ID: 1022482061

View in Genome Browser
Species Human (GRCh38)
Location 7:30750839-30750861
Sequence ATTGGCTTGTATAATTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 805
Summary {0: 1, 1: 1, 2: 16, 3: 140, 4: 647}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022482061_1022482065 19 Left 1022482061 7:30750839-30750861 CCTCCACAATTATACAAGCCAAT 0: 1
1: 1
2: 16
3: 140
4: 647
Right 1022482065 7:30750881-30750903 TCTCTCAGTGTACACAAGCTGGG No data
1022482061_1022482064 18 Left 1022482061 7:30750839-30750861 CCTCCACAATTATACAAGCCAAT 0: 1
1: 1
2: 16
3: 140
4: 647
Right 1022482064 7:30750880-30750902 TTCTCTCAGTGTACACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022482061 Original CRISPR ATTGGCTTGTATAATTGTGG AGG (reversed) Intronic
900957878 1:5898730-5898752 ATTGGCTTGTCTAAATTTGGTGG + Intronic
901764831 1:11493087-11493109 ATTGGCTTATGTGATTATGGAGG + Intronic
902901701 1:19521484-19521506 ATTGGCTCATACAATTATGGAGG + Intergenic
903662467 1:24986716-24986738 ATTGGCTCATGCAATTGTGGAGG - Intergenic
904222009 1:28978967-28978989 ATTGGCTCACATGATTGTGGTGG - Intronic
904224998 1:29009822-29009844 ATTTTCTGGTTTAATTGTGGTGG + Intronic
904968139 1:34396291-34396313 ATTGGCTTATGTAATTTTGGAGG - Intergenic
905155199 1:35972153-35972175 ATTGGCTTGTCTAATTCCAGTGG - Exonic
905385459 1:37600461-37600483 ATTTGCTTGTAAAACTGTTGAGG - Intergenic
905855562 1:41309423-41309445 ATTGGTTTATATGATTGAGGAGG + Intergenic
906779700 1:48561895-48561917 ATTGGCTTATGCAATTATGGAGG - Intronic
907255497 1:53175647-53175669 ATTGGCTCATGTGATTGTGGAGG - Intergenic
907256103 1:53180315-53180337 ATTGGCTTACATGACTGTGGAGG - Intergenic
907485181 1:54773005-54773027 ATTGGCTCATATGATTATGGAGG + Intergenic
907627514 1:56044556-56044578 ACTGGCTTATACAATTGTGGGGG + Intergenic
908015372 1:59827084-59827106 ATTGGCTCATGTGATTGTGGAGG + Intronic
908698180 1:66868722-66868744 ATTGGCTTATGTAATTATGGAGG - Intronic
909158572 1:72114396-72114418 ATTGGCTCATGTGATTGTGGAGG - Intronic
909466415 1:75978847-75978869 ATTGGCTTGCATATATGTGATGG - Intergenic
909601882 1:77469520-77469542 ATTGGCTTACACAATTGTAGGGG - Intronic
909650345 1:77968665-77968687 ATTGCCTTGTAATGTTGTGGGGG - Intronic
910290338 1:85594517-85594539 ATTGGCTTATGCAGTTGTGGGGG + Intergenic
910294762 1:85633384-85633406 ATTGGCTCATACAATTATGGAGG - Intergenic
910318389 1:85915451-85915473 ATTGGCTCACATGATTGTGGGGG - Intronic
910419095 1:87036585-87036607 TTTGGCTAGTATATTTGTGTAGG + Intronic
910473188 1:87577356-87577378 ATTGGATTGAATAATTGGGAGGG - Intergenic
911594963 1:99788959-99788981 ATTGGCTTACATGATTGTGGGGG + Intergenic
911697948 1:100914448-100914470 ATTGGCTTATAAAAATATGGTGG + Intronic
912105977 1:106276157-106276179 ATTGGCTTAGAAAACTGTGGAGG + Intergenic
912672499 1:111643863-111643885 ATTGGCTTATGTGATTGTGGGGG + Intronic
913024238 1:114820042-114820064 ATTGGCTTATGCAATTGTGGAGG + Intergenic
913097224 1:115530142-115530164 ATTGGCTTACATAATTGTGGAGG + Intergenic
913344192 1:117791672-117791694 ATTAGCTCATATAGTTGTGGAGG - Intergenic
913479750 1:119276656-119276678 ATTGGCTTATGTGATTGTGGGGG + Intergenic
913538270 1:119795084-119795106 ATTGGCTCATGCAATTGTGGGGG - Intronic
914220227 1:145674769-145674791 ATTGGCTTGTATGATTATGGAGG - Intronic
914472805 1:147997631-147997653 ATTGGCTTGTGTGATTATGGAGG - Intergenic
914772173 1:150697390-150697412 ATTGGCTGGTTTAATGGGGGTGG - Intergenic
915775406 1:158479658-158479680 ATTATCTTGTATTATTCTGGTGG + Intergenic
915917330 1:159948434-159948456 ATTGGCTTACATGATGGTGGAGG - Intergenic
916400073 1:164437760-164437782 ATTGGCTTGTGTGATTATGGAGG - Intergenic
916606138 1:166343789-166343811 ATTGGCTCATGTGATTGTGGAGG + Intergenic
916752449 1:167735583-167735605 ATTCGCTCATATGATTGTGGAGG + Intronic
917243858 1:172978706-172978728 ATTGGCTCATGTGATTGTGGGGG - Intergenic
917276839 1:173340279-173340301 ATTGGCTCATACAATTATGGAGG - Intergenic
917282773 1:173394862-173394884 ATTGGCTCACATGATTGTGGAGG - Intergenic
917360847 1:174174462-174174484 ATTGGCTTACACAATTATGGAGG + Intronic
917716896 1:177747416-177747438 ATTGGCTTATACAGTTATGGGGG - Intergenic
918077208 1:181179614-181179636 ATTGGCTCATACAGTTGTGGAGG - Intergenic
918276985 1:182962364-182962386 TTTGGTTTGTATTATTTTGGAGG + Intergenic
918358357 1:183728344-183728366 ATTGGCTAATGTAATTATGGAGG - Intronic
918389728 1:184046330-184046352 ATTGGCTCATGTGATTGTGGGGG - Intergenic
918523579 1:185441399-185441421 ATTGGCTTATGTGATTGTGGGGG + Intergenic
919234821 1:194827439-194827461 ATGGACTTATATAATTATGGAGG + Intergenic
919303787 1:195803837-195803859 ATTAGCTCGTGCAATTGTGGGGG + Intergenic
919408242 1:197210552-197210574 ATTGGCTCACATGATTGTGGGGG - Intergenic
919923909 1:202182340-202182362 ATTGGCTCATGTGATTGTGGAGG + Intergenic
920411533 1:205765235-205765257 ATTGGCTTACACAATTATGGAGG - Intergenic
921608625 1:217184264-217184286 ATTGGCTTGCACAATTATGAAGG - Intergenic
921619038 1:217306272-217306294 ATTGGCTCACATAATTGTGAAGG - Intergenic
921762621 1:218934183-218934205 ATTGGCTTACATAGTTATGGAGG + Intergenic
922360600 1:224818207-224818229 ATTGGCTCACACAATTGTGGAGG - Intergenic
923178381 1:231491763-231491785 ATTGGCTCCCATGATTGTGGAGG + Intergenic
923510657 1:234649556-234649578 ATTGGCTCATATGATTATGGAGG + Intergenic
923536450 1:234855879-234855901 ATTGGCTCAATTAATTGTGGAGG + Intergenic
923885150 1:238146367-238146389 ATTGGCTTACCCAATTGTGGAGG + Intergenic
924164989 1:241271852-241271874 TTTGGCTTGTGTGATTGTGGAGG - Intronic
924258580 1:242206913-242206935 ATTGGCACATATGATTGTGGGGG + Intronic
924447161 1:244144073-244144095 ATTGGCTTGAGTAATTTCGGTGG + Intergenic
924476856 1:244390072-244390094 ATTGGCTTGTGCAATTATGGAGG + Intergenic
1063049628 10:2433024-2433046 ATTGGCGTATGTGATTGTGGGGG - Intergenic
1063098282 10:2927187-2927209 ATTGGCTTATGCGATTGTGGAGG - Intergenic
1064114117 10:12563043-12563065 ATTGGCTCATGTAATTCTGGAGG + Intronic
1064690668 10:17915080-17915102 ATTGGCTTGCACAATTATGAAGG + Intergenic
1064969355 10:21048618-21048640 ATTGGCTCACATAATTGTGGGGG + Intronic
1065077897 10:22099153-22099175 ATTGGCTTATGCAATTATGGAGG + Intergenic
1065347212 10:24760026-24760048 ATTGGCTTATGCAATTATGGAGG - Intergenic
1065386392 10:25137931-25137953 ACTGGCTTATATAATTATGGAGG + Intergenic
1065462123 10:25979768-25979790 TGTGGCTTGGATAATTGTTGTGG + Intronic
1065606618 10:27424720-27424742 ATTGGCTGTTAGAATTGTGGGGG - Intergenic
1065808500 10:29418805-29418827 ATTGGCTTCTCTATTTCTGGGGG + Intergenic
1065857950 10:29845602-29845624 ATGGGCTCATATAATTGTGGAGG + Intergenic
1066051858 10:31643604-31643626 ATTGGATTGTAAAGATGTGGAGG - Intergenic
1066598491 10:37078085-37078107 ATTGGCTCATATGATTATGGAGG - Intergenic
1067241454 10:44498254-44498276 ATTGGCTTACATGATTATGGAGG + Intergenic
1067734618 10:48839898-48839920 ATTGGTTTTCTTAATTGTGGTGG + Intronic
1068470417 10:57455033-57455055 AATGGGTTTTATAATTTTGGAGG - Intergenic
1068488316 10:57688377-57688399 ATTGGCTCCAATTATTGTGGAGG + Intergenic
1068892227 10:62159882-62159904 ATTGGCTCACACAATTGTGGGGG - Intergenic
1069181212 10:65361260-65361282 ATTGGCTGATACAATTATGGAGG - Intergenic
1069194397 10:65531157-65531179 ATTGGTTTGCATGATTATGGAGG + Intergenic
