ID: 1022482062

View in Genome Browser
Species Human (GRCh38)
Location 7:30750842-30750864
Sequence GTAATTGGCTTGTATAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022482062_1022482065 16 Left 1022482062 7:30750842-30750864 CCACAATTATACAAGCCAATTAC 0: 1
1: 0
2: 4
3: 48
4: 288
Right 1022482065 7:30750881-30750903 TCTCTCAGTGTACACAAGCTGGG No data
1022482062_1022482064 15 Left 1022482062 7:30750842-30750864 CCACAATTATACAAGCCAATTAC 0: 1
1: 0
2: 4
3: 48
4: 288
Right 1022482064 7:30750880-30750902 TTCTCTCAGTGTACACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022482062 Original CRISPR GTAATTGGCTTGTATAATTG TGG (reversed) Intronic
900697607 1:4021928-4021950 GGAATTGGCTCATGTAATTGTGG + Intergenic
900817060 1:4856337-4856359 GGAATTGGCTTACATGATTGGGG + Intergenic
900957877 1:5898727-5898749 GGAATTGGCTTGTCTAAATTTGG + Intronic
905233825 1:36531750-36531772 GTAATTGACTTGTGTGATTATGG + Intergenic
909860853 1:80603677-80603699 GTAATTGGCTTACACAATTATGG - Intergenic
910107854 1:83651038-83651060 GTAATAGGATTATAGAATTGCGG + Intergenic
910424367 1:87104333-87104355 ATAATTGTCTTATATAATTCAGG - Intronic
910813857 1:91267003-91267025 GTAAGTGGTATCTATAATTGTGG + Intronic
911594960 1:99788956-99788978 GGAATTGGCTTACATGATTGTGG + Intergenic
912105976 1:106276154-106276176 GTAATTGGCTTAGAAAACTGTGG + Intergenic
912143041 1:106755136-106755158 GGAATTGGCTTATGCAATTGTGG - Intergenic
912672496 1:111643860-111643882 GGAATTGGCTTATGTGATTGTGG + Intronic
912896106 1:113591655-113591677 GTACCTGCTTTGTATAATTGTGG - Intronic
913096890 1:115526849-115526871 GGAATTGGCTTATGCAATTGTGG + Intergenic
913097223 1:115530139-115530161 GGAATTGGCTTACATAATTGTGG + Intergenic
914220228 1:145674772-145674794 GGAATTGGCTTGTATGATTATGG - Intronic
914314122 1:146493335-146493357 GGAATTGGCTCATATAATTGTGG - Intergenic
914472806 1:147997634-147997656 GGAATTGGCTTGTGTGATTATGG - Intergenic
914500226 1:148240047-148240069 GGAATTGGCTCATATAATTGTGG + Intergenic
914982592 1:152428095-152428117 GGAATTGGCTCATACAATTGTGG + Intergenic
916364352 1:164007118-164007140 GTGATTGTCTTGTCTATTTGAGG - Intergenic
916400074 1:164437763-164437785 GAAATTGGCTTGTGTGATTATGG - Intergenic
917524119 1:175772116-175772138 GTAGCTGGCTTATGTAATTGTGG - Intergenic
918523576 1:185441396-185441418 GGAATTGGCTTATGTGATTGTGG + Intergenic
919310072 1:195895867-195895889 GCAATTGGCTTACATAATTATGG + Intergenic
922556322 1:226535194-226535216 GGAATTGGCTGGCACAATTGTGG + Intergenic
1063417793 10:5888517-5888539 GCAATTGGCTTGTGTGATGGTGG + Intronic
1063706957 10:8440015-8440037 GGAATTGGCTTATACAATTGTGG + Intergenic
1064969352 10:21048615-21048637 GGAATTGGCTCACATAATTGTGG + Intronic
1065386391 10:25137928-25137950 GGAACTGGCTTATATAATTATGG + Intergenic
1065606621 10:27424723-27424745 GGAATTGGCTGTTAGAATTGTGG - Intergenic
1069079026 10:64068325-64068347 GTCATTGGCTTATACAATTGTGG - Intergenic
1069572093 10:69500444-69500466 GGAATTGGCTTGTGTAATTATGG + Intronic
1070274655 10:74994197-74994219 TTAATTTTTTTGTATAATTGTGG + Intronic
1070588576 10:77785137-77785159 GGAATTGGCTTGCAAGATTGTGG - Intergenic
