ID: 1022482063

View in Genome Browser
Species Human (GRCh38)
Location 7:30750857-30750879
Sequence TCAGATCTATTTTAAGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 565}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022482063_1022482065 1 Left 1022482063 7:30750857-30750879 CCAATTACTTAAAATAGATCTGA 0: 1
1: 0
2: 3
3: 50
4: 565
Right 1022482065 7:30750881-30750903 TCTCTCAGTGTACACAAGCTGGG No data
1022482063_1022482064 0 Left 1022482063 7:30750857-30750879 CCAATTACTTAAAATAGATCTGA 0: 1
1: 0
2: 3
3: 50
4: 565
Right 1022482064 7:30750880-30750902 TTCTCTCAGTGTACACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022482063 Original CRISPR TCAGATCTATTTTAAGTAAT TGG (reversed) Intronic
900867151 1:5276653-5276675 AGAGATTTATTTTAAATAATCGG - Intergenic
901193649 1:7427661-7427683 TCAGAAATATTTTTAGCAATGGG + Intronic
901246253 1:7733788-7733810 TTAGTTATATTTTAAATAATAGG + Intronic
902536793 1:17123622-17123644 AGAGATTTATTTTAAGAAATTGG + Intergenic
904197899 1:28799731-28799753 AAAGATTTATTTTAAGCAATTGG + Intergenic
904507515 1:30970647-30970669 TGAGATCTCTTTTGAGTTATTGG - Intronic
905074251 1:35255854-35255876 AGAGATTTATTTTAAGGAATTGG + Intergenic
905233823 1:36531560-36531582 AAAGATTTATTATAAGTAATTGG - Intergenic
905609016 1:39332329-39332351 ACAAATCGATTTTAAGTTATTGG - Intronic
905659459 1:39710229-39710251 AGAGATTTATTTTAAGGAATTGG + Intronic
906900093 1:49825822-49825844 GAAGATTTATTTTAAGGAATTGG - Intronic
907255499 1:53175665-53175687 AAAGGTCTATTTTAAGGAATTGG - Intergenic
907593634 1:55699831-55699853 TCAGATTTATTTTAAGGAATTGG + Intergenic
908604736 1:65784020-65784042 TCAGATTTTTTTTAAGTATAAGG - Intergenic
908953952 1:69598401-69598423 AGAGATTTATTTTAAGAAATTGG + Intronic
908960666 1:69693386-69693408 AGAGATTTATTTTAAGAAATTGG + Intronic
909308788 1:74118716-74118738 AGAGATTTATTTTAAGGAATTGG + Intronic
910090191 1:83453046-83453068 TCATATCTATTTTAATTAAAAGG + Intergenic
910241193 1:85087862-85087884 TCAGATCTATGTGAACTAACAGG + Intronic
910732091 1:90408841-90408863 TCAGATCATTCTTAAGCAATCGG - Intergenic
911558446 1:99374761-99374783 TACCATCTATTTTAAGGAATTGG - Intergenic
912072640 1:105831535-105831557 TAAGATTTATTTTAAGGAATTGG + Intergenic
912105975 1:106276139-106276161 ACAGATTTATTATAAGTAATTGG + Intergenic
912984174 1:114410031-114410053 AGAGATTTATTTTAAGGAATTGG - Intronic
913484548 1:119321978-119322000 AGAGATTTATTATAAGTAATTGG + Intergenic
913696202 1:121328206-121328228 ACATATCTATTTTATGTATTTGG - Intronic
914141362 1:144951852-144951874 ACATATCTATTTTATGTATTTGG + Intronic
914228570 1:145743475-145743497 TGAGATTTATTATAAGGAATTGG - Exonic
916294741 1:163205378-163205400 TCAAATTTATTTTACGTAGTAGG - Intronic
916459134 1:165004555-165004577 TGAGATTTATTATAAGGAATTGG + Intergenic
917382669 1:174431120-174431142 ACAGACCCATTTTAAATAATGGG - Intronic
917526603 1:175793775-175793797 AGAGATTTATTTTAAGAAATTGG + Intergenic
918389732 1:184046348-184046370 TGAGATTGATTTTAAGGAATTGG - Intergenic
918933211 1:190884398-190884420 TCAGATTTATTTTAATTTTTGGG - Intergenic
920483525 1:206346574-206346596 ACATATCTATTTTATGTATTTGG - Intronic
920979923 1:210823702-210823724 TCATCTCTATTTTAAATATTTGG + Intronic
921432438 1:215081120-215081142 ACAGATTTATTTTAAGGAATTGG - Intronic
922065300 1:222131937-222131959 TCAGATCTAGTCTATCTAATAGG - Intergenic
922135223 1:222818538-222818560 AGAGATTTATTTTAAGAAATTGG + Intergenic
923134319 1:231104750-231104772 AGAGATTTATTTTAAGAAATTGG + Intergenic
923191397 1:231624010-231624032 AAAGATTTATTTTAAGGAATTGG + Intronic
923957073 1:239034298-239034320 AGAGATTTATTTTAAGAAATTGG + Intergenic
924160067 1:241221859-241221881 AAAGATTTATTTTAAGGAATTGG - Intronic
924258576 1:242206895-242206917 TGAGATTTATCTTAAGGAATTGG + Intronic
924274934 1:242376206-242376228 TCAGTTCCATTTTGAGGAATGGG - Intronic
1062845237 10:698299-698321 TCAGATTTTTTTTAAACAATAGG + Intergenic
1063790641 10:9442321-9442343 ACAGATTTATTTTAAGGGATTGG - Intergenic
1064129331 10:12694999-12695021 AGAGATTTATTTTAAGGAATTGG - Intronic
1064468466 10:15610474-15610496 TCAGACCTATTTAGACTAATGGG - Intronic
1064772999 10:18743727-18743749 TCAGAATTATTCTAAGTAAAAGG + Intergenic
1065244642 10:23744735-23744757 AAAGATTTATTTTAAATAATTGG + Intronic
1065474596 10:26120461-26120483 TAAAATTTATTTTAAGTAACAGG + Intronic
1065762767 10:28998091-28998113 TCAGTTCCATTTTGAGGAATGGG + Intergenic
1065763492 10:29005580-29005602 TAAGACCTCTTATAAGTAATTGG - Intergenic
1066024905 10:31346289-31346311 TCAGGGTTATTTTAAGTAACTGG + Intronic
1066516595 10:36168368-36168390 TCAAATCTAGATTAAGTACTCGG - Intergenic
1066543956 10:36479344-36479366 TAAGATCTTTTTTAAAAAATTGG - Intergenic
1067358302 10:45551769-45551791 AGAGATTTATTTTAAGGAATTGG - Intronic
1068303217 10:55173237-55173259 AGAGAACTATTTTAAGTCATAGG + Intronic
1068542475 10:58311066-58311088 TGTGATCTATTTTAAGCATTTGG - Intergenic
1068598016 10:58924813-58924835 ACAGATTTATTTTAAGGAATTGG - Intergenic
1068892231 10:62159900-62159922 AGAGATTTATTTTAAGGAATTGG - Intergenic
1069389299 10:67915788-67915810 TCAAATCTTTTTAAAATAATTGG + Intronic
1070272727 10:74973095-74973117 TAAGATCTCTTTTATGAAATAGG + Intronic
1070296717 10:75167916-75167938 TAAGAGCAATTTTCAGTAATAGG + Intronic
1070426345 10:76291722-76291744 TAAGATCTTTTTTAAGGGATGGG - Intronic
1070706582 10:78643483-78643505 CCAGATTTATTTTAGGGAATTGG + Intergenic
1071182161 10:82998723-82998745 TAAGATTTATTTTAATTATTTGG + Intergenic
1071682846 10:87724890-87724912 AGAGATTTATTTTAAGGAATTGG + Intronic