1069572094 10:69500447-69500469 ATTGGCTTGTGTAATTATGGAGG + Intronic
1070043201 10:72803145-72803167 TTTGGCTTTTATTATTGTGGAGG + Intronic
1070699784 10:78593329-78593351 ATTGGCTCACATAATTATGGAGG + Intergenic
1070900054 10:80020757-80020779 ACTGGCTTATGTGATTGTGGAGG - Intergenic
1070901856 10:80036998-80037020 ACTGGCTTATGTGATTGTGGAGG - Intergenic
1071203432 10:83247008-83247030 ATTGGCCTACATAATTGTGAGGG - Intergenic
1071368518 10:84926899-84926921 ATTCGCTTGTAAGATTTTGGAGG - Intergenic
1072755713 10:98019508-98019530 TTTGGGCTGAATAATTGTGGGGG - Intronic
1073465099 10:103690407-103690429 ACTGGCTTATGTGATTGTGGAGG + Intronic
1073878039 10:107948411-107948433 ATTGGCTTACATGACTGTGGAGG + Intergenic
1073912658 10:108364588-108364610 ATTGGCTCACACAATTGTGGAGG - Intergenic
1074060221 10:109958594-109958616 ATTGGCTCATGCAATTGTGGAGG + Intergenic
1075398452 10:122144047-122144069 ATTGGCTCATGTGATTGTGGGGG + Intronic
1075872716 10:125782384-125782406 ATTGGCTCACATAATTCTGGAGG - Intergenic
1076923534 10:133468020-133468042 ATTTTCTTGTACAATTGTAGTGG + Intergenic
1077287625 11:1774839-1774861 GTTGGCCTGTGTAATTATGGAGG - Intergenic
1077709439 11:4521184-4521206 ATTGGCTAACATAATTATGGAGG - Intergenic
1077819485 11:5722773-5722795 ATTGGCTTACATAACTGTGGAGG + Intronic
1077966824 11:7143129-7143151 ATTGGCTTATATGTTTATGGAGG - Intergenic
1078025291 11:7689363-7689385 ATTGGCTTACACAATTGTGGGGG - Intergenic
1078646357 11:13144272-13144294 ATTGGCTTATAGAATTATGGAGG + Intergenic
1078774991 11:14385601-14385623 ATTGGGTTTTCTAGTTGTGGTGG + Intergenic
1078897444 11:15609474-15609496 ATTGGCTTATGAGATTGTGGGGG + Intergenic
1079092365 11:17490001-17490023 ATTGGCTCACACAATTGTGGAGG - Intergenic
1079448570 11:20579652-20579674 ATTAGCTTGTGTGATTATGGAGG + Intergenic
1079609846 11:22418567-22418589 ATTGGCTTAGATGATTATGGAGG + Intergenic
1079854469 11:25583862-25583884 ATTGCCCTGGATAATTGTGTTGG + Intergenic
1079915321 11:26362764-26362786 ATTAACTTGTATAATTTTGCTGG + Intronic
1080026372 11:27619716-27619738 ATTGGCTTATTCAGTTGTGGGGG - Intergenic
1080163282 11:29205060-29205082 ATTGGCTTGTGCAATTAGGGAGG - Intergenic
1080464363 11:32482971-32482993 ATTGGGTCACATAATTGTGGAGG + Intergenic
1080490746 11:32761801-32761823 ACTGGCTTACACAATTGTGGCGG + Intronic
1081154323 11:39670283-39670305 ATTGGCTTATGCAATTATGGAGG - Intergenic
1081341420 11:41932667-41932689 ATTGTCTTATGTGATTGTGGGGG - Intergenic
1081393110 11:42553029-42553051 ATTGGCTCATGTGATTGTGGCGG - Intergenic
1082178044 11:49084648-49084670 ATTGGCTCACAAAATTGTGGAGG + Intergenic
1082892501 11:58155076-58155098 TTTGGCTCATATGATTGTGGGGG + Intronic
1084728166 11:70955591-70955613 ATTGGTTTAAATGATTGTGGAGG + Intronic
1085076370 11:73596709-73596731 ATTGGGTTGGATTATTTTGGTGG - Intronic
1085081885 11:73641719-73641741 ATTGGCTTATATGATTGAGGGGG + Intergenic
1086080287 11:82896821-82896843 ATTGGCTCATGCAATTGTGGAGG - Intronic
1086170948 11:83835975-83835997 ATTGGCTTATGTAGTTGTGGAGG + Intronic
1086687676 11:89751207-89751229 ATTGGCTCACAAAATTGTGGAGG - Intergenic
1086718176 11:90088688-90088710 ATTGGCTCACAAAATTGTGGAGG + Intergenic
1086725583 11:90179199-90179221 ATTGTCTTTTATTATTCTGGGGG + Intronic
1086904690 11:92405038-92405060 GTTGGCTTGCATGATTATGGGGG - Intronic
1087017549 11:93568787-93568809 ATTGGCTTATGTGATTATGGAGG + Intergenic
1087377305 11:97360586-97360608 ATTGGCTCATGTAATTGTAGAGG + Intergenic
1087737419 11:101850733-101850755 ATTGGCTTGTGTGCTTTTGGAGG - Intronic
1087902797 11:103661448-103661470 ATTGGCTCACACAATTGTGGAGG - Intergenic
1087970549 11:104476153-104476175 ATTGGCTTACAGAATTGTTGGGG + Intergenic
1088456427 11:110037149-110037171 ATTGGCTAATATGATTATGGAGG - Intergenic
1088751529 11:112846087-112846109 ATTGGCTAATGTGATTGTGGAGG - Intergenic
1088942181 11:114470650-114470672 ATTGGCTCACATTATTGTGGGGG + Intergenic
1089039291 11:115431382-115431404 AGTGGCTTGTATTAGGGTGGTGG - Intronic
1089136254 11:116251674-116251696 ATTGGCTTATGCAATTATGGAGG + Intergenic
1089186826 11:116623096-116623118 ATTGGCTGATATGATTATGGAGG + Intergenic
1090060217 11:123458142-123458164 ATTGGCTTACATGATTATGGAGG + Intergenic
1090752344 11:129758570-129758592 ATTTGCTTGTGTGATTGTAGGGG - Intergenic
1091232064 11:133994823-133994845 ATTGGCTTACACAATTATGGAGG + Intergenic
1091629275 12:2147017-2147039 ATTTGCTTTGATAATTGGGGGGG - Intronic
1092324293 12:7512857-7512879 ATTGGCTTGCATAATTTTGGTGG - Intergenic
1092475293 12:8813758-8813780 ATTGGCTCACATGATTGTGGAGG + Intergenic
1092584925 12:9889592-9889614 ATTGTCTCATATAATTGTGGGGG - Intronic
1093002224 12:14010085-14010107 ATTAGCTTACATGATTGTGGGGG - Intergenic
1093208890 12:16283982-16284004 ATTGGCTCATGTGATTGTGGAGG - Intergenic
1093386914 12:18568462-18568484 ATTGGCTCACATGATTGTGGAGG + Intronic
1093415700 12:18918025-18918047 ATTGGCTCACATGATTGTGGAGG - Intergenic
1093417615 12:18937878-18937900 TCTGGCTTATATAATTGTGTTGG + Intergenic
1093715267 12:22374834-22374856 ATTTGCATGTATAATTATGCTGG - Intronic
1093904632 12:24675646-24675668 ATTGGCTCATGTAATTATGGAGG - Intergenic
1093975921 12:25422183-25422205 ATTGGCTCACATAATTATGGTGG + Intronic
1094277499 12:28694805-28694827 ATTGGCTTGTGCAATTCTGGAGG + Intergenic
1094378873 12:29821046-29821068 ATTGGCTCACATGATTGTGGAGG + Intergenic
1094439964 12:30463974-30463996 ATTGGCTTATGTGATTATGGAGG - Intergenic
1094543184 12:31379470-31379492 ATTGGCTCACACAATTGTGGAGG - Intergenic
1094788151 12:33875257-33875279 ATTGGCTTATGCAATTATGGAGG - Intergenic
1095731816 12:45513750-45513772 ATTGGCTCATGTGATTGTGGAGG - Intergenic
1095739188 12:45588429-45588451 ATTGGCTCATGTGATTGTGGAGG - Intergenic
1096266167 12:50124283-50124305 ATTGGCTTCTATGGTTCTGGAGG - Intergenic
1096609348 12:52790683-52790705 ATTGGCTTTTGTAATTGTTCTGG - Intronic
1096663479 12:53145475-53145497 ATTGGCTTGCACAATTATGGAGG + Intergenic
1098492445 12:71097990-71098012 ATTGGCTTATGTAATTATGAAGG - Intronic
1098746246 12:74240764-74240786 ATTGGCTCACATAATTATGGTGG - Intergenic
1098776176 12:74620431-74620453 ATTGGCTCTCATAATTGTGAAGG - Intergenic
1098789852 12:74807682-74807704 TGTGGCTAGTAAAATTGTGGTGG + Intergenic
1098905550 12:76158100-76158122 ATTGGCTCACACAATTGTGGAGG - Intergenic
1099841834 12:87975990-87976012 ATGGGCTTGTGCGATTGTGGAGG - Intergenic
1100019019 12:90047370-90047392 ATTGGCTCATATGATTATGGAGG - Intergenic
1100031080 12:90191889-90191911 ATTGGCTTATATAATTACGGTGG - Intergenic
1100198440 12:92273304-92273326 ATTGGCTCACATGATTGTGGAGG - Intergenic
1100212978 12:92417291-92417313 ATTGACTTATATGATTATGGAGG - Intergenic
1100579287 12:95923248-95923270 ATTGGCTCATATAATTATGGAGG - Intronic
1100657395 12:96661425-96661447 TTTGGCTTATATGATTGTGGAGG + Intronic
1100957640 12:99926638-99926660 ATTGGCTTGTGTGATTATGGAGG - Intronic
1101403558 12:104408998-104409020 ATTGGCTTTCACAATTGTGGAGG + Intergenic
1101698218 12:107146932-107146954 ATTGGCTCATGTGATTGTGGAGG - Intergenic
1101733601 12:107446337-107446359 AATGGCATGTTTATTTGTGGTGG + Intronic
1102098470 12:110258853-110258875 ATTGGCTTATGTGATTGTAGGGG + Intergenic
1102442882 12:112977208-112977230 ATTGGCTCATGTGATTGTGGAGG + Intergenic
1103735877 12:123060584-123060606 AATCGCTTGTTTATTTGTGGTGG - Intronic
