ID: 1022482063 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:30750857-30750879 |
| Sequence | TCAGATCTATTTTAAGTAAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022482063_1022482064 | 0 | Left | 1022482063 | 7:30750857-30750879 | CCAATTACTTAAAATAGATCTGA | No data | ||
| Right | 1022482064 | 7:30750880-30750902 | TTCTCTCAGTGTACACAAGCTGG | No data | ||||
| 1022482063_1022482065 | 1 | Left | 1022482063 | 7:30750857-30750879 | CCAATTACTTAAAATAGATCTGA | No data | ||
| Right | 1022482065 | 7:30750881-30750903 | TCTCTCAGTGTACACAAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022482063 | Original CRISPR | TCAGATCTATTTTAAGTAAT TGG (reversed) | Intronic | ||