1071207549 10:83298766-83298788 GTACTTGTTTTGTATAATTTTGG - Intergenic
1071252076 10:83829037-83829059 GGAATTGGCTTGCATGATTATGG - Intergenic
1074935604 10:118177438-118177460 GGAATTGGCTTATGTGATTGTGG + Intergenic
1075047023 10:119154352-119154374 GGAATTGGCTTACACAATTGTGG - Intronic
1076231774 10:128825662-128825684 GCAATTTGCTTTTATAATTGCGG + Intergenic
1078053139 11:7984748-7984770 GGAATTGGCTTTTGTAATTATGG - Intronic
1078646356 11:13144269-13144291 GGAATTGGCTTATAGAATTATGG + Intergenic
1079146251 11:17854643-17854665 GGAAATGGCTTGTACAACTGTGG - Intronic
1080163283 11:29205063-29205085 GAAATTGGCTTGTGCAATTAGGG - Intergenic
1080380547 11:31767439-31767461 GTAATTTGCTTTTATATGTGGGG - Intronic
1081375653 11:42355080-42355102 TGAATTGGCTTATGTAATTGTGG - Intergenic
1081415765 11:42813316-42813338 GGAATTGGTTTGTGTGATTGTGG - Intergenic
1082068722 11:47921428-47921450 CTACTTGGCTAGTATGATTGGGG - Intergenic
1082078297 11:47992095-47992117 GTAATTGACTTGTCCAATTCAGG + Intronic
1083774270 11:64885932-64885954 GTACTTGACTTGTTTAATTGGGG + Intronic
1085081882 11:73641716-73641738 GGGATTGGCTTATATGATTGAGG + Intergenic
1085446056 11:76601762-76601784 GGAATTGGCTTATATAGTTGTGG + Intergenic
1086170947 11:83835972-83835994 GGAATTGGCTTATGTAGTTGTGG + Intronic
1086766514 11:90702474-90702496 GAAATTGGCTTATATGATTGTGG - Intergenic
1089519699 11:119055744-119055766 GAAATTGTCTTGAATAAGTGAGG - Exonic
1092324294 12:7512860-7512882 GGAATTGGCTTGCATAATTTTGG - Intergenic
1093518069 12:20014337-20014359 ATACTTGTCTTGTATAATTTGGG + Intergenic
1093975920 12:25422180-25422202 GTAATTGGCTCACATAATTATGG + Intronic
1094277498 12:28694802-28694824 GGAATTGGCTTGTGCAATTCTGG + Intergenic
1096663478 12:53145472-53145494 GGAATTGGCTTGCACAATTATGG + Intergenic
1097302206 12:58030828-58030850 GAAATTCGCTTGTGAAATTGTGG - Intergenic
1099042607 12:77675278-77675300 GGAATTGGCTTACATGATTGTGG + Intergenic
1100031081 12:90191892-90191914 GGAATTGGCTTATATAATTACGG - Intergenic
1100201582 12:92304543-92304565 GTAATTAGCCTGAATACTTGAGG - Intergenic
1100579288 12:95923251-95923273 GTAATTGGCTCATATAATTATGG - Intronic
1100657394 12:96661422-96661444 GAATTTGGCTTATATGATTGTGG + Intronic
1100847375 12:98673883-98673905 GTATTTGGCTTGGAAAAATGAGG + Intronic
1100869935 12:98899662-98899684 GGAATTGGCTTACATGATTGTGG - Intronic
1100957641 12:99926641-99926663 GGAATTGGCTTGTGTGATTATGG - Intronic
1101403557 12:104408995-104409017 GAAATTGGCTTTCACAATTGTGG + Intergenic
1102835135 12:116050042-116050064 GTTATTGGGTTGTTAAATTGAGG - Intronic
1104132819 12:125910786-125910808 GGAATTGGCTTATACAATTATGG + Intergenic
1104330246 12:127837888-127837910 AGAATTGGCTTGCATATTTGTGG - Intergenic
1106644306 13:31616300-31616322 GTAATTTGGGTGAATAATTGAGG + Intergenic
1106772692 13:32977214-32977236 GGAATTGGCTCGCATAATTATGG - Intergenic
1106875112 13:34063578-34063600 GAAATTGGCTTGCATGATTATGG + Intergenic
1107650349 13:42538629-42538651 AAAATTGGCTTATGTAATTGTGG - Intergenic
1107747761 13:43529863-43529885 GTTATTGGCTTATATAATTGGGG - Intronic