1071810133 10:89170544-89170566 AGAGATTTATTTTAAGGAATTGG + Intergenic
1072825387 10:98600985-98601007 ACAGATTGATTTTAAGTAACTGG + Intronic
1072845728 10:98828129-98828151 AGAGATTTATTTTAAGGAATTGG - Intronic
1073378144 10:103054702-103054724 TCAGACCAATTTTAAGTTACTGG - Intronic
1073754041 10:106561685-106561707 AGAGATATATTTTAAATAATTGG - Intergenic
1073779231 10:106819015-106819037 CCAGATCTTTTTTAAGAACTGGG - Intronic
1073824032 10:107299729-107299751 GGAGATCTATTTTAAGGAACTGG + Intergenic
1074548866 10:114424588-114424610 TCATTTCTATTTTCTGTAATTGG - Intergenic
1074632123 10:115270469-115270491 TGAGATTTATTATAAGAAATTGG + Intronic
1075559006 10:123454987-123455009 TGAGATTTATTTTAAGGAAGTGG + Intergenic
1075663056 10:124211597-124211619 AGAGATTTATTTTAAGGAATTGG + Intergenic
1077759634 11:5078524-5078546 TAAGACCTATTTTAAGTATTTGG - Intergenic
1078948603 11:16101659-16101681 TTAAATCAATTTTATGTAATGGG - Intronic
1079379089 11:19920948-19920970 TCTGTTTTATTTTATGTAATAGG - Intronic
1079905070 11:26234793-26234815 TGAGATTTATTATAAGGAATTGG + Intergenic
1081750144 11:45504722-45504744 GGAGATTTATTTTAAGAAATGGG + Intergenic
1083495695 11:63050924-63050946 TCAGTTCCATTTTGAGGAATGGG - Intergenic
1084348687 11:68577108-68577130 TTAGGTCTATTTTAATTAAATGG - Intronic
1084841414 11:71853907-71853929 TTAGATATATACTAAGTAATGGG - Intergenic
1085191142 11:74623983-74624005 TCAGATCAGTTTTCTGTAATTGG + Intronic
1085698539 11:78726457-78726479 TTAGATCCTTTTAAAGTAATTGG - Intronic
1086324457 11:85683548-85683570 TCATTTCTATTTTAAGGAAGAGG - Intergenic
1086372063 11:86164843-86164865 ACAGATGTATTCTAAGTAAGAGG + Intergenic
1086379071 11:86232886-86232908 ACAGATTTATTTTAAGTAACTGG - Intergenic
1086809191 11:91284165-91284187 AAAGATTTATTTTAAATAATTGG - Intergenic
1087551762 11:99659522-99659544 ACAGATTTATTATAAGGAATTGG + Intronic
1088081353 11:105919350-105919372 ATAGATATCTTTTAAGTAATTGG + Intronic
1088997059 11:115010356-115010378 TCAGATATTTTGTAAGAAATGGG + Intergenic
1089006917 11:115099759-115099781 AGAGATTTATTTTAAGGAATTGG + Intergenic
1089205475 11:116758154-116758176 TCAGAGCTGTTATCAGTAATGGG - Intronic
1090752739 11:129761728-129761750 CCAGATTTATTTTAAATGATGGG + Intergenic
1091178664 11:133583503-133583525 TCAGATATTTGTTAAATAATTGG - Intergenic
1091292499 11:134449517-134449539 ACAGAACTATTTTAAGGAATTGG - Intergenic
1091462214 12:652561-652583 TCAGATCTATGTAAAGAAAAGGG + Intronic
1092014568 12:5147867-5147889 TCAAATCTATGTGAAGTCATGGG - Intergenic
1092314573 12:7396796-7396818 AGAGATTTATTTTAAGGAATTGG - Intronic
1092923394 12:13252352-13252374 ATAGATTTATTTTAAGGAATAGG + Intergenic
1093146502 12:15573109-15573131 AGAGATCTATTTTAAGGTATTGG + Intronic
1093568092 12:20632918-20632940 TTAGATTTATTTTATTTAATTGG - Intronic
1093758896 12:22882880-22882902 AGAGATTTATTTTAAGGAATTGG - Intergenic
1093927651 12:24925390-24925412 AGAGATTTATTTTAAGGAATTGG - Intronic
1093975919 12:25422165-25422187 AGAGATTTATTTTACGTAATTGG + Intronic
1095142369 12:38681772-38681794 AGAGATATATTTTAAGGAATTGG - Intronic
1095316761 12:40771774-40771796 TGAGATCTATTATAATTATTTGG + Intronic
1095318441 12:40795232-40795254 AGAGATTTATTTTAAGGAATTGG - Intronic
1096421217 12:51459566-51459588 TAAGATATATTTTAGGTGATGGG + Intronic
1097623582 12:61972272-61972294 TTATATTTATTTTAAGTATTTGG - Intronic
1097670152 12:62526799-62526821 ATAGATATATTTTGAGTAATTGG + Intronic
1098305365 12:69097263-69097285 AGAGATTTATTTTAAGGAATTGG + Intergenic
1098873024 12:75837588-75837610 TCAGACCCACTTTAAGAAATAGG + Intergenic
1098905552 12:76158118-76158140 AGAGATCTATTTTAAGAAATTGG - Intergenic
1099329596 12:81266920-81266942 TCAGATCTCTTTTGAATAACAGG + Intronic
1099974084 12:89528380-89528402 TAAGATCAACTTTAGGTAATAGG - Intergenic
1100712221 12:97269749-97269771 GGAGATTTATTTTAAGGAATTGG + Intergenic
1100904246 12:99279279-99279301 TCAGCTCTATTATAAGGAAAAGG + Intronic
1101280943 12:103254906-103254928 TAATTTCTATTTTAAGTTATGGG - Intronic
1101477934 12:105068577-105068599 TTAGATTTTTTTTAACTAATGGG - Intronic
1101698220 12:107146950-107146972 CGAGATTTATTTTAAGGAATTGG - Intergenic
1102209588 12:111115940-111115962 TCAGATCTATGTCAAAGAATAGG - Intronic
1103821972 12:123706059-123706081 CCAGATCTATTTTGAGAAAGAGG - Intronic
1107262107 13:38505266-38505288 TTAAATGTATTTTAACTAATTGG - Intergenic
1107718152 13:43220928-43220950 TCAGATCCTGTTTAATTAATTGG - Intronic
1107758837 13:43654393-43654415 AGAGATTTATTTTAAGGAATTGG - Intronic
1107990578 13:45815496-45815518 AGAGATTTATTTTAAGAAATTGG - Intronic
1108225836 13:48287817-48287839 TCAGAGCTCTTTCATGTAATTGG - Intergenic
1108764025 13:53604666-53604688 ACAGATTTATTGTAAGGAATTGG - Intergenic
1108838454 13:54581445-54581467 TCCGCTCAATTTCAAGTAATGGG - Intergenic
1108994657 13:56712977-56712999 ACAAATATATTTTCAGTAATGGG - Intergenic
1109122792 13:58479099-58479121 TCGAATTTATTTTAAGAAATTGG - Intergenic
1109970617 13:69763344-69763366 TTTGATCTATTTTAATTAGTTGG + Intronic
1110132808 13:72028102-72028124 ATAGATTTATTTTAAGCAATTGG + Intergenic
1110435473 13:75473319-75473341 TCATATATATTTTTAATAATGGG - Intronic
1110774788 13:79395085-79395107 TAAGATTTATTTTCAGTAAGGGG - Intronic
1111929297 13:94497344-94497366 ACAGATTTATTTTAAGGAATTGG - Intergenic
1112486670 13:99826405-99826427 ATAGACTTATTTTAAGTAATTGG - Intronic
1112785154 13:102943407-102943429 TCTGATGGGTTTTAAGTAATGGG + Intergenic
1113394757 13:109936806-109936828 GGAGATTTATTTTAAGGAATTGG - Intergenic
1113821122 13:113213926-113213948 TCAGATCTATTGGAAGCAAATGG + Intronic
