ID: 1022490090

View in Genome Browser
Species Human (GRCh38)
Location 7:30810358-30810380
Sequence GTTTATGTGCAAGGTGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022490088_1022490090 10 Left 1022490088 7:30810325-30810347 CCTGAATGTAAAACTATTGAAAA 0: 19
1: 73
2: 39
3: 74
4: 526
Right 1022490090 7:30810358-30810380 GTTTATGTGCAAGGTGTACAAGG No data
1022490087_1022490090 13 Left 1022490087 7:30810322-30810344 CCTCCTGAATGTAAAACTATTGA 0: 61
1: 51
2: 26
3: 30
4: 173
Right 1022490090 7:30810358-30810380 GTTTATGTGCAAGGTGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022490090 Original CRISPR GTTTATGTGCAAGGTGTACA AGG Intronic
No off target data available for this crispr