1104132820 12:125910789-125910811 ATTGGCTTATACAATTATGGAGG + Intergenic
1104357963 12:128104858-128104880 ATTGGCTTATGCAATTGTGGGGG - Intergenic
1104502979 12:129303710-129303732 ATTGGCTCATATGATTATGGAGG + Intronic
1105755531 13:23460095-23460117 TTTGGCTCATATAATTATGGAGG - Intergenic
1106398395 13:29403798-29403820 ATTGGCTTACATAATTGTAGAGG - Intronic
1106625636 13:31418307-31418329 ATTGGCTCACATGATTGTGGGGG + Intergenic
1106875113 13:34063581-34063603 ATTGGCTTGCATGATTATGGAGG + Intergenic
1107039280 13:35932367-35932389 AATGGCTTGTGTTATTATGGAGG - Intronic
1107325029 13:39232529-39232551 ATTGGCTTGCACAGTTGTAGGGG + Intergenic
1107676810 13:42806210-42806232 ATTGGCTCACATAATTATGGAGG - Intergenic
1107996462 13:45865734-45865756 ATTGGCTCATGCAATTGTGGAGG + Intergenic
1108234095 13:48383996-48384018 AAAGGCTTGGAAAATTGTGGAGG + Intronic
1108424906 13:50289826-50289848 GTTGGCTTATATGATTGTGGGGG + Intronic
1109397995 13:61785808-61785830 ATTGGCTCGCATGATTATGGAGG - Intergenic
1109451528 13:62520914-62520936 ATTGGCTTACACAATTATGGAGG + Intergenic
1109459958 13:62643657-62643679 ATTGACTTATACAATTATGGAGG - Intergenic
1109580947 13:64333687-64333709 ATTGGCATATGTGATTGTGGGGG - Intergenic
1109933535 13:69247969-69247991 ATTGGCTTACATGATTATGGAGG + Intergenic
1110039563 13:70735763-70735785 CTTGGCTTGAATGAATGTGGAGG + Intergenic
1110335180 13:74321767-74321789 ATTGGCTTATGTGCTTGTGGAGG + Intergenic
1110788224 13:79559067-79559089 ATTGGCTTATCTGATTATGGTGG + Intergenic
1111038797 13:82716249-82716271 ATTGTTTTATATAATTGTGAGGG - Intergenic
1111089300 13:83421936-83421958 ATTGGCTTGTGCAATTATGGAGG - Intergenic
1111819508 13:93195594-93195616 ATTGGCTTACATGATTTTGGTGG - Intergenic
1112160309 13:96860152-96860174 ATTGGCTCATATAATCATGGGGG + Intergenic
1112631845 13:101170165-101170187 ATTGGCTCATGTAATTATGGAGG + Intronic
1112748258 13:102552368-102552390 CTTGGATTGTCTTATTGTGGTGG - Intergenic
1113302632 13:109038576-109038598 ATTGGCTCACATAATTATGGGGG - Intronic
1113412027 13:110098579-110098601 ATTGACTTGTGTGATTATGGAGG - Intergenic
1114584446 14:23797266-23797288 ATTAGCTCTTATGATTGTGGAGG - Intergenic
1115184561 14:30670709-30670731 ATTGGCTTTTGTGATTTTGGGGG + Intronic
1115278175 14:31631526-31631548 ATTGGCTCACATAATTATGGAGG + Intronic
1115714189 14:36084670-36084692 ATTGGCTTGCATGATAGTGGAGG - Intergenic
1116213750 14:41982756-41982778 ATTAGCTCATATTATTGTGGGGG + Intergenic
1116409406 14:44603893-44603915 ATTGGCTTACATGATTATGGAGG + Intergenic
1116731076 14:48623394-48623416 ATTGGCTCACATGATTGTGGAGG + Intergenic
1118474755 14:66106220-66106242 ATTGGCTTATACAATTATGGAGG + Intergenic
1118520205 14:66574989-66575011 ATTGGCTCATGTAATTATGGAGG - Intronic
1118722253 14:68602600-68602622 ATTGGTTTATGCAATTGTGGAGG + Intronic
1118781642 14:69012597-69012619 ATTGGCTCATGTGATTGTGGGGG - Intergenic
1119137042 14:72230610-72230632 ATTGGCTTATGCAACTGTGGGGG + Intronic
1119177958 14:72583279-72583301 ATTGGCTTATACCATTATGGAGG - Intergenic
1120086333 14:80278417-80278439 ATTGGCTTACACAATTGTGATGG + Intronic
1120479913 14:85037032-85037054 ATTGGCTCGTGTGATTATGGAGG + Intergenic
1120644261 14:87054322-87054344 ATTGGCTCATATGATTATGGAGG + Intergenic
1120724390 14:87921769-87921791 ATTGGCTCATAGAATTGTAGAGG + Intronic
1120928393 14:89821364-89821386 ACTGGCTTGCAGGATTGTGGGGG - Intronic
1121581884 14:95037874-95037896 ATTGGCTTATGCAATTATGGAGG + Intergenic
1121663944 14:95657836-95657858 ATTGGCTCATGTAATTGTGGAGG - Intergenic
1121942354 14:98083188-98083210 ATTGGCTTGTGTGAATATGGAGG - Intergenic
1121969153 14:98340567-98340589 ATTGGCTCATGTAATTATGGAGG - Intergenic
1122385309 14:101341133-101341155 ATTGGCTTGCACGATTATGGAGG - Intergenic
1123805570 15:23868553-23868575 ATTAGCTTATTTAATTTTGGAGG + Intergenic
1124529977 15:30497569-30497591 ATTGGCTTACATAATTATGAAGG - Intergenic
1124768682 15:32510119-32510141 ATTGGCTTACATAATTATGAAGG + Intergenic
1125190136 15:36982098-36982120 ATTGGCTTGTGCAGTTATGGAGG - Intronic
1125262736 15:37846381-37846403 ATTAGCTTATGTAATTGTAGAGG - Intergenic
1126386025 15:48094225-48094247 ATTGGCTTGTGCAATTATGGAGG - Intergenic
1126564412 15:50080153-50080175 ATTGGATTTTATGATTTTGGGGG - Intronic
1126905138 15:53356785-53356807 ATTGGCTTACATGATTATGGAGG - Intergenic
1126966775 15:54063014-54063036 ATAGGCCTGGATAATTGTAGTGG + Intronic
1129150070 15:73683132-73683154 ATGGGTGTGTATATTTGTGGGGG - Intergenic
1130694476 15:86116819-86116841 ATTGGCTCATGTAATTATGGAGG - Intergenic
1130779013 15:87015301-87015323 ATTGGCTTCCATGATTATGGAGG - Intronic
1130875438 15:88009936-88009958 TTTGGCTTGGATAAGTTTGGTGG - Intronic
1130928233 15:88400966-88400988 ATTGGTTTATGTAATTGTGGGGG - Intergenic
1131153019 15:90058765-90058787 ATTGGCTCCTGTGATTGTGGGGG + Intronic
1131662591 15:94534465-94534487 ATTGGCTTACATAATTGTGGGGG + Intergenic
1131922698 15:97347295-97347317 ATTGGCTTACATAATTATGGAGG + Intergenic
1132423194 15:101691996-101692018 ATTGGCTTGTGTGATTATGGAGG - Intronic
1133822051 16:9245649-9245671 ATTGGCTCATATGATTGTAGGGG + Intergenic
1133867695 16:9659421-9659443 ATTGGCTTGCATGATTGTGCAGG - Intergenic
1134192705 16:12134885-12134907 ATTGGCTCATATAATTATGGGGG + Intronic
1134747226 16:16597680-16597702 ATTGGCTCGCATGATTATGGAGG + Intergenic
1134775236 16:16847146-16847168 ATTAGCTTACATGATTGTGGTGG - Intergenic
1134998247 16:18755979-18756001 ATTGGCTCGCATGATTATGGAGG - Intergenic
1135671130 16:24376545-24376567 ATGGGCTTATGTGATTGTGGAGG - Intergenic
1135883554 16:26282753-26282775 ATTGGCTTACATGATTGTGGGGG + Intergenic
1135892608 16:26371200-26371222 ATTGGCTCACATGATTGTGGGGG - Intergenic
1136280719 16:29209048-29209070 ATTGGCTAATGTAATTGTGAGGG + Intergenic
1137842754 16:51654940-51654962 ATTGACTTCTGTGATTGTGGGGG - Intergenic
1137902312 16:52281999-52282021 ATTGGCTCATACAATTGTGGAGG - Intergenic
1137955975 16:52829852-52829874 ATTGGCTTATACAATTATGGAGG + Intergenic
1140557947 16:75943178-75943200 ATTGGCTCACACAATTGTGGGGG - Intergenic
1140763767 16:78136857-78136879 ATTACCCTGTCTAATTGTGGTGG - Intronic
1141256872 16:82410554-82410576 ATTTTCTTGTATATTTTTGGTGG + Intergenic
1141899222 16:86979421-86979443 ATTGGCTGATGTGATTGTGGAGG - Intergenic
1142085076 16:88174969-88174991 ATTGGCTAATGTAATTGTGAGGG + Intergenic
1143285198 17:5783979-5784001 ATTGGCTTATGTGATTGTAGGGG + Intronic
1143727552 17:8859859-8859881 ATTGGCTCCTGTGATTGTGGAGG - Intronic
1144583754 17:16475356-16475378 ATTGGCTCACATGATTGTGGGGG + Intronic
1144589456 17:16511902-16511924 ATTGGCCTGTGCAATTATGGAGG - Intergenic
1145831265 17:27918178-27918200 ATTGGCTTACATGATTGAGGGGG + Intergenic
1146165815 17:30587544-30587566 ATTGGCTTATGCAATTATGGAGG - Intergenic
1147542827 17:41375189-41375211 ATTAGCTTATATGATTATGGAGG - Intronic
1148256712 17:46139929-46139951 ATTTACTTGAATTATTGTGGTGG - Intronic
1148569276 17:48654826-48654848 ATTGGCTTGCATGATTATGGAGG + Intergenic
1149053606 17:52335964-52335986 ATTGGCTCACATAATTATGGAGG - Intergenic
1149105666 17:52961575-52961597 ATTGACTTATGTAATTATGGAGG - Intergenic
1149350485 17:55781960-55781982 ATTGGCTCATACAATTATGGAGG + Intronic
1150875082 17:68962050-68962072 ATTGGCTCACATGATTGTGGGGG + Intergenic
1150931126 17:69586564-69586586 ATTGGCTCATGTGATTGTGGAGG - Intergenic