1114719572 14:24866320-24866342 AGAGATTTATTTTAAGGAATTGG - Intronic
1115078327 14:29418321-29418343 ACAGATCTATTTTTAACAATAGG - Intergenic
1115369944 14:32602136-32602158 TCGGAGCTATTTTAAGGAGTAGG + Intronic
1116620692 14:47199154-47199176 GGAGATTTATTTTAAGAAATTGG - Intronic
1117297891 14:54395688-54395710 ACAGATTTATTTTAAGGAATTGG - Intergenic
1117414294 14:55479476-55479498 AAAGATTTATTTTAAGAAATTGG + Intergenic
1117891946 14:60431541-60431563 CTAGATTTATTTTAAGGAATTGG - Intronic
1118023510 14:61744182-61744204 TCAGCTCTATTTTATAAAATAGG + Intronic
1119970420 14:78964067-78964089 TCAGACCTAATTTAAAGAATTGG - Intronic
1120456815 14:84741141-84741163 TAAGATTTATTTTAATAAATTGG - Intergenic
1120617656 14:86727611-86727633 AAAGATTTATTTTAAGGAATTGG - Intergenic
1120789380 14:88565088-88565110 TCAGAAATTTTTTAAGTACTGGG - Intronic
1120911221 14:89668830-89668852 AGAGATTTATTTTAAGGAATTGG + Intergenic
1120919757 14:89744158-89744180 AGAAATTTATTTTAAGTAATTGG - Intergenic
1120945661 14:89994282-89994304 AAAGATTTATTTTAAGGAATTGG + Intronic
1121030169 14:90651970-90651992 TCAGATATATTTAAAGTGACAGG + Intronic
1122567806 14:102674061-102674083 AGAGATTTATTTTAAGGAATTGG + Intronic
1122709130 14:103642550-103642572 TCAGAACTCTTTGGAGTAATGGG + Intronic
1202928516 14_KI270725v1_random:16935-16957 TCAGAGCTATGTTAAGTGTTAGG + Intergenic
1123908131 15:24940803-24940825 TTAAATTTATTTTAAGAAATTGG + Intronic
1124479313 15:30064035-30064057 AGAGATCTATTTTAAGGAATTGG - Intergenic
1125559708 15:40619175-40619197 TCACAGCCAGTTTAAGTAATGGG + Intronic
1126034517 15:44534518-44534540 AGAGATTTATTTTAAGGAATTGG + Intergenic
1126254212 15:46606013-46606035 TCTGATCTATTTTGAGTAATTGG - Intergenic
1126334477 15:47571200-47571222 TCAAATATATTTTAAGCAAGTGG - Intronic
1126386027 15:48094243-48094265 AAAGATATATTTTAAGAAATTGG - Intergenic
1126455656 15:48859109-48859131 TCATATTTATTTGAAGTAAAAGG + Intronic
1126678301 15:51180900-51180922 TGAGATTTATTATAAGGAATTGG - Intergenic
1127414164 15:58740884-58740906 TAAAATCTATTTTTAGTAGTTGG - Intronic
1127702644 15:61515894-61515916 TCAGTTCTGTTTGAAGTTATAGG + Intergenic
1128849079 15:70933200-70933222 TCAAAACTATTTTATGTATTTGG - Intronic
1130426799 15:83809566-83809588 GCAGATCTATTTAAAGAAAAGGG - Intronic
1130780486 15:87033285-87033307 TCAGGTCTATCTTGATTAATCGG - Intergenic
1130887174 15:88103413-88103435 TGTGATTTATTTTAAGGAATTGG - Intronic
1131358105 15:91763933-91763955 ATAGATTTATTTTAAGGAATTGG + Intergenic
1133039227 16:3051250-3051272 AGAGATTTATTTTAAGGAATTGG + Intronic
1133297079 16:4759641-4759663 ACAGATTTATTTTAAGGAATGGG - Intronic
1133393400 16:5427237-5427259 AGAGATTTATTTTAAGGAATTGG + Intergenic
1133672847 16:8041002-8041024 GCACATTTATTTTAAGGAATAGG + Intergenic
1135375856 16:21946675-21946697 TCAGATCTATTGTAGGACATTGG - Intergenic
1135886666 16:26316194-26316216 TTAAATTTATTTTAAGAAATTGG - Intergenic
1137637702 16:50001419-50001441 AGAGATTTATTTTAAGTAAATGG - Intergenic
1138911537 16:61405684-61405706 TCAGATGATTTTGAAGTAATTGG - Intergenic
1140557951 16:75943196-75943218 AGAGATTTATTTTAAGGAATTGG - Intergenic
1140784098 16:78323511-78323533 TGAGCTCTATTTAAACTAATAGG + Intronic
1142905230 17:3036897-3036919 ACAGATCTGTTTTAAGCAGTTGG + Exonic
1143291606 17:5835708-5835730 ATAGATTTATTTTAAGGAATAGG + Intronic
1144201582 17:12947119-12947141 TGAGAGCTATTTTAAGAAATTGG - Intronic
1145229996 17:21166598-21166620 TCAGATATATTTCAAGATATGGG + Intronic
1145831261 17:27918160-27918182 AAAGATATGTTTTAAGTAATTGG + Intergenic
1146601947 17:34225057-34225079 GCATATCTATTTTAGGGAATGGG + Intergenic
1147018674 17:37512998-37513020 TCAAATTTATTTTAAGAGATAGG + Exonic
1149253607 17:54799059-54799081 TCATATTCATTTTAAGAAATTGG - Intergenic
1149726761 17:58902916-58902938 TCAGATTTAATTTAATTTATAGG - Intronic
1149836090 17:59914121-59914143 TACAAACTATTTTAAGTAATAGG + Intronic
1150547244 17:66172436-66172458 TCAGTTATATAATAAGTAATGGG - Intronic
1153400669 18:4680894-4680916 TCAGATCAACTTAAAGTAAAGGG + Intergenic
1154256623 18:12786685-12786707 TCACATATATATTAAGAAATAGG + Intronic
1154928372 18:20964122-20964144 TCAGTTTTTTTTTAAGTAGTTGG - Intronic
1155233888 18:23799752-23799774 AGAGATTTATTTTAAGGAATTGG + Intronic
1155770203 18:29688171-29688193 TTAGATATATTTTAAATATTTGG - Intergenic
1156049825 18:32919325-32919347 AGAGATTTATTTTAAGGAATTGG + Intergenic
1156728556 18:40160876-40160898 TGAGATTTATTTTAAAAAATAGG - Intergenic
1157156882 18:45276992-45277014 TCAGGACAATTTTAACTAATAGG - Intronic
1157287109 18:46384441-46384463 CCAGATATATTTTAAGAAAGAGG - Intronic
1157760076 18:50255927-50255949 TCAACTATATTTTCAGTAATAGG + Intronic
1158068504 18:53441981-53442003 TCAGTTCTGTTTAAAGGAATAGG + Intronic
1158178409 18:54684233-54684255 TCAGATTTTTGTTAAATAATAGG + Intergenic
1158615761 18:58985155-58985177 TCAGTTCCATTTTGAGGAATGGG + Exonic
1158928232 18:62293261-62293283 AGAGATTTATTTTAAGGAATTGG + Intronic
1159449171 18:68577757-68577779 TGAGATCTAGTCTAAATAATTGG - Intergenic
1159583906 18:70264523-70264545 TCAGTTCTAATTAAATTAATTGG - Intergenic
1160175192 18:76587874-76587896 TTATATCTACTTTAAGTGATAGG + Intergenic
1162175949 19:8830475-8830497 CCAGATGTGTTTTGAGTAATGGG - Intronic
1163260554 19:16187166-16187188 TTAGTGCTACTTTAAGTAATAGG - Intronic
1163735406 19:18977250-18977272 AAAGATGTATTTTAAGGAATTGG - Intergenic
1164155427 19:22593628-22593650 TGAAATGTATTTAAAGTAATTGG + Intergenic
1164530572 19:29045256-29045278 TCAGATTTACTATAAGGAATTGG - Intergenic
