ID: 1022481896

View in Genome Browser
Species Human (GRCh38)
Location 7:30749707-30749729
Sequence CTGGAGGCCTTGCGTTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022481891_1022481896 -4 Left 1022481891 7:30749688-30749710 CCTCTGGCAGCAGGAGGCACTGG 0: 1
1: 0
2: 2
3: 46
4: 467
Right 1022481896 7:30749707-30749729 CTGGAGGCCTTGCGTTAGGAGGG No data
1022481887_1022481896 19 Left 1022481887 7:30749665-30749687 CCAAAGGGGAGTTTGGATTCATT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1022481896 7:30749707-30749729 CTGGAGGCCTTGCGTTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022481896 Original CRISPR CTGGAGGCCTTGCGTTAGGA GGG Intronic
No off target data available for this crispr