1151941791 17:77297096-77297118 ATTGGCTCATACCATTGTGGAGG + Intronic
1153132186 18:1867182-1867204 AATGCCTTGTATTATTTTGGTGG - Intergenic
1154250583 18:12740980-12741002 ATTGGCTTGTGTGATTATGGAGG + Intergenic
1155580498 18:27299778-27299800 ATTGGCTTATGTGATTATGGAGG - Intergenic
1155932458 18:31721828-31721850 ATTGGCTTACACAATTGTGAGGG - Intergenic
1155981528 18:32185164-32185186 ATTGGCTCACATGATTGTGGAGG - Intronic
1156598859 18:38579964-38579986 ATTGGCTTATATAATTGTGGGGG - Intergenic
1156720453 18:40063114-40063136 TTTGCCTTTTATAATTGTAGAGG - Intergenic
1157044820 18:44088831-44088853 ATTGGCTTATATAATTACAGAGG + Intergenic
1157075325 18:44460039-44460061 CTTGGTTTGTAAAATTGTAGTGG - Intergenic
1157340530 18:46773846-46773868 ATTGGCTCATATCATTGTGGAGG - Intergenic
1158078503 18:53560875-53560897 ATTGGCTTATATTATTGTAGGGG - Intergenic
1158482821 18:57836769-57836791 ATTGGCTTATGTGATTGTGGAGG - Intergenic
1158799611 18:60890745-60890767 ATTGGCTCTCACAATTGTGGGGG + Intergenic
1159335937 18:67066922-67066944 ATTGGCTTAAATAATTATGGTGG + Intergenic
1160264952 18:77334425-77334447 ATTGGCTCATATAATTATGGAGG + Intergenic
1161122158 19:2534676-2534698 ATTGGCTCACATAATTATGGAGG + Intronic
1161625515 19:5324332-5324354 ATTGGCTTGTATTATTTTTAGGG + Intronic
1161822492 19:6538800-6538822 ATTGTATTGTATAATTGTTAAGG + Intergenic
1163027712 19:14522617-14522639 ATTGGCTTACATGCTTGTGGGGG - Intronic
1163205692 19:15801031-15801053 ATTGGCTCACATAATTATGGAGG - Intergenic
1165019550 19:32912531-32912553 ATTGGCTCACACAATTGTGGGGG - Intronic
1165546473 19:36541112-36541134 ATTGGCTTGTGCAATTATGGGGG + Intronic
1166629850 19:44396692-44396714 ATTGACTTATATGATTATGGGGG - Intronic
1166637605 19:44464726-44464748 ATTGGCTTATATGATTATGGGGG + Intergenic
1167085108 19:47304261-47304283 ATTGGCTCATGCAATTGTGGGGG - Intronic
925298634 2:2794551-2794573 ATTGGCTTATGTGATTATGGGGG - Intergenic
925323353 2:2995200-2995222 ATTGGCTTATGTGATTATGGAGG + Intergenic
925516329 2:4686909-4686931 ATTGGCTTATGTGATTATGGAGG - Intergenic
925729967 2:6912729-6912751 ATTGGCTTACATAATTATGGAGG + Intergenic
925770609 2:7279048-7279070 ATTGGCTTGTATCATCATGGAGG - Intergenic
926390078 2:12380769-12380791 ATTGGCTTACATCATTGTTGGGG - Intergenic
926414982 2:12640804-12640826 ACTGGCTTACACAATTGTGGAGG + Intergenic
926863795 2:17337457-17337479 ATTGGCTCATACAATTATGGAGG + Intergenic
926985119 2:18613965-18613987 ATTGGCTTATGTGATTGTGGAGG - Intergenic
927131635 2:20065103-20065125 ATTGGCTTCCACAGTTGTGGGGG - Intergenic
927285106 2:21349186-21349208 ATTGGCTTTTTTAATTGTGGGGG + Intergenic
927849890 2:26492310-26492332 CTTGGACTGGATAATTGTGGTGG - Intronic
928351876 2:30565181-30565203 ATTGGCTCTTACAGTTGTGGAGG + Intronic
928403414 2:30995869-30995891 ATTGGCTTATGTGATTATGGAGG + Intronic
928489996 2:31772753-31772775 ATTGGCTCACATGATTGTGGGGG + Intergenic
928526012 2:32141356-32141378 ATATGCTTGTTTAAATGTGGAGG + Intronic
930533619 2:52620142-52620164 ATTGGCTCATATGATTATGGAGG - Intergenic
930903290 2:56534074-56534096 ATTGGCTCATGTAATTATGGAGG + Intergenic
931012998 2:57940144-57940166 ATTGGCTCATATAATTATGGAGG + Intronic
931047996 2:58378950-58378972 ATTGGCTCATACAATTTTGGAGG + Intergenic
931207925 2:60165624-60165646 ATTGGCTCACATGATTGTGGAGG + Intergenic
931438913 2:62273430-62273452 ATTGGTTCGCATGATTGTGGAGG + Intergenic
931445095 2:62320466-62320488 ATTTGGTTTTATGATTGTGGTGG + Intergenic
932388291 2:71359161-71359183 ATTGGCTTACACAATTATGGAGG + Intronic
932444397 2:71766418-71766440 ATTGGCTCACATAATTGTGGAGG - Intergenic
932855587 2:75230669-75230691 ATTGGCTTTTGTAATTATGGAGG - Intergenic
932910138 2:75797911-75797933 ATTGGCTCACATAATTATGGAGG + Intergenic
933560774 2:83883395-83883417 ATTGGCTCACATAATTATGGAGG + Intergenic
933566531 2:83957303-83957325 ATTGGCTCATACAATTGTGGAGG - Intergenic
934581850 2:95448359-95448381 ATTGGCTCACAAAATTGTGGAGG - Intergenic
934597600 2:95628355-95628377 ATTGGCTCACAAAATTGTGGAGG + Intergenic
934886730 2:98031714-98031736 ACTGGCTTATATGATTGTGAAGG + Intergenic
935107076 2:100054641-100054663 ATTGGCTTATGTGATTATGGAGG - Intronic
936636810 2:114268027-114268049 CTTGGCTTGTATAACTTTGAAGG + Intergenic
937500672 2:122475207-122475229 ATTGGCTTACACAATTTTGGGGG - Intergenic
937600300 2:123723577-123723599 ATTGGCTTACATGATTATGGAGG + Intergenic
937942259 2:127295114-127295136 ATTGGCTCATGCAATTGTGGGGG - Intergenic
937994951 2:127686246-127686268 ATTGGCTTGTATGACTATGGAGG - Intergenic
938120599 2:128630606-128630628 ATTGGCTTGCACAATTATGGAGG - Intergenic
938609225 2:132930078-132930100 CCTGGCTTATACAATTGTGGAGG - Intronic
938686061 2:133739145-133739167 ATTGGCTTATGCAATTGTAGAGG + Intergenic
938774182 2:134526589-134526611 TTTGTCTAGCATAATTGTGGAGG - Intronic
939576369 2:143900347-143900369 ATTGGCTCATGCAATTGTGGGGG + Intergenic
939768004 2:146277500-146277522 ACTGGCTTATGTAATTGTGGAGG + Intergenic
939985322 2:148824528-148824550 ATTGGCTTATATGATTATGGTGG - Intergenic
940147855 2:150566185-150566207 ATTGGCTCACATGATTGTGGAGG - Intergenic
941359897 2:164539012-164539034 ATTTGCTTGAAATATTGTGGTGG + Intronic
941708587 2:168687155-168687177 CTTGGCTAGTACAATTCTGGTGG - Intronic
942655974 2:178214416-178214438 ATTGGCTTGCTCATTTGTGGGGG + Intronic
943244930 2:185434775-185434797 ATTGGCTCATATAATTATGGAGG + Intergenic
944442061 2:199752642-199752664 ATTGGCTTATGTGATTATGGGGG - Intergenic
946124370 2:217548675-217548697 GTTGGCTTGTGTGATTCTGGAGG - Intronic
946655487 2:221941415-221941437 ATTGGCTTACATGATTGTGGAGG - Intergenic
947022782 2:225700390-225700412 TTCTGCTTGTATAATTGAGGTGG + Intergenic
947024758 2:225724615-225724637 GTTGGCTTACATTATTGTGGAGG - Intergenic
947348985 2:229222811-229222833 ATTGGCTTATGTGATTTTGGAGG - Intronic
1169732187 20:8798405-8798427 ATTGGCTTATGCAATTTTGGTGG + Intronic
1169880112 20:10338024-10338046 ATTCACTTGTATATTTGTGGAGG - Intergenic
1169987996 20:11468770-11468792 ATTTGCTTTTATAAATGTGAAGG + Intergenic
1170025821 20:11889194-11889216 ATTGGCTTATATGGTTGTGGAGG + Intergenic
1170030467 20:11938828-11938850 ATTGGCTCACATGATTGTGGAGG - Intergenic
1170061831 20:12266951-12266973 CTTGGCTTGAATACTTCTGGGGG - Intergenic
1170530520 20:17286917-17286939 ATTGGCTTATGCAATTGTGAAGG + Intronic
1171224959 20:23434859-23434881 ATTGGCTTGTACAATTATGGAGG - Intergenic
1172865910 20:38097129-38097151 ATTGGCTCACACAATTGTGGAGG + Intronic
1173037573 20:39427444-39427466 ATTGGCTTATGCAATTATGGAGG + Intergenic
1173654558 20:44690679-44690701 CTTGGCTTGTCTCATGGTGGAGG + Intergenic
1173756336 20:45519903-45519925 ATTGGCTCACATGATTGTGGAGG + Intergenic
1175480260 20:59305643-59305665 TTTGGCTTACATGATTGTGGGGG + Intronic
1175637023 20:60593243-60593265 ATTGGCTCATACAATTATGGTGG - Intergenic
1176425684 21:6547075-6547097 ATTGGCTCGGGCAATTGTGGGGG - Intergenic
1176587444 21:8602009-8602031 ATTGGCTTATGTGATTGTGGAGG + Intergenic
1177335511 21:19720715-19720737 ATTGGCTTGTGTGATTACGGAGG + Intergenic
1177568283 21:22852243-22852265 ATTGGCTTGCCCAGTTGTGGAGG + Intergenic
1177600953 21:23313063-23313085 ATTCCCTTGTATAATTCCGGTGG - Intergenic
1177605493 21:23372126-23372148 ATTGGCTCATATGATTATGGAGG - Intergenic