1108087592 13:46810254-46810276 TTCATAGGCTTGTATATTTGAGG + Intergenic
1108424903 13:50289823-50289845 GGAGTTGGCTTATATGATTGTGG + Intronic
1108708730 13:53013232-53013254 GGAATTGGCTCACATAATTGTGG + Intergenic
1108747865 13:53413528-53413550 GGAATTGGCTTATGTGATTGTGG - Intergenic
1109919490 13:69036903-69036925 GAAACTGACTCGTATAATTGTGG - Intergenic
1111089301 13:83421939-83421961 GGAATTGGCTTGTGCAATTATGG - Intergenic
1114802636 14:25795502-25795524 TTAATTGGCTTTTATCTTTGAGG + Intergenic
1115714190 14:36084673-36084695 GGAATTGGCTTGCATGATAGTGG - Intergenic
1116530405 14:45965864-45965886 GGAATTGGCTCATACAATTGTGG + Intergenic
1116774339 14:49162836-49162858 GTATTTGTCTTTTATATTTGTGG - Intergenic
1116931058 14:50691366-50691388 GTAATTGTCTGTTATAATTTGGG + Intergenic
1117295115 14:54371954-54371976 GGAATTGGCTAATATAATTATGG - Intergenic
1117387513 14:55230852-55230874 GGAATTGGCTTACACAATTGTGG - Intergenic
1118474754 14:66106217-66106239 GGAATTGGCTTATACAATTATGG + Intergenic
1120334861 14:83142074-83142096 GGAATTGGGTTTTATAATTATGG + Intergenic
1120582619 14:86271852-86271874 GAAATTGGCTCACATAATTGTGG + Intergenic
1202870983 14_GL000225v1_random:163472-163494 ATAATTTGCTTGTATATATGAGG + Intergenic
1125336286 15:38629857-38629879 GTAATTGCCTGGCATATTTGGGG + Intergenic
1126386026 15:48094228-48094250 GAAATTGGCTTGTGCAATTATGG - Intergenic
1127112592 15:55690715-55690737 GTTATTTGCTTTTATAATTTGGG - Intronic
1128773274 15:70299968-70299990 GGAATTGGCTTATATAATCACGG + Intergenic
1128854825 15:71001170-71001192 GTAATTGATTTTTATATTTGAGG + Intronic
1130838366 15:87673803-87673825 GGAATTGACTTACATAATTGTGG + Intergenic
1130928236 15:88400969-88400991 GGAATTGGTTTATGTAATTGTGG - Intergenic
1131037716 15:89234944-89234966 TAAATTGGCTCCTATAATTGAGG - Intergenic
1131662588 15:94534462-94534484 GGAATTGGCTTACATAATTGTGG + Intergenic
1131922697 15:97347292-97347314 GGAATTGGCTTACATAATTATGG + Intergenic
1131963677 15:97815045-97815067 GAATTTGGTTTATATAATTGTGG - Intergenic
1132423195 15:101691999-101692021 GGAATTGGCTTGTGTGATTATGG - Intronic
1133919049 16:10135641-10135663 GGAATTGGCTTACATGATTGTGG + Intronic
1137902313 16:52282002-52282024 GGAATTGGCTCATACAATTGTGG - Intergenic
1145831262 17:27918175-27918197 GTAATTGGCTTACATGATTGAGG + Intergenic
1148569275 17:48654823-48654845 GGAATTGGCTTGCATGATTATGG + Intergenic
1149109658 17:53012842-53012864 GTACTTGGCTTTTATACTGGAGG + Intergenic
1149939564 17:60849119-60849141 GGAATTGGTTTGTGTAATTTGGG + Intronic
1154250582 18:12740977-12740999 GGAATTGGCTTGTGTGATTATGG + Intergenic
1154952363 18:21222748-21222770 GGTATTGGCTTATATGATTGTGG + Intergenic
1155302015 18:24438949-24438971 GAAATTGGCTTATACAGTTGTGG + Intronic
1155387937 18:25301401-25301423 GTAATAGGTGTGTATATTTGTGG - Intronic
1155580951 18:27305800-27305822 GGAATTGGCTTATGTGATTGTGG - Intergenic
1156598862 18:38579967-38579989 GGAATTGGCTTATATAATTGTGG - Intergenic
1157971183 18:52270879-52270901 TTAATTGTCTGGTATAATTTGGG - Intergenic
1158482822 18:57836772-57836794 GGAATTGGCTTATGTGATTGTGG - Intergenic
