCATTGCCTCTTCCTCCCAGTGG + Intronic
1032642071 7:133781009-133781031 CCAGTGCCTCTTGCTTCCAAAGG - Intronic
1033597675 7:142868511-142868533 CCAGGGCCGCCTGCAGCCACGGG + Exonic
1034558139 7:151862933-151862955 CCAGTGCTCCCTGCACCCAGAGG - Intronic
1034560807 7:151878003-151878025 CCAGTACCGCCTGCTGCCGAGGG + Intergenic
1035353645 7:158264547-158264569 CCACTGTCACCTGCTGCCACCGG - Intronic
1035486274 7:159228692-159228714 AAAGTGCCTCCTGCAGGCAGGGG + Intergenic
1035513030 8:206693-206715 CCAGCGCCTCCTGCTGGCGACGG + Intergenic
1036813769 8:11886123-11886145 CCAGTGCATCCTGGAGACAGAGG - Intergenic
1036953804 8:13165990-13166012 CCAGTCCCTCTGGCTCCCAGTGG - Intronic
1039276679 8:35940130-35940152 CCAGTGCCTGCTGTTGGCAGTGG + Intergenic
1039856818 8:41422187-41422209 CCAGTGGCTTCTGTTTCCAGTGG + Intergenic
1043252578 8:78093738-78093760 CCAGTGACTTCTGCTGCCAAAGG + Intergenic
1043515744 8:80993223-80993245 CCAGTGCCTGCTCCTGCCATGGG - Exonic
1043596041 8:81885974-81885996 CTAGTGCCTTGTGCAGCCAGTGG + Intergenic
1045246126 8:100443091-100443113 TCAGTGCCTCTTGCTGAGAGGGG + Intergenic
1047080551 8:121454811-121454833 CCAGAGCCTGCTGCTGCCCTGGG + Intergenic
1048548183 8:135406211-135406233 TCAGGGTCGCCTGCTGCCAGAGG - Intergenic
1048792808 8:138119592-138119614 CCAGTTCCTCCTTGTACCAGTGG - Intergenic
1048866978 8:138768419-138768441 CCACTGCCTTCTGCTGCCTCCGG - Intronic
1049257605 8:141622307-141622329 CCAGCCCTTGCTGCTGCCAGAGG + Intergenic
1049297053 8:141846857-141846879 CCAGTTCCTACTGGTACCAGAGG + Intergenic
1049348859 8:142153408-142153430 CCTGCACCTTCTGCTGCCAGCGG - Intergenic
1049379464 8:142304879-142304901 GCACAGCCTCCTCCTGCCAGCGG + Intronic
1049400366 8:142424004-142424026 GCAGGGCCGCCTGCAGCCAGTGG + Intergenic
1049639387 8:143707773-143707795 CCAGTTCCGCCCGCTGCCAGTGG + Exonic
1052603560 9:30671047-30671069 GCAGCTCCTCCTGCTCCCAGAGG - Intergenic
1054327462 9:63720363-63720385 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1056081174 9:83095365-83095387 CCATTGCTTCCTGCTGCCATAGG - Intergenic
1056457424 9:86774193-86774215 CCAGCCCCTCCTGGAGCCAGGGG + Intergenic
1057921815 9:99104493-99104515 CTATTTCCTCCTGCTCCCAGCGG - Intronic
1059328206 9:113517564-113517586 CCGGACCCTCCTGCTGTCAGAGG + Exonic
1059336693 9:113573507-113573529 CCAGGCCCTCCTGCTTCCAAAGG + Intronic
1060506364 9:124201073-124201095 CCACTGACTCCTGCTGCCCCAGG + Intergenic
1061680387 9:132240135-132240157 CCAGAGCCTCCTGCTGGGTGGGG - Intronic
1061780763 9:132994886-132994908 CCTGTGACACCTGCTTCCAGGGG + Intergenic
1062104912 9:134750114-134750136 CCAGTGCCTCCTGTGCCCAGTGG - Intronic
1062339852 9:136089193-136089215 CCAGAGCCTCCCCCTGCCAGGGG + Intronic
1062588603 9:137263018-137263040 ACAGTGCCTCTTGCTGCAGGTGG + Exonic
1062710971 9:137975022-137975044 GCTGGGCCTCCTGCTGCCTGTGG + Intronic
1202794237 9_KI270719v1_random:105892-105914 GCAGGTCCTCCTGCTCCCAGAGG + Intergenic
1185784348 X:2877283-2877305 CCAGTGCATCCTGCAGACTGGGG - Exonic
1186320550 X:8419792-8419814 CCATAGCCACCTGCTGCCTGAGG + Intergenic
1186459968 X:9740131-9740153 CCAGCTCCTCCTGCAGCCTGGGG + Intronic
1186770337 X:12811906-12811928 CCACTTCCTGCTGCTGGCAGAGG - Intronic
1187913664 X:24133325-24133347 CCAGTGCCTGCTGGGACCAGAGG + Intergenic
1188359118 X:29230872-29230894 TCAGAGACTCCTGCTACCAGAGG - Intronic
1189026858 X:37404235-37404257 CCTTTCCCTACTGCTGCCAGAGG + Intronic
1189309143 X:40008000-40008022 CGGGTTCCTCCTGCTTCCAGAGG - Intergenic
1190499767 X:51062879-51062901 CCAGGGCATCCTGGTGCAAGGGG - Intergenic
1192253706 X:69436300-69436322 CCAGCTCCTCCTTCTACCAGAGG + Intergenic
1192330724 X:70173218-70173240 CCAGTCACTACTGCTTCCAGGGG + Intergenic
1192553463 X:72071531-72071553 CCACCTCCTCGTGCTGCCAGAGG - Intergenic
1192582748 X:72298576-72298598 ACCCTGCCTCCTGGTGCCAGTGG - Intronic
1192618456 X:72652328-72652350 CATGTCCCTCCTGCTGCCCGGGG - Intronic
1192801869 X:74473365-74473387 CCATTGCCTCATCCAGCCAGAGG - Intronic
1193011947 X:76686751-76686773 CCAGTGCCACTTACTGCCATGGG - Intergenic
1194809760 X:98375639-98375661 TAAGTGCTTCCTGCTGACAGGGG + Intergenic
1194885251 X:99307345-99307367 CCTGTGGCTCCTGGTGCCTGAGG + Intergenic
1196733449 X:118963783-118963805 CCAGTGCTTCCTGCTGCTCCTGG + Intergenic
1198262171 X:134974576-134974598 CCAGTGCCCTCTCCTGCCATAGG - Intergenic
1199109657 X:143915832-143915854 TCAGTGCCTCCAGCTGTGAGTGG - Intergenic
1199169850 X:144722515-144722537 TAACTGCTTCCTGCTGCCAGGGG - Intergenic
1201149080 Y:11085533-11085555 GCAGGTCCTCCTGCTCCCAGAGG - Intergenic