1177645523 21:23895904-23895926 ATTGGCTCACATAATTATGGAGG - Intergenic
1177765465 21:25451941-25451963 ATTGGCTCATGTAATTATGGAGG - Intergenic
1177772310 21:25530372-25530394 ATTGGCTCATGTAATTATGGAGG - Intergenic
1177883059 21:26716938-26716960 ATTGGTTTGTATTAATGTAGTGG + Intergenic
1177957925 21:27623801-27623823 TTTGGCTCGTGTAATTGTGAAGG - Intergenic
1177969141 21:27766951-27766973 ATTAGCTTATATGATTATGGAGG + Intergenic
1178300331 21:31447838-31447860 ATTGGCTCGTGTGATTATGGAGG + Intronic
1178463543 21:32825617-32825639 ATTAGCTCACATAATTGTGGAGG + Intergenic
1178789865 21:35689714-35689736 ATTGGCTTACGCAATTGTGGGGG + Intronic
1179077203 21:38133809-38133831 ATTGTCTTGTGTGATTGTAGGGG + Intronic
1179176477 21:39011487-39011509 ATTGGCTTGCGTGATTATGGAGG + Intergenic
1179310375 21:40190246-40190268 AGTGGCTTGTGGAATTGGGGTGG - Intronic
1179426773 21:41286067-41286089 ATTGGCTTACATGATTATGGAGG - Intergenic
1179617530 21:42591518-42591540 ACTGGCTTATGTAACTGTGGGGG - Intergenic
1179701175 21:43155392-43155414 ATTGGCTCGGGCAATTGTGGGGG - Intergenic
1179952880 21:44721175-44721197 ATTGCCTTATGTGATTGTGGGGG - Intergenic
1180270275 22:10579006-10579028 ATTGGCTTATGTGATTGTGGAGG + Intergenic
1181780437 22:25189000-25189022 ATTGGCTCATGTGATTGTGGAGG + Intronic
1182406659 22:30139191-30139213 ATTGGCTTATCCAATTATGGAGG - Intronic
1183147163 22:36004032-36004054 TTTGAGTTTTATAATTGTGGAGG - Intronic
1184541501 22:45128639-45128661 ATTGGCTCCCATAATTGTGGGGG + Intergenic
1185136261 22:49074828-49074850 ATTGGCTTATACAATTATGAAGG - Intergenic
949139915 3:619744-619766 ATTGGCTTATGTGATTGTGGAGG - Intergenic
949633753 3:5959381-5959403 ATTGTTTTGCCTAATTGTGGTGG + Intergenic
949840968 3:8319541-8319563 CTTGGCTTGGATTATAGTGGTGG - Intergenic
949852028 3:8429348-8429370 AATGGTTTGAATAATTTTGGTGG - Intergenic
949906258 3:8861177-8861199 ATTGGCTTGCTTGATTATGGGGG - Intronic
950213547 3:11141397-11141419 ATTGTCTTTTATAATTTGGGGGG + Intronic
950327185 3:12121795-12121817 ATTGGCTCAGATGATTGTGGGGG + Intronic
950851219 3:16063944-16063966 ATTTGGTTCTATAAATGTGGAGG + Intergenic
951022866 3:17799569-17799591 ATTGGCTGGTAAAATGGTGGAGG - Intronic
951258224 3:20475850-20475872 ATTTGCTTCTATAATTTTGTTGG + Intergenic
952144387 3:30516044-30516066 ATTGTCTTTTATGATTGTGGAGG - Intergenic
952269851 3:31819978-31820000 GTTGGCTTATATGATTGTGGGGG - Intronic
953233626 3:41086480-41086502 ATTGGCTTATGTGATTGTGGAGG - Intergenic
953547743 3:43876128-43876150 ATTGGCTCGTGTGATAGTGGAGG + Intergenic
953609038 3:44432353-44432375 ATTGGCTTATAGAATTAAGGAGG + Intergenic
953712718 3:45288260-45288282 ATTGGCTTGTGAGATTGTGGAGG + Intergenic
953895764 3:46798940-46798962 GTTGGCTTGTACAATTATGGAGG - Intronic
953965177 3:47299143-47299165 ATTGGCATATATAAGTGTGGTGG + Intronic
955226798 3:57066919-57066941 ATTGGCTCATGTGATTGTGGAGG - Intronic
955638562 3:61056870-61056892 GTTTGCATTTATAATTGTGGTGG + Intronic
956320562 3:67991792-67991814 ATTGGCTCACATAATTATGGAGG - Intergenic
956635796 3:71363663-71363685 ATTTTCTTGTATTATTATGGAGG - Intronic
957245564 3:77711805-77711827 ATTGTTTTATGTAATTGTGGAGG + Intergenic
957289078 3:78254011-78254033 ATTGGCTCATGTAATTATGGAGG - Intergenic
957462272 3:80536520-80536542 ATTTTCTTGTATAGTTGTGATGG - Intergenic
958126918 3:89368403-89368425 ATTTGTTTGCATAATTATGGAGG + Intronic
959017731 3:101154788-101154810 ATTGGCTCATATGATTATGGAGG + Intergenic
959268618 3:104175285-104175307 ATTGGCTCATACATTTGTGGAGG + Intergenic
959280516 3:104332316-104332338 ATTGGTTTACATGATTGTGGAGG - Intergenic
959446991 3:106452869-106452891 ATTGGCTCATATAATTATGGAGG + Intergenic
959502894 3:107127029-107127051 ATTGGCTCACATAATTATGGAGG + Intergenic
959577560 3:107950647-107950669 ATTGGCTCACATGATTGTGGAGG - Intergenic
959727844 3:109564256-109564278 ATTGGCTCATATAATTATAGAGG - Intergenic
960249872 3:115440043-115440065 ATGGGCTTTTATGATTGTGGAGG + Intergenic
960613355 3:119574754-119574776 ATTGGCTTATACAATTGTGGAGG + Intergenic
961778992 3:129310551-129310573 ACTGGCTTGCACAATTGTAGGGG - Intergenic
961927921 3:130502693-130502715 ATTGGCTCATGTGATTGTGGAGG - Intergenic
962472029 3:135717839-135717861 ATTGACTTATATAATTGTGGGGG + Intergenic
962586505 3:136847599-136847621 ATTGGCTTATGTTCTTGTGGGGG + Intronic
962895285 3:139708363-139708385 ATTGGCTTATGTCATTATGGAGG - Intergenic
963106464 3:141651793-141651815 ATTGGCTCACATGATTGTGGAGG + Intergenic
963568936 3:146967341-146967363 ATTGGCTTATGTAATTTTGGGGG - Intergenic
964073753 3:152667596-152667618 ATTGGCTAATGCAATTGTGGAGG - Intergenic
964539522 3:157763979-157764001 ATTGGCTTACACAATTATGGAGG - Intergenic
965097089 3:164244229-164244251 ATTGGCTCATGTGATTGTGGAGG + Intergenic
965425186 3:168514193-168514215 ATTGGCTTATGTGATTATGGAGG + Intergenic
966271017 3:178105745-178105767 ATTGGCTCACATGATTGTGGAGG - Intergenic
966335844 3:178867212-178867234 ATTGACTTACATGATTGTGGGGG - Intergenic
966432503 3:179846942-179846964 ATTGGCTCACACAATTGTGGAGG - Intronic
966495319 3:180573524-180573546 ATTGGCTCACATGATTGTGGGGG - Intergenic
967149035 3:186631289-186631311 ACTGGCTTATGCAATTGTGGGGG + Intergenic
967475025 3:189906732-189906754 ATTGGCTTGTGTGATGATGGAGG + Intergenic
967523798 3:190468796-190468818 GTTGGCTTATGTAATTGTGTAGG + Intergenic
967662737 3:192133093-192133115 ATTGGCTCATACAATTGTGGGGG + Intergenic
968931863 4:3584715-3584737 ATTGGCCCACATAATTGTGGAGG - Intronic
969887837 4:10232060-10232082 ATTGGCCTATGTAATTATGGGGG + Intergenic
970317543 4:14844202-14844224 ATTGGCTCACATGATTGTGGAGG + Intergenic
970331488 4:14990114-14990136 ATTGGCATGTATGTTTATGGGGG - Intergenic
970552750 4:17199545-17199567 ATTGGTTTGTGTGATTATGGAGG + Intergenic
970941891 4:21643795-21643817 ATTGGCTCACATAATTATGGAGG - Intronic
971228081 4:24773359-24773381 ATTGGCTTACATGATTATGGAGG - Intergenic
971277502 4:25211945-25211967 ACTGGCTTATGTGATTGTGGGGG - Intronic
971629686 4:28974499-28974521 ATTGGCTTATGCAATTGTGGAGG + Intergenic
971701690 4:29985169-29985191 AGTGGCTTACATAATTATGGAGG + Intergenic
971701856 4:29987145-29987167 AGTGGCTTACATAATTATGGAGG - Intergenic
971870876 4:32236972-32236994 ATTTGCTCGTGTAATTATGGAGG - Intergenic
972028423 4:34418084-34418106 ATTGGCTTATGCAATTGTGGGGG - Intergenic
972073729 4:35056801-35056823 GTGGGTTTGTATAATTGTAGGGG - Intergenic
972553993 4:40162772-40162794 ATTGGCTCCTGTAATTTTGGAGG + Intergenic
972776123 4:42242218-42242240 ATTGTCTCATATAATTATGGAGG - Intergenic
972987604 4:44783569-44783591 ATTGGGTTGCACAATTATGGAGG - Intergenic
973098333 4:46229559-46229581 ATTGGCTTGTGTGATTAGGGAGG - Intergenic
973211741 4:47622814-47622836 ATTGGCTTATGTGATTCTGGAGG - Intronic
973546842 4:51990690-51990712 ATTGGCTCATGTAATTATGGAGG - Intergenic
973942279 4:55923329-55923351 ATTGGCTCATGTAATTATGGAGG + Intergenic
974336414 4:60551543-60551565 ATTGGCTTGTATGATTATGAGGG - Intergenic
974372265 4:61032743-61032765 ATTGGCTTGCACAATCATGGAGG - Intergenic
974773790 4:66452639-66452661 ATTGGGTAGTATACCTGTGGAGG + Intergenic
975177452 4:71304213-71304235 ATTGGCTGTTGTAATTATGGAGG + Intronic
975230931 4:71932247-71932269 ATTTGCATGTATATTAGTGGTGG + Intergenic
975575560 4:75859038-75859060 ATTGGCTTACATGATTATGGAGG - Intergenic
