ID: 1022482061 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:30750839-30750861 |
Sequence | ATTGGCTTGTATAATTGTGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022482061_1022482064 | 18 | Left | 1022482061 | 7:30750839-30750861 | CCTCCACAATTATACAAGCCAAT | No data | ||
Right | 1022482064 | 7:30750880-30750902 | TTCTCTCAGTGTACACAAGCTGG | No data | ||||
1022482061_1022482065 | 19 | Left | 1022482061 | 7:30750839-30750861 | CCTCCACAATTATACAAGCCAAT | No data | ||
Right | 1022482065 | 7:30750881-30750903 | TCTCTCAGTGTACACAAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022482061 | Original CRISPR | ATTGGCTTGTATAATTGTGG AGG (reversed) | Intronic | ||