1158914647 18:62110740-62110762 GAAATTGGCTTATGTGATTGTGG - Intronic
1160471857 18:79142717-79142739 CTTATTGGCTTGTATAATTGAGG + Intronic
1165505427 19:36224988-36225010 GTAATTAGATTATATAATTGAGG + Intronic
1166637602 19:44464723-44464745 GGAATTGGCTTATATGATTATGG + Intergenic
925005545 2:440594-440616 GTAATTGGCTTCTGCAATCGTGG - Intergenic
925729966 2:6912726-6912748 GGAATTGGCTTACATAATTATGG + Intergenic
925770610 2:7279051-7279073 ATAATTGGCTTGTATCATCATGG - Intergenic
926985120 2:18613968-18613990 GGAATTGGCTTATGTGATTGTGG - Intergenic
927285103 2:21349183-21349205 AGAATTGGCTTTTTTAATTGTGG + Intergenic
927327512 2:21822315-21822337 ATAATTAGCTCATATAATTGAGG + Intergenic
929226876 2:39520198-39520220 GGAATTGGCTCATGTAATTGTGG - Intergenic
930457451 2:51623603-51623625 GGAATTGGCTTGAGCAATTGTGG + Intergenic
930937245 2:56969175-56969197 GGAATTGGCTTATGTAATTACGG + Intergenic
931071006 2:58650058-58650080 ACAAATGGCTTGTATACTTGTGG - Intergenic
931610508 2:64094374-64094396 GAAATTGTTTTGTATAACTGAGG - Exonic
931627095 2:64266609-64266631 AGAATTGGCTTGTGTGATTGTGG + Intergenic
933541992 2:83656800-83656822 CTAATTTGCTTGTGTAATTTGGG - Intergenic
933605388 2:84377034-84377056 TTTATTGTCTTTTATAATTGTGG - Intergenic
937660100 2:124420809-124420831 GGAATTGGCTTATACAATTGTGG - Intronic
937994952 2:127686249-127686271 GGAATTGGCTTGTATGACTATGG - Intergenic
938077942 2:128350662-128350684 GGAATTGGCTCATACAATTGTGG + Intergenic
938120600 2:128630609-128630631 GGAATTGGCTTGCACAATTATGG - Intergenic
939395238 2:141620832-141620854 TTAAGTGGCTTGTATCATTCAGG + Intronic
939425405 2:142030054-142030076 GCAAGTTGCTTGTATATTTGTGG + Intronic
939732498 2:145801936-145801958 GTAATTGACTGATATGATTGTGG + Intergenic
939768003 2:146277497-146277519 GGAACTGGCTTATGTAATTGTGG + Intergenic
939985323 2:148824531-148824553 GTAATTGGCTTATATGATTATGG - Intergenic
942026902 2:171919762-171919784 GTGATTTGCTTGCAGAATTGAGG - Intronic
942335251 2:174877250-174877272 TTAATTGTCTTTTATAATTAAGG + Intronic
944444669 2:199777326-199777348 GAAATTAGCTTGCAGAATTGTGG + Intronic
944653825 2:201858300-201858322 GTAAGAGGGTTGTATAATTTTGG + Intronic
945863179 2:215147152-215147174 GGAACTGGCTTATGTAATTGTGG - Intergenic
946655488 2:221941418-221941440 GCAATTGGCTTACATGATTGTGG - Intergenic
947680325 2:232025599-232025621 AAAATTGGGTTGTAGAATTGAGG + Intronic
947946929 2:234112469-234112491 GAAATTGGCTTATGTGATTGTGG + Intergenic
1169732186 20:8798402-8798424 GTAATTGGCTTATGCAATTTTGG + Intronic
1170428240 20:16256659-16256681 GGAATTGGCTTGTGCAATTGTGG - Intergenic
1175356655 20:58374278-58374300 GAAATTGTCTTGTGAAATTGTGG - Intergenic
1176587443 21:8602006-8602028 GAAATTGGCTTATGTGATTGTGG + Intergenic
1177335510 21:19720712-19720734 GGAATTGGCTTGTGTGATTACGG + Intergenic
1177531804 21:22370398-22370420 ATAATTAGCTTGTATAATCCTGG - Intergenic
1177600954 21:23313066-23313088 ATAATTCCCTTGTATAATTCCGG - Intergenic
1179056037 21:37935306-37935328 GAAATTGGCTTATCTAATTGTGG - Intergenic
1179140962 21:38724844-38724866 GGAATTGGATCATATAATTGTGG + Intergenic
