ID: 1022482064

View in Genome Browser
Species Human (GRCh38)
Location 7:30750880-30750902
Sequence TTCTCTCAGTGTACACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022482062_1022482064 15 Left 1022482062 7:30750842-30750864 CCACAATTATACAAGCCAATTAC 0: 1
1: 0
2: 4
3: 48
4: 288
Right 1022482064 7:30750880-30750902 TTCTCTCAGTGTACACAAGCTGG No data
1022482063_1022482064 0 Left 1022482063 7:30750857-30750879 CCAATTACTTAAAATAGATCTGA 0: 1
1: 0
2: 3
3: 50
4: 565
Right 1022482064 7:30750880-30750902 TTCTCTCAGTGTACACAAGCTGG No data
1022482061_1022482064 18 Left 1022482061 7:30750839-30750861 CCTCCACAATTATACAAGCCAAT 0: 1
1: 1
2: 16
3: 140
4: 647
Right 1022482064 7:30750880-30750902 TTCTCTCAGTGTACACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022482064 Original CRISPR TTCTCTCAGTGTACACAAGC TGG Intronic
No off target data available for this crispr