975703730 4:77091191-77091213 ATTGGCTCATGCAATTGTGGAGG + Intergenic
975709709 4:77148265-77148287 ATTGGCTTATGCAATTATGGAGG - Intergenic
975903071 4:79176386-79176408 ATTGGCTCATGTAATTGTGGAGG + Intergenic
976351693 4:84067120-84067142 ATTGGCTTCCACTATTGTGGGGG - Intergenic
977334174 4:95675021-95675043 ATTGGCTCATGTGATTGTGGAGG + Intergenic
977465309 4:97377042-97377064 ATTGGCTCTCACAATTGTGGGGG - Intronic
977891782 4:102320119-102320141 ATTGGCTCATGTGATTGTGGAGG - Intronic
978083980 4:104627297-104627319 ATTGGCTTACACAATTATGGAGG + Intergenic
978606871 4:110490264-110490286 ATGCCCTTGTATAATCGTGGTGG - Intronic
978772551 4:112472073-112472095 ATTGTTTTGTATATTTGTGTGGG + Intergenic
979123153 4:116928311-116928333 ATTGGCTTACATGATTATGGAGG + Intergenic
979140375 4:117164891-117164913 ATTGGCTCATGTAATTATGGAGG + Intergenic
979469988 4:121084227-121084249 ATTGTCTTGTATACTTTTGAGGG - Intergenic
979799215 4:124887094-124887116 ATTGGCTTATTTGATTATGGAGG + Intergenic
979955982 4:126954842-126954864 ATTGGTTTGCATGATTGTGAGGG - Intergenic
979966080 4:127077681-127077703 CTTGGCTTATCTCATTGTGGGGG - Intergenic
979997154 4:127444637-127444659 ATTGGCATATATGATTATGGAGG - Intergenic
980119659 4:128714587-128714609 ATTGTCTAGTGTAATTATGGGGG + Intergenic
980246672 4:130254392-130254414 ATTGTCTTCTATAATGTTGGTGG - Intergenic
980382604 4:132043720-132043742 ATTGTCTTATGTGATTGTGGAGG + Intergenic
980858318 4:138467474-138467496 ATTGGCTCATGTAATTATGGAGG - Intergenic
981950163 4:150396438-150396460 ATTGGCATGTGTGATTATGGGGG - Intronic
983012818 4:162569454-162569476 ATTGGCTTATGCAATTATGGAGG + Intergenic
983037696 4:162887376-162887398 ATTGGCTTATGTCATTGTGGGGG - Intergenic
983127749 4:163975128-163975150 ATTGGCTTATGTAATTATGGAGG - Intronic
983825329 4:172251100-172251122 ATTGGCTTACATGATTGTGAGGG + Intronic
983857107 4:172659896-172659918 ACTGGATTATACAATTGTGGGGG - Intronic
984103768 4:175518296-175518318 ATTGGCTTACATAATTATAGAGG - Intergenic
984111468 4:175621644-175621666 ATTGGCTTGTGTAAATGAGGTGG - Intergenic
984341636 4:178464871-178464893 ATTGGCTCATGCAATTGTGGAGG + Intergenic
984848684 4:184131859-184131881 ATTGGCTTCCACAATTATGGAGG + Intronic
984972925 4:185206767-185206789 ATTGGCTTACATGATTATGGAGG + Intronic
985233823 4:187851084-187851106 ATTGGCTTACATGATTGTGGGGG + Intergenic
985278881 4:188267937-188267959 ATTGGCTTACATAACTGTGGAGG + Intergenic
985395186 4:189536574-189536596 ATTTCCGTGTATAAATGTGGGGG + Intergenic
985887728 5:2693115-2693137 ATTGGCTTTTGCCATTGTGGGGG + Intergenic
985906921 5:2846010-2846032 ATTGGCTCATATGATTATGGAGG + Intergenic
986120669 5:4833129-4833151 ATTGTCTTGTATAATTTATGGGG - Intergenic
986407612 5:7441953-7441975 ATTCACTTATGTAATTGTGGCGG - Intronic
986511906 5:8516838-8516860 AGTGGCTTACAAAATTGTGGGGG + Intergenic
986517608 5:8580641-8580663 ATTGGCTTATGTCATTGTGGAGG - Intergenic
986520006 5:8605172-8605194 ATTGGCTTATGTGATTATGGAGG - Intergenic
986521723 5:8626418-8626440 ATTGGCTTATATGTTTATGGGGG - Intergenic
986751278 5:10790181-10790203 ATTGGCTTACATGATTATGGAGG + Intergenic
987036111 5:14020054-14020076 ATTGGCTTACACAATTGTGTGGG + Intergenic
987046757 5:14116004-14116026 ATTGGCTCGCATAATTATGGAGG + Intergenic
987136962 5:14909181-14909203 ATTGGCTTGTGTGATTATGGAGG + Intergenic
987186782 5:15429587-15429609 ATTGGCTAATATCGTTGTGGAGG + Intergenic
987199035 5:15556159-15556181 ATTGGCTTATGTGACTGTGGAGG + Intronic
987639424 5:20593743-20593765 ATTGGCTCACATGATTGTGGTGG + Intergenic
987808663 5:22804420-22804442 ATTGGCTTATGTGAATGTGGGGG + Intronic
987820682 5:22962135-22962157 ATTGGCTTATATAATTTCGAAGG - Intergenic
987844096 5:23259107-23259129 ATTGGCTTACATGATTGTGATGG + Intergenic
987856505 5:23425625-23425647 ATTGGCTCATATAATTATGGAGG + Intergenic
988175576 5:27719662-27719684 TTTGGCTTGTATATTTATTGTGG + Intergenic
988606365 5:32681794-32681816 GTTAGCTTATATGATTGTGGAGG + Intergenic
988640302 5:33034336-33034358 ATTGGTTATTAGAATTGTGGTGG - Intergenic
988877640 5:35465293-35465315 ATTGGCTCACATGATTGTGGGGG - Intergenic
989165560 5:38430679-38430701 ATTGGCTTGCATGATTATGGAGG + Intronic
989845510 5:46135650-46135672 ATTGGCTTATATCATTGTTTTGG - Intergenic
990323887 5:54655565-54655587 ATTGGCTTATATGATTATAGAGG - Intergenic
990598025 5:57330654-57330676 CTTGGCTCATATAATTATGGAGG + Intergenic
990657779 5:57976564-57976586 ATTGGCTCACATGATTGTGGAGG - Intergenic
991013191 5:61905095-61905117 ATTGGCTCATACAATTATGGAGG - Intergenic
991095656 5:62737340-62737362 AATGGATTTTATAATTGAGGGGG + Intergenic
991123394 5:63042439-63042461 ATTGGTTTGTGTGATTGTGAGGG + Intergenic
991470416 5:66963023-66963045 ATTGGCTGGAATAATCATGGTGG + Intronic
991920953 5:71656389-71656411 CTTGGCTTATATATTTGTGTGGG + Intronic
992034669 5:72760768-72760790 ATTGGCTTACATGATTATGGAGG - Intergenic
992108231 5:73468271-73468293 ATTGGCTCATTTAACTGTGGAGG + Intergenic
992161055 5:74002472-74002494 ATTGGCTTATGCAATTATGGAGG + Intergenic
992836613 5:80648037-80648059 ATTGGCTTACACAATTATGGGGG - Intronic
992933844 5:81680236-81680258 ATTGGCTCATATGATTATGGAGG - Intronic
993006716 5:82436296-82436318 ATTGGCTCACACAATTGTGGAGG - Intergenic
993006723 5:82436478-82436500 ATTGGCTTACATGATTTTGGAGG - Intergenic
994373737 5:98995037-98995059 ATTGGCTCACATAATTGTGGAGG - Intergenic
994540973 5:101096658-101096680 ATTTGCCTATGTAATTGTGGAGG - Intergenic
994651933 5:102539877-102539899 ATTGGCTTACATAATTATGGAGG - Intergenic
994804474 5:104426415-104426437 ATTGGCTTATACAATTATGGAGG - Intergenic
994873523 5:105384019-105384041 ATTGGCTCATATGATTGCGGAGG + Intergenic
994888981 5:105604987-105605009 ATTTGCTTCTATATGTGTGGGGG + Intergenic
994925955 5:106117652-106117674 AATTGCTTGTATAATTCTGTTGG - Intergenic
995209527 5:109521463-109521485 ATTGGCTTGTATGATTATGGGGG + Intergenic
995251894 5:110002894-110002916 ATTGGCTTGCATAATTATGGAGG + Intergenic
995585177 5:113641404-113641426 ATTGGCTCCTACAATTATGGAGG - Intergenic
995710908 5:115034576-115034598 ACTGTCTTGTATAGTTCTGGAGG + Intergenic
995773416 5:115698090-115698112 ATTGGCTTATAAGATTGTGAGGG - Intergenic
995856713 5:116600522-116600544 ATTGTCCTGTATAATTGGGATGG - Intergenic
996511241 5:124318624-124318646 ATTGGCTTATATGATTATGGAGG + Intergenic
996902810 5:128562866-128562888 ATTGGCTTACATGATTGTTGAGG - Intronic
997795379 5:136804506-136804528 ATTGGCTTACATAATTTTGGAGG + Intergenic
998454155 5:142257806-142257828 ATTGGCTCACATGATTGTGGAGG - Intergenic
998494736 5:142578267-142578289 ATTGGCTTGCATGATTGTGGAGG + Intergenic
998628532 5:143873218-143873240 ATTGGCTGGCATAATTGTAGAGG + Intergenic
999521473 5:152355099-152355121 ATTGGCTTAAATGATTATGGAGG + Intergenic
999522093 5:152361259-152361281 ATTGGCTTATATGGTTATGGAGG - Intergenic
999841374 5:155431158-155431180 ATTGGCCTATGTAATTATGGAGG - Intergenic
999985713 5:157003438-157003460 ATTGGCTTATGCAATTATGGAGG - Intergenic
1000122519 5:158210763-158210785 ATTGGCTTATATGATTATGGAGG + Intergenic
1000225580 5:159257971-159257993 ATTGGCTCACACAATTGTGGAGG - Intergenic
1000429388 5:161133392-161133414 ATTGGCTCATGTAGTTGTGGAGG + Intergenic
1000527928 5:162381589-162381611 ATTGGCTTATGCAATTATGGAGG + Intergenic
1000580114 5:163026196-163026218 ATTGGCTGGTTTGATTATGGAGG + Intergenic