1179310376 21:40190249-40190271 ATAAGTGGCTTGTGGAATTGGGG - Intronic
1180270274 22:10579003-10579025 GAAATTGGCTTATGTGATTGTGG + Intergenic
1181395877 22:22621283-22621305 GGAATTGGCTTACATAATTGTGG - Intergenic
1182125781 22:27815008-27815030 GTAAATAGTTTTTATAATTGAGG - Intergenic
1182871967 22:33655550-33655572 GGAATTGGCTTGCATGATTATGG - Intronic
1184541498 22:45128636-45128658 GGAATTGGCTCCCATAATTGTGG + Intergenic
949139916 3:619747-619769 GAAATTGGCTTATGTGATTGTGG - Intergenic
949336670 3:2982392-2982414 ATTATTGGCTTATATAACTGGGG + Intronic
951062727 3:18228603-18228625 GAAATTGGCTTATGTAATTGAGG + Intronic
951223503 3:20094467-20094489 GTAATTGCATTTTACAATTGAGG - Intronic
952144388 3:30516047-30516069 GGAATTGTCTTTTATGATTGTGG - Intergenic
952269854 3:31819981-31820003 GGAGTTGGCTTATATGATTGTGG - Intronic
953113283 3:39965579-39965601 GGAATTGGCTTATGTAATTTTGG + Intronic
953233627 3:41086483-41086505 ATAATTGGCTTATGTGATTGTGG - Intergenic
953609037 3:44432350-44432372 GGAATTGGCTTATAGAATTAAGG + Intergenic
953712717 3:45288257-45288279 GGAATTGGCTTGTGAGATTGTGG + Intergenic
953895765 3:46798943-46798965 GGAGTTGGCTTGTACAATTATGG - Intronic
955255876 3:57330861-57330883 GGAATTGGCTGGTGTGATTGTGG - Intronic
955368216 3:58329607-58329629 GTATTTAACTTGTATGATTGGGG - Intergenic
956292635 3:67677469-67677491 GGAATTGGCTTGCATGATTACGG - Intergenic
956350572 3:68330744-68330766 TTATTTGGTTTGTATAATTTTGG + Intronic
957261977 3:77913596-77913618 GGAATTGGCTCGTGGAATTGTGG + Intergenic
958065058 3:88534161-88534183 GGAATTGGCTTGCATGATTAGGG - Intergenic
958614329 3:96471762-96471784 GAAAATGGCTGGTATATTTGAGG - Intergenic
959135349 3:102411928-102411950 GAAATTGGCTTATGCAATTGTGG + Intronic
959446990 3:106452866-106452888 GTAATTGGCTCATATAATTATGG + Intergenic
959832900 3:110885187-110885209 GTTTTTGGCTTGTGTAATTCTGG + Intergenic
960613354 3:119574751-119574773 GGGATTGGCTTATACAATTGTGG + Intergenic
963159034 3:142131351-142131373 AAAATTGTCTTGTATGATTGTGG - Intronic
963464356 3:145659549-145659571 GGAATTGGCTTACATGATTGTGG - Intergenic
963537887 3:146550987-146551009 TTGACTGACTTGTATAATTGAGG + Intergenic
963568939 3:146967344-146967366 GGAATTGGCTTATGTAATTTTGG - Intergenic
964747130 3:160022997-160023019 GGAATTGGCCTGTGTGATTGTGG - Intronic
965714339 3:171586624-171586646 GGAATTGGCTTATGTGATTGTGG + Intergenic
965735660 3:171817687-171817709 GGAATTCGCTTGCACAATTGTGG + Intergenic
967662734 3:192133090-192133112 GGAATTGGCTCATACAATTGTGG + Intergenic
968839391 4:2991104-2991126 GGAATTGGCTTACATAATTGTGG + Intronic
969135282 4:5024426-5024448 GGAATTGGCTTGCATGATTGTGG - Intergenic
970221471 4:13816428-13816450 GAAATTGGCTTATGCAATTGTGG + Intergenic
971228082 4:24773362-24773384 GTAATTGGCTTACATGATTATGG - Intergenic
971511976 4:27437794-27437816 GAAATTGGCTTGTGCAATTGTGG + Intergenic
973098334 4:46229562-46229584 GGAATTGGCTTGTGTGATTAGGG - Intergenic
974183022 4:58407484-58407506 GAAATTGGCTTATGTAATTGTGG - Intergenic
974524792 4:63035797-63035819 CTAATTGGCTAGTATGCTTGCGG + Intergenic
975468756 4:74739243-74739265 GTGATTGGCAAGTATAAGTGAGG - Intergenic