1164663938 19:30009970-30009992 TTTGATCTATTTTAAATACTGGG - Intronic
1167697916 19:51025825-51025847 TAAGATATATTTTAAGTGTTTGG - Intronic
925562518 2:5212570-5212592 AAAGATTTATTTTAAGAAATTGG + Intergenic
925690581 2:6518879-6518901 ACAGATTTAATTTAAGGAATTGG + Intergenic
925844377 2:8022086-8022108 TTAGATTTTTTTTAAGTATTTGG + Intergenic
926952869 2:18262444-18262466 TCAGTTCCATTTTGAGGAATGGG + Intronic
927233489 2:20848383-20848405 AGAGATTTATTTTAAGGAATTGG - Intergenic
927431146 2:23027124-23027146 AGAGATTTATTTTAAGGAATTGG + Intergenic
928307675 2:30183956-30183978 AAAGATTTATTTTAAGGAATTGG + Intergenic
928351874 2:30565163-30565185 TGAGATTTATTTTAAGGAATTGG + Intronic
928730671 2:34228296-34228318 AGAGATTTATTTTAAGGAATTGG - Intergenic
928776886 2:34776411-34776433 TCTGATCTCTTTCAAGTCATGGG + Intergenic
928818779 2:35334555-35334577 TTAGATAAATTTTAAGTAACTGG + Intergenic
931073153 2:58677783-58677805 AGAGATTTATTTTAAGGAATTGG + Intergenic
931077440 2:58732093-58732115 TAAGAGCTATTTTACATAATAGG + Intergenic
932080140 2:68706833-68706855 CCAGATCTATTTTTGGAAATAGG - Intronic
934686125 2:96322978-96323000 TTGGATAGATTTTAAGTAATGGG - Intergenic
935495854 2:103780849-103780871 GTGGATCTATTTTCAGTAATTGG + Intergenic
936232712 2:110717947-110717969 AGAGATTTATTTTAAGGAATTGG - Intergenic
936257797 2:110932191-110932213 TGAGATGTATTTTAAGTAAATGG - Intronic
937866682 2:126757232-126757254 ATAAATCTATTTTAATTAATGGG + Intergenic
938686060 2:133739127-133739149 AGAGATTTATTTTAAGGAATTGG + Intergenic
939021778 2:136966057-136966079 TCAGTTCAATTTTAAGCACTGGG - Intronic
939385133 2:141486260-141486282 TGAAATCTATTTTGACTAATTGG - Intronic
940087990 2:149883107-149883129 TATGATTTATTTTAAGGAATTGG + Intergenic
940268722 2:151868163-151868185 TCAGATAGATTTTAATAAATTGG - Intronic
940422461 2:153496525-153496547 TCAGATCAATTTCCAGTAATTGG + Intergenic
940436105 2:153657085-153657107 TCAGATCTCTATGAAGTTATGGG + Intergenic
940476407 2:154168177-154168199 AGAGATTTATTTTAAGGAATTGG + Intronic
940554987 2:155213233-155213255 TCAGATCTACATGAAGAAATCGG - Intergenic
942193555 2:173494944-173494966 TCAGAACTAGGTTAAGCAATGGG - Intergenic
942283912 2:174395159-174395181 AAAGATCTATCTTAAGTAAACGG + Intronic
942517609 2:176770083-176770105 TCAAATCTGATTTAAGTAGTAGG + Intergenic
942696295 2:178650577-178650599 TCAAATCTATTTTGGGTTATTGG - Intronic
943291001 2:186071673-186071695 ACAGATTTATTATAAGGAATTGG + Intergenic
943891457 2:193292183-193292205 TAATGTTTATTTTAAGTAATGGG - Intergenic
943981832 2:194562050-194562072 TCAAATTTTTTTTCAGTAATTGG + Intergenic
944130138 2:196338747-196338769 TCATATCTATTTTACTTAAAAGG + Intronic
945115500 2:206404444-206404466 TCAAATATATTTTAAGTATGAGG + Intergenic
945424227 2:209679937-209679959 TTAAATCTATTTTAAATATTAGG - Intronic
946952681 2:224894491-224894513 TCAGAACTATTTTCAGAAAGAGG + Intronic
947044956 2:225971289-225971311 TAAGATTTATTATAAGGAATTGG + Intergenic
947371025 2:229445748-229445770 AGAGATTTATTTTAAGTAACTGG - Intronic
1169102583 20:2964032-2964054 TCAGATTTTTTTTAAGAGATAGG - Intronic
1170939740 20:20839027-20839049 AGAGATTTATTTTAAGGAATTGG + Intergenic
1170964747 20:21057381-21057403 TCAGATCTATTTTATTTTGTAGG + Intergenic
1176587442 21:8601991-8602013 ATAGATTTATTTTAAGAAATTGG + Intergenic
1176590543 21:8645578-8645600 TCAGAGCTATGTTAAGTGTTAGG + Intergenic
1177006477 21:15678869-15678891 ACAGATGTAATTTAAGGAATTGG + Intergenic
1177138732 21:17334958-17334980 TAAGAACTATTTTCAGTTATTGG - Intergenic
1177168340 21:17628260-17628282 AGAGATTTATTTTAAGGAATTGG + Intergenic
1177629946 21:23713833-23713855 TCAGATTTATTATAATAAATTGG - Intergenic
1177772312 21:25530390-25530412 TAAGATTTATTATAAGAAATTGG - Intergenic
1178009275 21:28264078-28264100 ACTGATTTATTTTAAGAAATTGG + Intergenic
1178247700 21:30969856-30969878 TCAGATCAATTGTAAGAAACTGG - Intergenic
1178366114 21:31990263-31990285 TGAGATTTATTTTAAGGAGTTGG + Intronic
1178472542 21:32906264-32906286 AGAGATTTATTTTAAGGAATTGG - Intergenic
1178721444 21:35014196-35014218 TCAGCTGTACTTTAATTAATTGG + Intronic
1179364864 21:40749712-40749734 TTAGATCTATATCCAGTAATGGG - Intronic
1179952756 21:44720027-44720049 TTAGACATATTTTAAGTACTTGG + Intergenic
1180270273 22:10578988-10579010 ATAGATTTATTTTAAGAAATTGG + Intergenic
1181535685 22:23542018-23542040 TCAGATCAATTATAATTAAAGGG - Intergenic
1184714968 22:46276152-46276174 GGAGATTTATTTTAAGGAATTGG + Intronic
949139917 3:619762-619784 ATAGATTTATTTTAAGAAATTGG - Intergenic
949451145 3:4186478-4186500 TAAGAAATAATTTAAGTAATAGG + Intronic
949596290 3:5550882-5550904 TCATATTTAAGTTAAGTAATAGG + Intergenic
949615764 3:5752225-5752247 AGAGATCTATTATAAGCAATTGG - Intergenic
949735830 3:7170581-7170603 TCACATCTAATTTATGTGATAGG - Intronic
951118838 3:18898984-18899006 TGAGATTTATTTTAATAAATTGG - Intergenic
951272881 3:20649112-20649134 TTAGCTCTATTTTACATAATGGG + Intergenic
951445459 3:22774642-22774664 TCTTCTCTATTTTAATTAATTGG + Intergenic
951453183 3:22862538-22862560 ACAGGTTTATTTTAAGAAATCGG + Intergenic
951925513 3:27905245-27905267 TTATATCTATTTTATGCAATGGG - Intergenic
951987568 3:28637894-28637916 ACAGATCTAATTTGAGAAATAGG - Intergenic
952226761 3:31385166-31385188 TGAGATTTTTTTTAAGTATTGGG - Intergenic
952743604 3:36757931-36757953 TCAGATGTAGTTAAGGTAATGGG - Intergenic
952859902 3:37804265-37804287 TCTGATCTTTTTTAAGCAAATGG - Intronic
953208849 3:40856553-40856575 AGAGATTTATTTTAAGGAATTGG - Intergenic
953547741 3:43876110-43876132 AGAGATTTATTTTAAGGAATTGG + Intergenic