1000733309 5:164864376-164864398 ATTGGCTTATGTAATCGTGGAGG - Intergenic
1001268887 5:170296002-170296024 ATTGGATTGTATAATTCTCCTGG + Intronic
1001339701 5:170831920-170831942 ATTGGCTCATATGATTATGGGGG + Intergenic
1001410979 5:171511467-171511489 ATTGGCTTATGTGATTGTCGGGG + Intergenic
1001475571 5:172048352-172048374 ATTGGCTTACACGATTGTGGGGG - Intronic
1001863723 5:175083923-175083945 ATTGGCTCATACAATTATGGAGG - Intergenic
1002045379 5:176538473-176538495 TTCTGCTTATATAATTGTGGTGG - Intergenic
1003721715 6:8710611-8710633 ATTGGCTCATATGATTGTGGAGG + Intergenic
1003763545 6:9210024-9210046 ATTGGCTTGCCTCATTGTGGAGG - Intergenic
1004471089 6:15929707-15929729 ATTGGCTTATGTGATTGTGGGGG + Intergenic
1004576262 6:16898113-16898135 ATTGGCTTATGCAATTATGGAGG - Intergenic
1004682393 6:17909122-17909144 TTTTGCGTGTATAATTGAGGAGG - Intronic
1004895117 6:20140739-20140761 ATTGGCTTATGTGATTATGGAGG - Intronic
1005242548 6:23848693-23848715 AGTGGCTTGGGTAATTGTTGAGG + Intergenic
1005564238 6:27073531-27073553 ATTGGCTTGCATGATTATGGGGG - Intergenic
1005992722 6:30913670-30913692 ATTAGTTTGTAAAATTGCGGTGG + Intronic
1007160561 6:39788745-39788767 ATTGGCTTATGTAATTATGGAGG + Intergenic
1007996169 6:46310235-46310257 ATTGCCTGGAATAATTGTGTAGG + Intronic
1008058228 6:46967400-46967422 ATTGGCGTATGTAGTTGTGGGGG + Intergenic
1008433596 6:51449282-51449304 ATAGGCTTGTATAATTATGGAGG - Intergenic
1009811466 6:68672987-68673009 TTTGGCTCACATAATTGTGGAGG - Intronic
1009844256 6:69115955-69115977 ATTGGTTTGCACAATTATGGAGG + Intronic
1009901218 6:69809950-69809972 ATTGACTTGTGCAATTGTGGGGG + Intergenic
1010003041 6:70967413-70967435 ATTGGCTTATATGATTATGGAGG - Intergenic
1010930431 6:81795217-81795239 ACTTGCTCGTATAATTGTGGTGG + Intergenic
1010970336 6:82256033-82256055 ATTGGCACATGTAATTGTGGAGG - Intergenic
1011002161 6:82603389-82603411 ATTGGCTCATATGATTATGGAGG + Intergenic
1011082342 6:83503383-83503405 ATTGACTTATGCAATTGTGGAGG + Intergenic
1011382117 6:86753225-86753247 ATTGGCTTATATGATTATGGAGG - Intergenic
1011827378 6:91325072-91325094 ATTAACTTGTTTAGTTGTGGAGG + Intergenic
1012041215 6:94206292-94206314 ATGGGCTCACATAATTGTGGGGG - Intergenic
1012060353 6:94470642-94470664 ATTGGCTCAGATGATTGTGGAGG + Intergenic
1012680818 6:102176944-102176966 ATTGGCTCACATAATTATGGAGG + Intergenic
1012741599 6:103022345-103022367 ATTGGCTTATGTGATTATGGAGG - Intergenic
1012757198 6:103247297-103247319 ATTGGCACATATGATTGTGGAGG + Intergenic
1012924525 6:105254175-105254197 ATTGGCTTGAACAACTATGGAGG - Intergenic
1013553515 6:111233557-111233579 ATTGGATTTAGTAATTGTGGAGG - Intergenic
1013861769 6:114644279-114644301 ATTGGCTTACATGATTATGGAGG - Intergenic
1013953680 6:115816329-115816351 ATTGGCTCATGTAATTTTGGAGG + Intergenic
1013968222 6:115982374-115982396 ATTGGCTCACAAAATTGTGGAGG - Intronic
1014216684 6:118758455-118758477 ATTGGCTCATATGGTTGTGGAGG - Intergenic
1014347206 6:120287499-120287521 ATTGGCTCATGCAATTGTGGAGG + Intergenic
1014361670 6:120484459-120484481 ATTGGCTCATACAATTGTTGAGG - Intergenic
1014454228 6:121618963-121618985 ATTGGCTCACATAATTATGGAGG + Intergenic
1014487963 6:122023961-122023983 ATTGGCTCATATGATTTTGGAGG - Intergenic
1015195477 6:130520919-130520941 ATTGGGTAGTTTAATTTTGGTGG - Intergenic
1015217806 6:130770117-130770139 ATTGGCTCACAGAATTGTGGGGG - Intergenic
1015356662 6:132285572-132285594 ATTTGCATGTACTATTGTGGTGG + Intergenic
1015671692 6:135698066-135698088 GTTGTCTTATATAATTGAGGAGG + Intergenic
1016158967 6:140852314-140852336 ATTGGCTTATGTGATTATGGAGG + Intergenic
1016552333 6:145295787-145295809 ATTGGTTTATGTGATTGTGGAGG + Intergenic
1016913469 6:149222292-149222314 ATTGGCTCGTGTGATTATGGAGG - Intronic
1017390114 6:153928816-153928838 ATTAGCTTACCTAATTGTGGGGG - Intergenic
1017471395 6:154740324-154740346 TTTGGCTGTCATAATTGTGGAGG - Intronic
1017632520 6:156411045-156411067 ATTGGCTCATGTAATTATGGAGG + Intergenic
1019967641 7:4513047-4513069 ATTGGCTCATGTGATTGTGGGGG - Intergenic
1020751673 7:12148677-12148699 ATTGGCTCACATAATTATGGAGG + Intergenic
1020882498 7:13779446-13779468 ACTGGCTTATACAATTATGGAGG + Intergenic
1020934989 7:14451498-14451520 ATTGGCTCACATGATTGTGGAGG - Intronic
1021677519 7:23096725-23096747 ATTGGCTCATACAATTATGGAGG - Intergenic
1021775156 7:24046922-24046944 ATTGGCTCATGCAATTGTGGAGG - Intergenic
1022029101 7:26476115-26476137 ATTGGCTTATGTGATTATGGAGG + Intergenic
1022482061 7:30750839-30750861 ATTGGCTTGTATAATTGTGGAGG - Intronic
1023901236 7:44481282-44481304 ATTGGCTTACATGATTGTGGGGG + Intronic
1024406634 7:48989779-48989801 ATTGACTTACATGATTGTGGAGG + Intergenic
1024743554 7:52381834-52381856 GTTGGCTTATGAAATTGTGGAGG + Intergenic
1024871664 7:53970445-53970467 ATTGGCTTATGCAATTATGGAGG + Intergenic
1024871882 7:53973039-53973061 ATTGGTTTGTTTAATTATTGAGG + Intergenic
1025624760 7:63210908-63210930 ACGCCCTTGTATAATTGTGGTGG - Intergenic
1026297009 7:69061798-69061820 ATTGGCTCACATGATTGTGGAGG + Intergenic
1026402092 7:70024680-70024702 ATTGGCTTACTTGATTGTGGGGG + Intronic
1027559091 7:79704608-79704630 ATTGGCTTGCATGATTATGAAGG - Intergenic
1028625161 7:92869476-92869498 ATAGGCTTATGTGATTGTGGGGG - Intergenic
1028628218 7:92902046-92902068 ATTGGCTTGTGTGATTGTTGGGG + Intergenic
1030165147 7:106547128-106547150 ATTGGCTCATATGATTATGGAGG + Intergenic
1031128228 7:117799958-117799980 TTTGGCTTCTATCAGTGTGGTGG - Intronic
1031579863 7:123459593-123459615 ATTTGCTCACATAATTGTGGAGG - Intronic
1031855085 7:126912485-126912507 ACTGGCTTACATAATTATGGAGG - Intronic
1032017019 7:128386795-128386817 ATTGGCTCACATCATTGTGGAGG - Intergenic
1032891875 7:136205433-136205455 ATTGGCTCACATGATTGTGGAGG + Intergenic
1033455736 7:141501803-141501825 ATTGACTCACATAATTGTGGAGG - Intergenic
1033662446 7:143411574-143411596 ATTGGCTAGGAGAATGGTGGAGG + Intergenic
1034070632 7:148181213-148181235 ATTGGCTCATGTAATTGTGGAGG - Intronic
1034356914 7:150458184-150458206 ATTGGCCTTCATGATTGTGGAGG + Intronic
1036602261 8:10272273-10272295 ATTGGCTCATATGATTATGGAGG + Intronic
1037375963 8:18228701-18228723 CTTGTCTTTTCTAATTGTGGAGG - Intergenic
1037596564 8:20359129-20359151 ATTGGCTCCCATAATTGTGTTGG - Intergenic
1038449298 8:27629130-27629152 ATTGGCTCATGTAATTATGGAGG - Intergenic
1039156556 8:34564831-34564853 ATTGGCTCACATAATTATGGGGG - Intergenic
1040703486 8:50096404-50096426 AGTGGCGAGTATAATTGTGAAGG + Intronic
1040829516 8:51661636-51661658 ATTGGCTCACACAATTGTGGGGG - Intronic
1041043965 8:53874461-53874483 ATTGGCTCATGTAATTGTGGAGG + Intronic
1041677847 8:60553793-60553815 ATTGGCGTATATGATTGTGGGGG + Intronic
1041803438 8:61824293-61824315 ATTGGCTTATATGATTGTGGGGG + Intergenic
1042538230 8:69880743-69880765 ACTGGCTTACATAATTGTGGAGG - Intergenic
1043207391 8:77463302-77463324 ATTGGCTTATGCAATTGTGGAGG - Intergenic
1043831388 8:84993422-84993444 ATTGGCTTCTACAATTATGAAGG + Intergenic
1044062892 8:87661670-87661692 ATTGGCTCATACAATTATGGAGG - Intergenic
1045294800 8:100863548-100863570 ATTGGCTCCCATGATTGTGGAGG - Intergenic
1045396302 8:101763915-101763937 ATTGGCTCATCTGATTGTGGAGG - Intronic
1045497072 8:102717850-102717872 ATTGGCTTATGTGATTATGGGGG - Intergenic