975903070 4:79176383-79176405 GGAATTGGCTCATGTAATTGTGG + Intergenic
976880815 4:89922855-89922877 GTAAATTGCCTGCATAATTGAGG - Intronic
976952806 4:90853921-90853943 TTTATTGGCTTTTATAATTGGGG - Intronic
978223100 4:106301100-106301122 GGAATTGGTTTGCATGATTGTGG - Intronic
978814935 4:112893476-112893498 TTAATTTGCTAATATAATTGTGG + Intronic
979302611 4:119104269-119104291 ATAATTGGGTTTTATAAGTGAGG + Intergenic
979505456 4:121490789-121490811 TTAATTGGCTTGTCTCATTAAGG + Intergenic
980252190 4:130331864-130331886 GGAATTGGATTGCATGATTGTGG + Intergenic
980572667 4:134641244-134641266 GTAATTGGCTTATATGATTATGG + Intergenic
981067622 4:140501725-140501747 GTAATTGGCTTGTGTGGTAGAGG - Intergenic
981407450 4:144387523-144387545 GGAATTGGCTTGTGCAATTATGG - Intergenic
982921742 4:161283323-161283345 TGAATTGGCTTATATAATTTTGG + Intergenic
983037699 4:162887379-162887401 GGAATTGGCTTATGTCATTGTGG - Intergenic
983127750 4:163975131-163975153 GAAATTGGCTTATGTAATTATGG - Intronic
983361079 4:166724148-166724170 ACAAATGGCTAGTATAATTGTGG - Intergenic
984111469 4:175621647-175621669 GAAATTGGCTTGTGTAAATGAGG - Intergenic
984239486 4:177200494-177200516 GGAATTGGCTTATGTGATTGTGG + Intergenic
985098030 4:186432071-186432093 GTATGTGGCTTGAATAAGTGGGG + Intronic
985233820 4:187851081-187851103 GGAATTGGCTTACATGATTGTGG + Intergenic
985278880 4:188267934-188267956 GAAATTGGCTTACATAACTGTGG + Intergenic
986168267 5:5294351-5294373 GGAATTGGCTTATGTGATTGTGG + Intronic
986521726 5:8626421-8626443 GTAATTGGCTTATATGTTTATGG - Intergenic
987046756 5:14116001-14116023 GGAATTGGCTCGCATAATTATGG + Intergenic
987136961 5:14909178-14909200 GGAATTGGCTTGTGTGATTATGG + Intergenic
987856504 5:23425622-23425644 GGAATTGGCTCATATAATTATGG + Intergenic
992932589 5:81664735-81664757 TAAATTGGCTTGTTTAATTGGGG + Intronic
994651934 5:102539880-102539902 GGAATTGGCTTACATAATTATGG - Intergenic
994655584 5:102589098-102589120 GTAATTGGCTTATATGATCGTGG - Intergenic
994804475 5:104426418-104426440 GGAATTGGCTTATACAATTATGG - Intergenic
994873522 5:105384016-105384038 ATAATTGGCTCATATGATTGCGG + Intergenic
995209524 5:109521460-109521482 AGAATTGGCTTGTATGATTATGG + Intergenic
995251893 5:110002891-110002913 GGAATTGGCTTGCATAATTATGG + Intergenic
996154779 5:120084695-120084717 GTAATTGGCTCACATAATTATGG - Intergenic
996265439 5:121534397-121534419 GGAATTGGCTTATATGATTATGG + Intergenic
996511240 5:124318621-124318643 GAAATTGGCTTATATGATTATGG + Intergenic
997795378 5:136804503-136804525 GGAATTGGCTTACATAATTTTGG + Intergenic
998480118 5:142456129-142456151 GGAATTGGCTTACATAATTGTGG + Intergenic
998494735 5:142578264-142578286 GCAATTGGCTTGCATGATTGTGG + Intergenic
1000733310 5:164864379-164864401 GGAATTGGCTTATGTAATCGTGG - Intergenic
1000922112 5:167150627-167150649 TTATTTGTCTTTTATAATTGAGG + Intergenic
1001887863 5:175311778-175311800 GGAATTGGCTTATACCATTGTGG + Intergenic
1001905923 5:175473133-175473155 GAAATTGGCTCACATAATTGTGG - Intergenic
1002354918 5:178619345-178619367 AAAATTGGCCTGTATAATAGTGG - Intronic
