ID: 1022482065 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:30750881-30750903 |
Sequence | TCTCTCAGTGTACACAAGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022482061_1022482065 | 19 | Left | 1022482061 | 7:30750839-30750861 | CCTCCACAATTATACAAGCCAAT | No data | ||
Right | 1022482065 | 7:30750881-30750903 | TCTCTCAGTGTACACAAGCTGGG | No data | ||||
1022482062_1022482065 | 16 | Left | 1022482062 | 7:30750842-30750864 | CCACAATTATACAAGCCAATTAC | 0: 1 1: 0 2: 4 3: 48 4: 288 |
||
Right | 1022482065 | 7:30750881-30750903 | TCTCTCAGTGTACACAAGCTGGG | No data | ||||
1022482063_1022482065 | 1 | Left | 1022482063 | 7:30750857-30750879 | CCAATTACTTAAAATAGATCTGA | No data | ||
Right | 1022482065 | 7:30750881-30750903 | TCTCTCAGTGTACACAAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022482065 | Original CRISPR | TCTCTCAGTGTACACAAGCT GGG | Intronic | ||