1045673818 8:104587737-104587759 TTTGACTAGTATAATGGTGGTGG - Intronic
1045706240 8:104926373-104926395 ATTGGCTCATATAATTATGAAGG - Intronic
1045867822 8:106889291-106889313 ATTGGCTCATATGATTATGGAGG + Intergenic
1046035807 8:108840098-108840120 ATTGGCTTATGTGATTATGGAGG + Intergenic
1046079782 8:109357344-109357366 CTTCGCTTGCATAAATGTGGTGG - Intergenic
1046472857 8:114701425-114701447 ATTGGCTTACATGATTGTGGAGG - Intergenic
1046521561 8:115332244-115332266 AGTGGCTTATAGAATTGTTGAGG + Intergenic
1046780064 8:118205234-118205256 ATTGGCTTATTCAATTGTGAAGG - Intronic
1046795377 8:118365664-118365686 ATTGGCTCGCATGATTTTGGAGG - Intronic
1046797145 8:118385506-118385528 ATTGGCCTGTGTAATTATGGAGG - Intronic
1046914291 8:119663165-119663187 AATGGGTAGTATAATTGTCGTGG + Intronic
1047104333 8:121716822-121716844 ATAGGCTCATATAATTATGGAGG + Intergenic
1047382598 8:124377131-124377153 ATTGGCTGGTATGGTTATGGAGG + Intergenic
1047705263 8:127492891-127492913 ATTGGTTCATATAATTATGGAGG - Intergenic
1047828718 8:128608407-128608429 ATTGGCTTGCATGATTATGGAGG - Intergenic
1048123255 8:131605396-131605418 ATTGGCTTGCATGATTATGGAGG + Intergenic
1048400006 8:134056609-134056631 TTTGGTTTGTATAATTGTATTGG - Intergenic
1048550492 8:135428891-135428913 ATTGGCTCGTGCAATTGTGGAGG - Intergenic
1048550757 8:135431887-135431909 ATTGGCTTACACAATTATGGAGG - Intergenic
1048750610 8:137669765-137669787 ATTTGCTGGTACAAGTGTGGTGG - Intergenic
1050039159 9:1470687-1470709 ATTGGCTCACATGATTGTGGAGG - Intergenic
1050092923 9:2033650-2033672 ATTCTCTTATATAATTCTGGAGG + Intronic
1051220492 9:14843445-14843467 ATTGGCTTATGTAATTGCGGAGG - Intronic
1051274128 9:15382910-15382932 ATTGGTTCATATCATTGTGGGGG - Intergenic
1051694999 9:19758673-19758695 ATTGGCTTTTGTAAGTGTGAGGG + Intronic
1051971469 9:22892398-22892420 ATTGGCTCATGTAATTATGGAGG - Intergenic
1052558114 9:30047028-30047050 ATTGGCTCATATAATTATGGAGG + Intergenic
1052683297 9:31722055-31722077 ATTGGCTAGAATACTTGAGGTGG - Intergenic
1052704453 9:31978135-31978157 ATTGGCTTCTGTGATTATGGGGG - Intergenic
1052751527 9:32496621-32496643 ATTGGCTCACATGATTGTGGAGG - Intronic
1052811174 9:33061950-33061972 AGGGGCTTGGATAATTGAGGGGG - Intronic
1052893904 9:33729842-33729864 ATTTGCTTGTGTGATTGTAGGGG - Intergenic
1053607613 9:39677115-39677137 ATTGGCTCATGTAATTATGGAGG + Intergenic
1053611128 9:39714183-39714205 ATTAGCTTATGTAATTCTGGAGG - Intergenic
1053865458 9:42433466-42433488 ATTGGCTCATGTAATTATGGAGG + Intergenic
1053869170 9:42472234-42472256 ATTAGCTTATGTAATTCTGGAGG - Intergenic
1054087127 9:60756975-60756997 ATTAGCTTATGTAATTCTGGAGG + Intergenic
1054242392 9:62628212-62628234 ATTAGCTTATGTAATTCTGGAGG + Intergenic
1054245921 9:62665291-62665313 ATTGGCTCATGTAATTATGGAGG - Intergenic
1054458265 9:65447214-65447236 ATTGGCCCACATAATTGTGGAGG + Intergenic
1054556518 9:66662730-66662752 ATTAGCTTATGTAATTCTGGAGG + Intergenic
1054560046 9:66699824-66699846 ATTGGCTCATGTAATTATGGAGG - Intergenic
1054832550 9:69642926-69642948 ATTGGTTCGTGTGATTGTGGAGG - Intronic
1054855536 9:69895300-69895322 ATTGGCTCACATGATTGTGGAGG - Intronic
1054888385 9:70224284-70224306 ATTGGCTCATATAATTATGAAGG + Intronic
1055116430 9:72610311-72610333 ATTGGCTCACATGATTGTGGAGG + Intronic
1055195748 9:73591282-73591304 ATTGGTTCCTATGATTGTGGAGG - Intergenic
1055224038 9:73971662-73971684 ATTGGCTTATGTGACTGTGGAGG - Intergenic
1056529403 9:87473635-87473657 ATTGGCTCATGCAATTGTGGAGG + Intergenic
1056537974 9:87547639-87547661 ATTGGCTTCTGTGATTGTGGAGG + Intronic
1056603271 9:88063464-88063486 ATTGGTTCATACAATTGTGGAGG + Intergenic
1056678925 9:88700119-88700141 AATGGCTCGCATGATTGTGGAGG - Intergenic
1056731350 9:89169052-89169074 ATTGGCTTGCATAATTTTGGAGG - Intronic
1056775356 9:89508414-89508436 ATTGGCTTCAGTAATTATGGAGG + Intergenic
1056779786 9:89540784-89540806 ACTGGCTTGCACAATTATGGGGG + Intergenic
1056943864 9:90977370-90977392 ATTGGCTTGCATGATTATGGAGG + Intergenic
1058797231 9:108510649-108510671 ATTGGGGTTTATACTTGTGGAGG - Intergenic
1061230743 9:129314393-129314415 ATTGGCTCATGCAATTGTGGGGG + Intergenic
1061928318 9:133818646-133818668 ATTGGCTTATGCAATTATGGAGG - Intronic
1203617405 Un_KI270749v1:80191-80213 ATTGGCTTATGTGATTGTAGAGG + Intergenic
1186140045 X:6562060-6562082 ATTGGTTCATATGATTGTGGAGG - Intergenic
1186682859 X:11894166-11894188 ATTGGCTTATGTCATTGTGAAGG - Intergenic
1187004912 X:15223084-15223106 ATTGGCTCATATGATTGTAGAGG - Intergenic
1188734264 X:33693128-33693150 ATTGGCTCATATGATTATGGAGG + Intergenic
1188914092 X:35888729-35888751 ATTGGCTTACATGATTGTGGAGG + Intergenic
1189087180 X:38037856-38037878 ATTGGCTCATATGATTATGGAGG + Intronic
1189567785 X:42261289-42261311 ATTGGCTCATATGATTATGGTGG + Intergenic
1189879669 X:45477207-45477229 ATTGGCTTACATGATTGTGGAGG - Intergenic
1190023406 X:46900008-46900030 ACTGGCTTATGTGATTGTGGTGG + Intergenic
1190045447 X:47108288-47108310 ATTGGCTCACATGATTGTGGAGG - Intergenic
1190552813 X:51602288-51602310 ACTGGCTTACATAATTGTGGGGG + Intergenic
1191041455 X:56085282-56085304 ATTGGCTTATGTGATTATGGAGG + Intergenic
1191081836 X:56520442-56520464 ATTGGCTCATTTGATTGTGGAGG - Intergenic
1191750039 X:64532738-64532760 ATTGGCTCATATGATTATGGAGG + Intergenic
1191886905 X:65898142-65898164 ATTGGCTCGTACAATTAAGGAGG - Intergenic
1191938376 X:66450797-66450819 ATTGGCTTGTATGATTATGGAGG + Intergenic
1192110226 X:68356385-68356407 ATTGGCTCATGTGATTGTGGAGG - Intronic
1192824326 X:74679225-74679247 ATTGGCTCATGCAATTGTGGGGG - Intergenic
1192824901 X:74684752-74684774 ATTGGCTCACATAGTTGTGGGGG - Intergenic
1193179196 X:78433500-78433522 ATTGGCTTATACAACTGTAGGGG + Intergenic
1193424442 X:81324757-81324779 ACTGGCTTACACAATTGTGGAGG - Intergenic
1193570892 X:83141398-83141420 ATTAGCTTATGTAATTATGGAGG - Intergenic
1193779856 X:85687966-85687988 ATTGGCTTATGTGATTATGGAGG - Intergenic
1194459153 X:94144652-94144674 ATTAGCTTACATAATTATGGAGG - Intergenic
1194463350 X:94200187-94200209 ATTGGCTCGTGTGATTATGGAGG + Intergenic
1194499770 X:94667377-94667399 ATTGGTTTGTATGATTATGGAGG - Intergenic
1194562319 X:95437850-95437872 ATTGGCTTTTATGATTGGGAAGG + Intergenic
1194589311 X:95778166-95778188 ATTGGCTTGCATAATCGTAAGGG - Intergenic
1194870443 X:99124970-99124992 ATTGGCTTGCACAATTATAGAGG - Intergenic
1195200059 X:102540475-102540497 ATTGGCTTATGCAATTGTAGGGG + Intergenic
1195690183 X:107617818-107617840 TTTGGCTTACATCATTGTGGGGG + Intergenic
1196118660 X:112024603-112024625 ATTGACTTGCATGATTATGGGGG - Intronic
1196367149 X:114935951-114935973 ATTGGCTTATACAATTATGGAGG - Intergenic
1196894654 X:120322967-120322989 ATTGGCTCATATGATTATGGAGG + Intergenic
1198058398 X:133018745-133018767 ATTGGCTTATGTGATTATGGAGG + Intergenic
1198488668 X:137115362-137115384 GTTTGCTTGTTTAATTTTGGAGG + Intergenic
1199823652 X:151476107-151476129 ATTGGCTCACATAATTATGGAGG - Intergenic
1199969939 X:152852276-152852298 ATTGGTTTACATGATTGTGGGGG + Intronic
1200368681 X:155697453-155697475 ATTGGCTCGTGTGTTTGTGGAGG - Intergenic
1201621405 Y:15962590-15962612 ATTGGTTCATATGATTGTGGAGG - Intergenic
1202181791 Y:22146003-22146025 CTTGTCTTGTTTCATTGTGGAGG - Intergenic
1202209569 Y:22440399-22440421 CTTGTCTTGTTTCATTGTGGAGG + Intergenic