1002403291 5:179006608-179006630 GGAATTGGCTTGTGTGATTATGG + Intergenic
1002671948 5:180874587-180874609 CTAATTGGCTTTTATGAATGAGG - Intergenic
1003721714 6:8710608-8710630 GGAATTGGCTCATATGATTGTGG + Intergenic
1004039786 6:11964059-11964081 AAAATTGGCTTGCATAATTATGG - Intergenic
1004192602 6:13477275-13477297 GGAATTGGCTCGCACAATTGTGG + Intronic
1004471086 6:15929704-15929726 GGAATTGGCTTATGTGATTGTGG + Intergenic
1004728647 6:18335824-18335846 TTAATTGGCAGGTATAATTGTGG + Intergenic
1005564241 6:27073534-27073556 GAAATTGGCTTGCATGATTATGG - Intergenic
1008433597 6:51449285-51449307 GTCATAGGCTTGTATAATTATGG - Intergenic
1010003042 6:70967416-70967438 GGAATTGGCTTATATGATTATGG - Intergenic
1010013324 6:71075118-71075140 ATAATAGGCTTATATAATTATGG - Intergenic
1010501768 6:76609853-76609875 GTAATTGGGATGAATAACTGTGG - Intergenic
1011382118 6:86753228-86753250 GGAATTGGCTTATATGATTATGG - Intergenic
1012626371 6:101408425-101408447 GTAATTGGCTTACATGATTATGG + Intronic
1012648849 6:101725487-101725509 GTATTTGCCTTGTATATCTGTGG + Intronic
1014348837 6:120313118-120313140 GGAATTGGCTTATGCAATTGTGG - Intergenic
1015588948 6:134804251-134804273 TTAATTGTCTTGTAGAAATGGGG - Intergenic
1016808194 6:148234409-148234431 GTATTTGGCTTCTATCACTGAGG + Intergenic
1016862033 6:148730644-148730666 GTAATTGACTTCTTCAATTGTGG + Intergenic
1020604683 7:10321663-10321685 ATAATTAGCTTGCATAATTTTGG + Intergenic
1021627434 7:22608208-22608230 GGAATTGGCTTGTGTGATTGTGG - Intronic
1021814704 7:24435834-24435856 GTAATTGGCTTACACAATTGTGG - Intergenic
1022482062 7:30750842-30750864 GTAATTGGCTTGTATAATTGTGG - Intronic
1022861090 7:34367729-34367751 GGAATTGGCTTATATGATTATGG + Intergenic
1023130699 7:37000085-37000107 GTTCTTGGCTTGTTTTATTGTGG - Intronic
1023286170 7:38622769-38622791 GAGAATGGCTTGTATAATTTGGG + Intronic
1023901233 7:44481279-44481301 GAAATTGGCTTACATGATTGTGG + Intronic
1024064850 7:45724073-45724095 GGAATTGGCTTACATGATTGTGG + Intergenic
1028246200 7:88480594-88480616 GGAATTGGCTCGCATGATTGTGG - Intergenic
1028694687 7:93695047-93695069 GGTTTTGGCTTGTAAAATTGGGG - Intronic
1028769351 7:94598601-94598623 GTAATTGTATTGTATATTTCAGG + Intronic
1028807741 7:95048441-95048463 GTAATTGGCTTGAGTAGTTAAGG + Intronic
1029136606 7:98377109-98377131 GAAATTGGCTTCCATGATTGTGG - Intronic
1029578804 7:101421149-101421171 GGAATTGGCTTGTATGATTATGG + Intronic
1031705209 7:124972518-124972540 GGAATTGGCTCATGTAATTGTGG + Intergenic
1034070633 7:148181216-148181238 GGAATTGGCTCATGTAATTGTGG - Intronic
1035834119 8:2729729-2729751 GTAAATGGCTGGTTTATTTGGGG + Intergenic
1038734195 8:30154714-30154736 GGAATTGGCTTACATGATTGTGG - Intronic
1038830836 8:31058170-31058192 TTAATTGACTTGTATAATTCTGG - Intronic
1038831657 8:31068552-31068574 GTATTTGGCTTCTAGAGTTGGGG + Intronic
1039124255 8:34183365-34183387 GGAATTGGCTTATGTGATTGTGG + Intergenic
1039626210 8:39057484-39057506 TGAATTGGCTTGTGTGATTGTGG + Intronic
1041043964 8:53874458-53874480 GGAATTGGCTCATGTAATTGTGG + Intronic
1041125230 8:54630939-54630961 TCAATTGGTTTGAATAATTGTGG + Intergenic