953712716 3:45288242-45288264 TGAGATTTATTTCAAGGAATTGG + Intergenic
953808239 3:46090039-46090061 TCATTTCTAATTTATGTAATAGG + Intergenic
955068223 3:55550712-55550734 ACAGATATAATTTAAGAAATAGG + Intronic
955762892 3:62307200-62307222 ACAGCTCTCTTTTAAGCAATAGG + Intergenic
955827184 3:62960716-62960738 TCAGAATTTTTTTAAGTAATGGG - Intergenic
956693987 3:71903258-71903280 ACAGATTTATTTTAAGGAATTGG + Intergenic
957289080 3:78254029-78254051 TGAGATTTATTATAAGGAATTGG - Intergenic
957358427 3:79121686-79121708 ACAGGTCTGTTTTAAGGAATAGG - Intronic
957933997 3:86919084-86919106 AGAAATCCATTTTAAGTAATGGG + Intergenic
958008003 3:87837754-87837776 TCACATATATTTTAAGTGAAAGG + Intergenic
958106698 3:89083531-89083553 TAGGATCTTTTTTAAATAATAGG - Intergenic
958159371 3:89797410-89797432 TATGATTTATTATAAGTAATTGG + Intergenic
958178292 3:90024363-90024385 TCAGAGCTATTCCAACTAATGGG + Intergenic
958189461 3:90166265-90166287 AGAGATTTATTTTAAGGAATTGG + Intergenic
958411773 3:93825869-93825891 ACAGATTTATTTTAAGGAATTGG + Intergenic
958524286 3:95233966-95233988 ACAGATATATTTTAAGACATTGG + Intergenic
959070369 3:101696053-101696075 TCAGATCAATTATAATTAAAGGG - Intergenic
959255997 3:104014887-104014909 TTAGATATATATTCAGTAATGGG - Intergenic
959458713 3:106596840-106596862 TTGGATCTATTTTCAGTAGTGGG + Intergenic
960920526 3:122742847-122742869 TGAGATTTACTTTAAGGAATGGG - Intronic
960976954 3:123184899-123184921 AGAGATTTATTTTAAGGAATTGG + Intronic
961776095 3:129286910-129286932 TCAAACTTTTTTTAAGTAATGGG - Intronic
962031040 3:131600519-131600541 TAAGATCTATTATAAATATTGGG + Intronic
962609313 3:137060402-137060424 ATAGATTTATTTCAAGTAATTGG + Intergenic
963986669 3:151603606-151603628 ACAGATCTATTATAAGAAATTGG + Intergenic
964245875 3:154652820-154652842 AGAGATTTATTTTAAGGAATTGG + Intergenic
965097087 3:164244211-164244233 TGAGATTTATTTTATGAAATTGG + Intergenic
966271019 3:178105763-178105785 TTAGATTTATTTTAGGGAATTGG - Intergenic
966307003 3:178547712-178547734 TTAGAGCTTTTTTCAGTAATTGG + Intronic
969120605 4:4907357-4907379 TTAGATCTTTTTTAAATATTTGG - Intergenic
969173429 4:5381902-5381924 AGAGATTTATTTTAAGAAATTGG + Intronic
969782509 4:9419951-9419973 TTAGATATATACTAAGTAATGGG - Intergenic
970007423 4:11425073-11425095 TCATTTCTATTTTAAGGATTTGG - Intronic
970243929 4:14038907-14038929 TCAGAGAGATTTTAAGTAGTGGG + Intergenic
970336748 4:15054441-15054463 TAAGATCTATGTGAAGTGATTGG + Intronic
970485750 4:16523137-16523159 ACATATTTATTTTAAGAAATTGG + Intronic
970696598 4:18685491-18685513 GGAGATTTATTTTAAGGAATTGG + Intergenic
970925515 4:21447098-21447120 ACAGATTTATTTTAAAGAATTGG - Intronic
970986762 4:22168019-22168041 TGAGATTTATTTTAAAGAATTGG + Intergenic
971799376 4:31268443-31268465 ACAGATCTATTTATAGCAATAGG - Intergenic
971934846 4:33134408-33134430 AGAGATTTATTTTAAGGAATTGG - Intergenic
972371857 4:38431696-38431718 AGAGATTTATTTTAAGGAATTGG + Intergenic
972438111 4:39054565-39054587 TCAGTTCTCTCTTCAGTAATAGG - Intronic
973171734 4:47153438-47153460 TCATATCTATTTAAAGAAATTGG + Intronic
973186039 4:47329878-47329900 ACAGATTTATTATAAGGAATTGG + Intronic
973235658 4:47901094-47901116 TGAGTTTTATTTTAAATAATGGG + Intronic
973318584 4:48786523-48786545 TCACAGATATTTTTAGTAATAGG - Intergenic
974529973 4:63096288-63096310 AGAGATTTATTTTAAGGAATTGG + Intergenic
974596981 4:64026770-64026792 TCGGATATATATTCAGTAATTGG - Intergenic
974918993 4:68213623-68213645 ACAGGTTTATTTTAAGGAATTGG - Intergenic
975258748 4:72271305-72271327 ACAGATTTATTATAAGAAATTGG - Intergenic
975703728 4:77091173-77091195 AGAGATTTATTTTAAGGAATTGG + Intergenic
975734730 4:77370296-77370318 TCAAATCTTTTCTAAGGAATGGG + Intronic
975903069 4:79176368-79176390 AGAGATTTATTTTAAGGAATTGG + Intergenic
976913970 4:90346951-90346973 TCTGATCTACTTTAATTCATGGG - Intronic
977030047 4:91872082-91872104 TCTGAACTAGGTTAAGTAATTGG - Intergenic
977076610 4:92460009-92460031 TGAGATTTATTTTAAGGAATGGG - Intronic
977251497 4:94693938-94693960 AGAGATTTATTTTAATTAATTGG - Intergenic
977403849 4:96570524-96570546 AAAGATTTATTTTAAGAAATTGG + Intergenic
977424962 4:96856740-96856762 ATAGATCTATTTTAAGGAATTGG - Intergenic
977445638 4:97128296-97128318 TTAGATATATATTCAGTAATGGG - Intergenic
977686808 4:99856126-99856148 TCAGAACTGTTTTAAGCACTGGG + Intronic
977717535 4:100198454-100198476 TAAAATGTATTTAAAGTAATTGG + Intergenic
978255046 4:106682847-106682869 AGAGATTTATTTTAAGGAATTGG - Intergenic
978373861 4:108054690-108054712 TAAGAGATATTTTAATTAATTGG - Intronic
978593201 4:110349064-110349086 AGAGATTTATTTTAAGAAATTGG + Intergenic
978867674 4:113534232-113534254 CCAGATATATTTTAAGTATTAGG - Intronic
979210588 4:118096719-118096741 GCAGATGTATTATAAGGAATTGG + Intronic
979799213 4:124887076-124887098 TGAGATTTATTATAAGGAATTGG + Intergenic
979821702 4:125181962-125181984 TCAGTTGTATTTTAGGAAATTGG + Intergenic
979895623 4:126152744-126152766 TGAGATTTATTATAAGGAATTGG - Intergenic
980764903 4:137289262-137289284 TGAGATTTATTATAAGAAATTGG + Intergenic
981017034 4:139984620-139984642 TGAGATTTATTTTAAGGAATTGG + Intronic
981123555 4:141079883-141079905 TCAGTTCTCTTATAAGTAAATGG + Intronic
981180087 4:141731278-141731300 TATGATATATTTTATGTAATGGG + Intronic
981358409 4:143819328-143819350 ACAGAGCTATTCTAGGTAATGGG + Intergenic
981902384 4:149881654-149881676 TCAGATCTTTTTCAAAAAATAGG + Intergenic
982311091 4:153985686-153985708 TTTCATCTATTTTATGTAATTGG + Intergenic
982419195 4:155174508-155174530 TAAAATCTGTTTTAAGTATTTGG + Intergenic