1041803435 8:61824290-61824312 GTAATTGGCTTATATGATTGTGG + Intergenic
1042538231 8:69880746-69880768 GGAACTGGCTTACATAATTGTGG - Intergenic
1043318049 8:78945509-78945531 GAAATTGGTTTATATGATTGTGG + Intergenic
1046436826 8:114201423-114201445 GTAATTTTCTTGTCTAATTATGG - Intergenic
1046472858 8:114701428-114701450 ATAATTGGCTTACATGATTGTGG - Intergenic
1046797146 8:118385509-118385531 GAAATTGGCCTGTGTAATTATGG - Intronic
1047828719 8:128608410-128608432 GGAATTGGCTTGCATGATTATGG - Intergenic
1048016630 8:130503008-130503030 GGAATTGGTTCATATAATTGTGG + Intergenic
1048123254 8:131605393-131605415 GAAATTGGCTTGCATGATTATGG + Intergenic
1048550493 8:135428894-135428916 GGAATTGGCTCGTGCAATTGTGG - Intergenic
1050070078 9:1801181-1801203 GAAATTGGCTTGTGCAATTATGG - Intergenic
1050172629 9:2838381-2838403 GTGTTTGGCTGTTATAATTGGGG - Intronic
1050786378 9:9407872-9407894 GTAATTATCTTGTAAAATTTTGG + Intronic
1051220493 9:14843448-14843470 GGAATTGGCTTATGTAATTGCGG - Intronic
1051345057 9:16143974-16143996 GGAATTGGCTCATACAATTGTGG + Intergenic
1052468436 9:28860521-28860543 GTAATTGGCTCACATAATTGTGG - Intergenic
1052558113 9:30047025-30047047 GGAATTGGCTCATATAATTATGG + Intergenic
1052670933 9:31556326-31556348 GTAATTGGCTTACGCAATTGTGG + Intergenic
1052683298 9:31722058-31722080 GTGATTGGCTAGAATACTTGAGG - Intergenic
1053611129 9:39714186-39714208 GTAATTAGCTTATGTAATTCTGG - Intergenic
1054087126 9:60756972-60756994 GTAATTAGCTTATGTAATTCTGG + Intergenic
1054242391 9:62628209-62628231 GTAATTAGCTTATGTAATTCTGG + Intergenic
1054556517 9:66662727-66662749 GTAATTAGCTTATGTAATTCTGG + Intergenic
1055294251 9:74818057-74818079 GGAATTGGGTTGTACAATTGAGG - Intronic
1055907458 9:81310891-81310913 GTATTTGTCTTGTGTAATTTGGG + Intergenic
1056537973 9:87547636-87547658 GGAATTGGCTTCTGTGATTGTGG + Intronic
1056731351 9:89169055-89169077 GGAATTGGCTTGCATAATTTTGG - Intronic
1057667777 9:97059639-97059661 GGAATTGGTTTATGTAATTGTGG - Intergenic
1060040948 9:120300447-120300469 GTAATTTTCTTGTAAAATTGTGG + Intergenic
1203733468 Un_GL000216v2:113114-113136 ATAATTTGCTTGTATATATGAGG - Intergenic
1188850635 X:35127751-35127773 GGAATTAGCTTGAATAATTTTGG - Intergenic
1188914091 X:35888726-35888748 GGAATTGGCTTACATGATTGTGG + Intergenic
1190552810 X:51602285-51602307 GTGACTGGCTTACATAATTGTGG + Intergenic
1191886906 X:65898145-65898167 ATAATTGGCTCGTACAATTAAGG - Intergenic
1191938375 X:66450794-66450816 GGAATTGGCTTGTATGATTATGG + Intergenic
1193487805 X:82108072-82108094 AAAATTGGCTAGGATAATTGAGG - Intergenic
1194626905 X:96235823-96235845 GGAATTGGCTTGTGTGATTACGG - Intergenic
1196226445 X:113172842-113172864 GGAATTGGCTTACATAATTATGG - Intergenic
1196367150 X:114935954-114935976 GCAATTGGCTTATACAATTATGG - Intergenic
1197338917 X:125242488-125242510 GTAAATGGCTTATATTTTTGAGG - Intergenic
1197485209 X:127040852-127040874 GTTATTTGCTTGAACAATTGAGG + Intergenic
1198381534 X:136088381-136088403 GAAATTGGCTTATGCAATTGTGG - Intergenic
1201607109 Y:15799251-15799273 GTAATTTGCTTATATAATAATGG - Intergenic
1202627539 Y:56875303-56875325 ATAATTTGCTTGTATATATGAGG + Intergenic