982620577 4:157698626-157698648 TCAGAATTCTTTTAAGGAATTGG - Intergenic
982800492 4:159699981-159700003 TTAGTTCTTTTTTAAATAATTGG + Intergenic
982990838 4:162271746-162271768 TAAGTTCAATTTTGAGTAATGGG + Intergenic
983314685 4:166116031-166116053 TTAGATTTACTTTCAGTAATTGG + Intergenic
983731267 4:170996584-170996606 ACAGATCTATTTGAAGGAATTGG - Intergenic
983806356 4:171998272-171998294 AGAGATCTATTTTAAGAAATTGG + Intronic
983861535 4:172713282-172713304 AAAGATTTATTTTAAGGAATTGG + Intronic
984341634 4:178464853-178464875 AGAGATTTATTTTAAGAAATTGG + Intergenic
984534583 4:180957873-180957895 AGAGATTTATTTTAAGGAATTGG + Intergenic
984633300 4:182083216-182083238 TTAGATATGTATTAAGTAATAGG + Intergenic
984871139 4:184326113-184326135 AGAGATTTATTTTAAGGAATTGG - Intergenic
986168266 5:5294336-5294358 GAAGATTTATTTTAAGGAATTGG + Intronic
986208308 5:5646727-5646749 TAGGATCTATTATAAGGAATTGG + Intergenic
986732763 5:10647652-10647674 AGAGATTTATTTTAAGGAATTGG + Intronic
986803681 5:11287428-11287450 AGAGATTTATTTTAAGGAATTGG - Intronic
986883178 5:12200845-12200867 AAAGATTTATTTTAAGGAATTGG + Intergenic
986897991 5:12394322-12394344 ACAGATTTATTTTAAGGAATTGG + Intergenic
987036109 5:14020036-14020058 GGAGATCTATTTCAAGGAATTGG + Intergenic
987154247 5:15071879-15071901 AGAGATTTATTTTAAGGAATTGG - Intergenic
987280219 5:16406288-16406310 AGAGATTTATTTTAAGAAATTGG + Intergenic
987283163 5:16430586-16430608 TGAGATTTATTTTTAGAAATTGG - Intergenic
987598544 5:20034767-20034789 AGAGATCTATTGTAAGTAATTGG - Intronic
987661376 5:20882584-20882606 ATTGATTTATTTTAAGTAATTGG + Intergenic
987683498 5:21166818-21166840 TCAGATTTATCTTTATTAATTGG + Intergenic
987901636 5:24019740-24019762 ACACATTTATTTTAAGGAATTGG + Intronic
988363507 5:30266342-30266364 AGAGATTTATTTTAAGTAATTGG + Intergenic
988534957 5:32058955-32058977 TCACATCTGTTTTTAGAAATAGG - Intronic
988624169 5:32853090-32853112 ACAGATCCATTTAAAGTAAAAGG - Intergenic
988762209 5:34322741-34322763 ATTGATTTATTTTAAGTAATTGG - Intergenic
988959534 5:36355949-36355971 ATAGATTTATTTTAAGGAATTGG + Intergenic
990487899 5:56277234-56277256 TCAGATCTGTTTCAAGGAATTGG - Intergenic
990657781 5:57976582-57976604 ACAGGTTTATTTTAAGCAATTGG - Intergenic
990739280 5:58895716-58895738 TCAGATGGATTTTAAACAATTGG - Intergenic
990934486 5:61133008-61133030 TGAGATCCATTTTAAGTAAGGGG + Intronic
990941817 5:61210139-61210161 TTAGATCATTTTGAAGTAATAGG + Intergenic
991013193 5:61905113-61905135 GGAGATTTATTTTAAGAAATTGG - Intergenic
991216568 5:64162931-64162953 ACAGATTTATTTTAACTACTAGG - Intergenic
992397790 5:76383398-76383420 AGAGATTTATTTTAAGGAATTGG - Intergenic
993006718 5:82436314-82436336 AGAGATTTATTTTAAGGAATTGG - Intergenic
993006725 5:82436496-82436518 TGATATTTATTTTAAGGAATTGG - Intergenic
993049292 5:82908111-82908133 TCAGGGTTATATTAAGTAATGGG - Intergenic
993280287 5:85917307-85917329 TAATATCTATGTTAAATAATTGG - Intergenic
993521585 5:88909020-88909042 TCAGATCTGTTTTCAGGAAGAGG + Intergenic
993591114 5:89796190-89796212 AGAGATGTATTTTAAGGAATTGG - Intergenic
993896964 5:93547105-93547127 TATGATTTATTTTAAGAAATTGG - Intergenic
994033948 5:95177205-95177227 AGAGATTTATTTTAAGGAATTGG + Intronic
994082007 5:95717340-95717362 AGAGATTTATTTTAAGGAATTGG - Intronic
994116681 5:96069293-96069315 TAAGATTTATTTTAAGAAACTGG + Intergenic
994380650 5:99066940-99066962 AGAGATTTATTTTAAGGAATTGG - Intergenic
994622785 5:102182645-102182667 AAAGATTTATTTTAAGGAATTGG + Intergenic
994646510 5:102476271-102476293 ACAGATTCATTTTAAGGAATTGG + Intronic
995251892 5:110002876-110002898 AGAGATTTATTTTAAGGAATTGG + Intergenic
995392859 5:111658410-111658432 TTAACTCTATATTAAGTAATTGG - Intergenic
995903494 5:117095632-117095654 TACAATCTATTTTAAGTAAATGG + Intergenic
996154780 5:120084710-120084732 ACAGATTTACTGTAAGTAATTGG - Intergenic
996372807 5:122771208-122771230 AGAGATTTATTTTAAGCAATCGG + Intergenic
996487483 5:124053857-124053879 AGAGATTTATTTTAAGGAATTGG - Intergenic
996583674 5:125060546-125060568 ATAGATTTATTTTAAGGAATTGG - Intergenic
997164530 5:131645377-131645399 TAAGATGTATTGGAAGTAATGGG + Intronic
997192806 5:131954791-131954813 TCAGATGGATGTTAAATAATGGG + Intronic
997346033 5:133192829-133192851 AGAGATCTATTTTAAGGAATTGG - Intergenic
997391147 5:133517658-133517680 ATAGATCTTTTTTAAGGAATTGG + Intronic
998879109 5:146629080-146629102 TCATAGCTATTTTAAGCCATGGG - Intronic
999136450 5:149323055-149323077 TCTGGCCTCTTTTAAGTAATTGG - Intronic
999957566 5:156719111-156719133 AAAGATTTATTTTAAGGAATTGG + Intronic
1000337285 5:160251371-160251393 AGAGATTTATTTTAAGGAATTGG - Intergenic
1000873769 5:166609841-166609863 TCAGATATATACTCAGTAATGGG - Intergenic
1001188848 5:169606998-169607020 TAAGCTCTTTTTTAAGTATTTGG - Intergenic
1001327610 5:170740653-170740675 TCAGAGCTAGTTTTAGGAATAGG - Intergenic
1001327886 5:170742680-170742702 ACTGATTTATTTTAAGGAATGGG - Intergenic
1001410976 5:171511449-171511471 ACAGATTTATTTTAAGGAATTGG + Intergenic
1001414917 5:171538796-171538818 AGAGATTTATTTTAAGGAATTGG + Intergenic
1003435878 6:6087503-6087525 AGAGATTTATTTTAAGGAATTGG - Intergenic
1003626902 6:7749469-7749491 TCAGATCTATTTTCAGAACGAGG + Intronic
1003865582 6:10359592-10359614 TAAGATGTATTTTAAGAAATTGG + Intergenic
1004674341 6:17826632-17826654 TTAGATCTCTTTTAACAAATGGG - Intronic
1005117499 6:22354984-22355006 AGAGATTTATTTTAAGAAATTGG - Intergenic
1005784911 6:29234499-29234521 TCAAATCTATGTTAATTCATGGG - Intergenic
1005805539 6:29471257-29471279 TCAGGTCTATTTTAAGCTCTGGG + Intergenic
1006260528 6:32865441-32865463 AGAGATTTATTTTAAGTAATTGG + Intergenic
1006344467 6:33468841-33468863 AAAGATTTATTTTAAGGAATTGG + Intergenic
1006950047 6:37814216-37814238 TGAGATTTATTATAAGGAATTGG - Intergenic
1006969423 6:38026081-38026103 TAATTTATATTTTAAGTAATAGG - Intronic
1008006447 6:46414777-46414799 ACAGATTTGTTTTAAGGAATTGG - Intronic
1008334732 6:50288664-50288686 TTAGGTATATTTTAAGTTATGGG - Intergenic
1008449783 6:51637123-51637145 TCAAGTTTATTTTAAGGAATAGG - Intronic
1008693434 6:54006538-54006560 TCAGATTTATTTGAAATCATGGG + Intronic
1010502616 6:76619548-76619570 TAAGATCTATTTTAAGAGAGAGG - Intergenic
1010661586 6:78577625-78577647 TCTTCTCTATTTTCAGTAATGGG + Intergenic
1010917371 6:81636762-81636784 TCAGATTTAATTTAATAAATTGG + Intronic
1010941765 6:81927432-81927454 TCAGATCTGCTTTAAGTAGATGG + Intergenic
1011715482 6:90100645-90100667 ACAGATTTATTTTAAAGAATTGG - Intronic
1011938505 6:92812969-92812991 TCTGATATAATTTAAGTATTTGG + Intergenic
1012060351 6:94470624-94470646 TGAGATTTATTTAAAGAAATTGG + Intergenic
1012071399 6:94622865-94622887 TAAGGTCTATTTTGACTAATAGG + Intergenic
1012269799 6:97194489-97194511 CCAGATCTATTCTAAGTGTTTGG - Intronic
1012322678 6:97869879-97869901 GCAGAAATATTTTAAGTCATCGG + Intergenic
1012682469 6:102199584-102199606 CCAAATCTATTTTAAATAATAGG + Intergenic
1013220420 6:108073113-108073135 ACAGATTTATTTTAAATAACAGG + Intronic
1015128022 6:129776214-129776236 GGAGATTTATTTTAAGGAATTGG + Intergenic
1015196399 6:130528765-130528787 GCATATCTTATTTAAGTAATTGG - Intergenic
1015780319 6:136858680-136858702 TTAGTTCTATTTGAGGTAATGGG + Intronic
1016158965 6:140852296-140852318 TGAGATTTATTATAAGGAATTGG + Intergenic
1016223262 6:141702903-141702925 ATAGATTTATTTTAAGTAATTGG - Intergenic
1016491414 6:144608350-144608372 TGAGATTTATTTTAGGAAATTGG - Intronic
1016509573 6:144826191-144826213 TCAGATCTATTTTCAGAACCAGG - Intronic
1016515405 6:144888053-144888075 TGAGATTTATTTTAGGGAATTGG + Intergenic
1016579330 6:145611499-145611521 ATAGAAATATTTTAAGTAATGGG + Intronic
1017685067 6:156905280-156905302 ACAGATTTATTATAAGGAATTGG + Intronic
1018103502 6:160462472-160462494 TCAGTTTTATTTTAAATAGTAGG - Intergenic
1018282051 6:162197478-162197500 TCAGTTATATTTTAAGTACAAGG + Intronic
1019967645 7:4513065-4513087 AGAGATTTATTTTAAGGAATTGG - Intergenic
1020885647 7:13816276-13816298 TGAGATTTATTTTAAGGAACTGG + Intergenic
1021354035 7:19632012-19632034 TCAGCTCTACTTTAAGTGTTTGG - Intergenic
1021371034 7:19847382-19847404 TCAGATATATTTAATGTTATTGG + Intergenic
1021453826 7:20807559-20807581 TCAGCTCTATGATATGTAATAGG - Intergenic
1021513471 7:21458711-21458733 CCAGATCTATCTTCAGTAGTAGG - Intronic
1021993773 7:26160494-26160516 ACAGATTTATTTCAAGGAATTGG + Intronic
1022160571 7:27706456-27706478 AGAGATTTATTTTAAGGAATTGG - Intergenic
1022455180 7:30552446-30552468 TGAGATTTATTTTAAGGAATGGG + Intergenic
1022482063 7:30750857-30750879 TCAGATCTATTTTAAGTAATTGG - Intronic
1023520311 7:41043911-41043933 TCTCATTTATTTTAATTAATAGG + Intergenic
1023601383 7:41884760-41884782 TGAGATTTATTTCAAGGAATTGG - Intergenic
1023805908 7:43872854-43872876 TCAGCTCTATTCTGAGAAATAGG + Intronic
1023994728 7:45152308-45152330 AGAGATTTATTTTAAGGAATTGG + Intergenic
1024013841 7:45293715-45293737 GTAGATTTATTTTAAGGAATTGG + Intergenic
1024345291 7:48307097-48307119 AGAGATTTATTTTAAGGAATTGG - Intronic
1024721839 7:52145565-52145587 AGAGATTTATTTTAAGCAATTGG - Intergenic
1026094317 7:67330658-67330680 TCAGATCTGTTTTCAGAAAGAGG - Intergenic
1026144336 7:67733490-67733512 AGAGATTTATTTTAAGGAATTGG + Intergenic
1026402088 7:70024662-70024684 AGAGATTTATTTTAAGGAATTGG + Intronic
1026531421 7:71201128-71201150 TTAAATCCATTTTCAGTAATTGG + Intronic
1027367119 7:77470001-77470023 ACATATCTATGTTAAGTATTTGG - Intergenic
1027855912 7:83511002-83511024 TCAGATTTATTATAATTAAAAGG + Intronic
1029797824 7:102913707-102913729 TCAGATCTATTTTAAGAGCATGG - Intronic
1030279182 7:107752603-107752625 TCAGCTTTACTTTAGGTAATTGG + Intronic
1030518791 7:110570761-110570783 TTAGTCCTATTTTAAGTATTAGG + Intergenic
1030608364 7:111662473-111662495 AGAGATTTATTTTAAGGAATTGG + Intergenic
1030789971 7:113712459-113712481 ACAGATTTATTTTAAGGAATTGG - Intergenic
1031126747 7:117782317-117782339 TTAGGTATATTTTAATTAATAGG + Intronic
1031705208 7:124972503-124972525 AGAGATTTATTTTAAGGAATTGG + Intergenic
1032793645 7:135260354-135260376 CGAGATTTATTTTAAGAAATTGG + Intergenic
1033310474 7:140258236-140258258 AGAGATTTATTTTAAGGAATTGG - Intergenic
1035197991 7:157239131-157239153 TCACATGTATTCTAATTAATAGG - Intronic
1035587747 8:788714-788736 TCAGATTTCTTTTAAGAAGTGGG + Intergenic
1036836558 8:12074177-12074199 TTAGATATATACTAAGTAATGGG + Intergenic
1036858399 8:12320746-12320768 TTAGATATATACTAAGTAATGGG + Intergenic
1037535742 8:19822368-19822390 TCAGAACTATATGAAGTAATGGG - Intronic
1037596565 8:20359147-20359169 AGAGATTTATTTTAAGGAATTGG - Intergenic
1038519063 8:28213906-28213928 TGAGATTTATTTTAAGGAATTGG + Intergenic
1038826542 8:31008904-31008926 TCAGCTCTATTTTTAGGTATTGG - Intronic
1038835839 8:31121882-31121904 TATGATCTAATTTAAATAATTGG + Intronic
1039334746 8:36576545-36576567 AGAGATTTACTTTAAGTAATTGG - Intergenic
1040719025 8:50294409-50294431 AGAGATCTATTTTAAGGAATTGG + Intronic
1040931706 8:52741887-52741909 TCAGGTCTATTTTAACAAAGAGG + Intronic
1040995569 8:53397939-53397961 AGAGATTTATTTTAAGGAATTGG + Intergenic
1041021871 8:53646026-53646048 TGAGATTTAATTTAAGGAATTGG - Intergenic
1041140009 8:54807704-54807726 AGAGATTTATTTTAAGGAATTGG + Intergenic
1041203036 8:55470054-55470076 TCAGCTCTATCTGATGTAATGGG + Intronic
1041784202 8:61613374-61613396 AGAGATTTATTTTAAGGAATTGG - Intronic
1042848255 8:73189792-73189814 GAAGACCTATTTTAAGGAATTGG - Intergenic
1043040589 8:75257939-75257961 AGAGATTTATTTTAAGAAATTGG + Intergenic
1043120619 8:76318332-76318354 AGAGATTTATTTTAAGCAATTGG - Intergenic
1043122466 8:76344789-76344811 TCAGATCAATTTTTAGAGATAGG - Intergenic
1043440638 8:80274218-80274240 TCAGATGTGTTTTAAGGATTAGG - Intergenic
1043920232 8:85974221-85974243 CCAGAGCTCTTTTAGGTAATAGG - Intergenic
1044132408 8:88540767-88540789 TCATATTTATTTTAAGCAGTGGG + Intergenic
1044524151 8:93232596-93232618 TCAGGTTTATTTTAAGCAACAGG - Intergenic
1044575249 8:93761776-93761798 TCAGCACTATTTTATGTACTTGG + Intronic
1045697281 8:104823836-104823858 TTAGATATATTCTTAGTAATGGG - Intronic
1045706241 8:104926391-104926413 GGAGATTTATTTTAAGAAATTGG - Intronic
1046481876 8:114831089-114831111 TCATATCTGTTTTCAGTAACGGG + Intergenic
1046535379 8:115502296-115502318 TCTCATCTGTTTTAAGCAATTGG - Intronic
1046665885 8:117002392-117002414 TCAGTTCTATTTAAAGTACTTGG - Intronic
1046945690 8:119972190-119972212 TCTGATCTACTCTAAATAATAGG + Intronic
1047054388 8:121147829-121147851 TCAGATCTGTCTTCAGTACTTGG + Intergenic
1047185756 8:122631791-122631813 AGAGATTTATTTTAAGGAATTGG + Intergenic
1047630770 8:126705588-126705610 CGAGATTTATTTTAAGGAATTGG + Intergenic
1048016629 8:130502993-130503015 AGAGATTTATTTTAAGGAATTGG + Intergenic
1048357578 8:133666093-133666115 AGAGATTTATTTTAAGGAATTGG - Intergenic
1048550494 8:135428909-135428931 AGAGATTTATTTTAAGGAATTGG - Intergenic
1048682899 8:136865942-136865964 TCAGTTCCATTTTGAGGAATGGG + Intergenic
1048889916 8:138937635-138937657 AGAGATGTATTTTAAGAAATTGG - Intergenic
1050138503 9:2493573-2493595 TCAGGTGTATTTTAAATGATGGG + Intergenic
1050451944 9:5791206-5791228 TGAGATTTATTTTAAGGAACTGG + Intronic
1050561729 9:6841133-6841155 GCAGATCTTTTTTTAATAATTGG + Intronic
1051096383 9:13470768-13470790 TCAGATCACTTTTAATTTATGGG + Intergenic
1051153292 9:14109842-14109864 TGAGATATATTTTCAGTGATAGG + Intronic
1051293662 9:15571974-15571996 TTAGATTTATTTTAATTAATGGG + Intronic
1051454076 9:17232974-17232996 TCTGTTCTATTTTAATTATTAGG - Intronic
1051955668 9:22690513-22690535 TCAGATATATTTTCATTAACTGG + Intergenic
1052064891 9:24006016-24006038 TCAGATCTATTTAAAGTAGCAGG + Intergenic
1052142917 9:25009573-25009595 TCAGATTTATTAAGAGTAATGGG - Intergenic
1052188274 9:25625588-25625610 TCAGATATGTTCCAAGTAATGGG + Intergenic
1052894299 9:33732987-33733009 CCAGATTTATTTTAAATGATGGG + Intergenic
1053223793 9:36333760-36333782 TCACAGCTATTTAAAATAATTGG - Intergenic
1053239418 9:36484548-36484570 TCAGATTTTTTTTAAGTAATAGG + Intronic
1054697554 9:68375618-68375640 CCAGATTTATTTTAAGTTCTTGG + Intronic
1055004603 9:71491257-71491279 CCATATCTATATGAAGTAATTGG + Intergenic
1056105766 9:83344762-83344784 TGAGATTTATTATAAGGAATTGG - Intronic
1057319430 9:93998849-93998871 ACAGATTTATTATAAGGAATTGG + Intergenic
1058460750 9:105180191-105180213 AGAGATTTATTTTAAGAAATCGG - Intergenic
1058523017 9:105830676-105830698 ATAGATTTATTTTAAGGAATTGG - Intergenic
1058865646 9:109159910-109159932 ACAGATTTATTTTAAGGAACTGG - Intronic
1059263692 9:113005506-113005528 TCAGTACTGTTTTAAGTATTGGG + Intergenic
1059421571 9:114195725-114195747 TCTGATCTATTTTACATACTGGG - Intronic
1060017017 9:120095645-120095667 GGAGATCTATTATAAGAAATTGG + Intergenic
1060393545 9:123299775-123299797 CCAGATCTATTTAAAGAAACAGG - Intergenic
1060701433 9:125753144-125753166 TCATATCAATTTTAAGCATTAGG + Intronic
1061501074 9:131002342-131002364 AGAGATTTATTTTAAGGAATTGG - Intergenic
1203617404 Un_KI270749v1:80173-80195 ATAGATTTATTTTAAGAAATTGG + Intergenic
1186082897 X:5952665-5952687 ATTGATCTATTTTAAGGAATTGG + Intronic
1186675351 X:11811205-11811227 ACAGATTTATTTTAAGGCATTGG + Intergenic
1188422188 X:30003701-30003723 TTTTATCTATTTTAAGTCATTGG - Intergenic
1188657030 X:32710430-32710452 TCAGATTATTTTTAAGTGATAGG + Intronic
1188970266 X:36606621-36606643 TCACTTCTCTATTAAGTAATCGG - Intergenic
1190016782 X:46834650-46834672 TCAGATCTGTTCTAAGCAAATGG - Intergenic
1190408047 X:50107142-50107164 AGAGATTTATTTTAAGGAATTGG + Intergenic
1191629150 X:63302214-63302236 TGGGATCTATTTTAAGTAAAGGG + Intergenic
1191673627 X:63772023-63772045 AGAGATTTATTTTAAGGAATTGG - Intronic
1191977217 X:66886616-66886638 TATGATTTATTTTAAGGAATTGG + Intergenic
1192548971 X:72038443-72038465 TCAGATCTTTTCTAAGAAACAGG + Intergenic
1192789166 X:74364264-74364286 AAAGATTTATTTTAAGGAATTGG - Intergenic
1194348019 X:92790618-92790640 ACAGATTTATTTTAAGAAATTGG + Intergenic
1194562316 X:95437832-95437854 AGAGATTTATTTTAAGGAATTGG + Intergenic
1194725161 X:97387379-97387401 ACAGATTTATTTTATGGAATTGG + Intronic
1195262671 X:103148771-103148793 AGAGATTTATTTTAAGAAATTGG + Intergenic
1195274497 X:103268172-103268194 TCATAGCTATTTTAAATTATTGG + Intergenic
1195826696 X:109010084-109010106 TCAAATCTCTTTTAAGTTACAGG + Intergenic
1196251169 X:113461811-113461833 TTTTATTTATTTTAAGTAATTGG - Intergenic
1196944098 X:120807004-120807026 AGAGATTTATTTTAAGGAATTGG - Intergenic
1197321056 X:125031507-125031529 TCATTTGTATTTTAAGTTATAGG + Intergenic
1197486856 X:127062661-127062683 ACTGATTTATTTTAAGGAATTGG - Intergenic
1198623263 X:138537678-138537700 TTAGATTTATTTCTAGTAATAGG - Intergenic
1199611423 X:149619291-149619313 TCAGAAATATTTTAATTACTGGG + Intronic
1200656347 Y:5907248-5907270 ACAGATTTATTTTAAGAAATTGG + Intergenic