ID: 1022490100

View in Genome Browser
Species Human (GRCh38)
Location 7:30810525-30810547
Sequence ACATATTAGCTACAGTTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 22, 2: 99, 3: 127, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022490100 Original CRISPR ACATATTAGCTACAGTTAAA GGG Intronic
900459109 1:2791940-2791962 AAATATTAGCGACAGTAGAAGGG - Intronic
904570099 1:31457406-31457428 ACATATTGGCTAAAGTTAAGGGG - Intergenic
905428625 1:37904471-37904493 ACATACTGGCTAAAGTTAAGAGG + Intronic
905657376 1:39693331-39693353 ACACATTAGCTATTGTTAAGGGG - Intronic
905984635 1:42268153-42268175 CCATATTAATTACAGTGAAAGGG + Intronic
906506698 1:46385351-46385373 AAACATTGGCTAAAGTTAAATGG - Intergenic
906859564 1:49344539-49344561 ACATACTGGCTAAAGTTAAAGGG + Intronic
909064829 1:70922886-70922908 ACACACTGGCTAAAGTTAAAGGG + Intronic
909428084 1:75551218-75551240 ACTCATTAGCTGCAGTAAAATGG - Intronic
909575886 1:77175720-77175742 ACATATTGGCTACAGTTAAAGGG + Intronic
909605464 1:77503413-77503435 ACATATTGGCTAAATTTAAAGGG + Intronic
911226145 1:95307601-95307623 AGAAATTAGCTACAGAAAAAAGG - Intergenic
911299535 1:96155639-96155661 ACATATTGACTACATTCAAAAGG - Intergenic
912442173 1:109707604-109707626 AGAGATTAGCTACAGGAAAATGG + Intronic
912815928 1:112828334-112828356 ACATATTGGCTAAAGTTAAAGGG + Intergenic
912980510 1:114367055-114367077 ACATATTGGCTAAAGTTAAAGGG - Intergenic
915655688 1:157357926-157357948 ACATATTGGCTAAAGTTAAAGGG + Intergenic
915665850 1:157444277-157444299 ACATATTGGCTAAATTTAAAGGG - Intergenic
916035605 1:160919921-160919943 ACATATCAGCTAAATTTAAAGGG - Intergenic
916640356 1:166721842-166721864 ACATATTGGCTAAATTTAAAGGG + Intergenic
916954472 1:169817920-169817942 ACATATTGGCTAAAGTTAAAGGG - Intronic
917311860 1:173687034-173687056 ACATATTGGCTAAAGTTAAGGGG - Intergenic
918175283 1:182038608-182038630 ACATATTAACTAAATTCAAAAGG - Intergenic
918589609 1:186225718-186225740 ACATATTGGCTAAAGTTAAATGG + Intergenic
918704461 1:187642828-187642850 ACATATTAACTAAATTCAAAAGG + Intergenic
919142818 1:193594490-193594512 GCCTATTAGGTACAGTTTAATGG - Intergenic
919298942 1:195736358-195736380 ACATATTAGCTAAAATTAAAGGG + Intergenic
919301711 1:195777893-195777915 TTATATTAGCCACAGATAAATGG + Intergenic
921489407 1:215756226-215756248 ACCTATTAGCTGAACTTAAACGG - Intronic
921788345 1:219260365-219260387 AAATATTAGATACAGTGGAATGG + Intergenic
923052846 1:230401024-230401046 GCATATTATCTACAGTTACCTGG + Intronic
923071615 1:230570422-230570444 AGATAATAGCAACAGTGAAAAGG - Intergenic
923726636 1:236511251-236511273 TCAAATTAGCTCCAGTGAAACGG + Intergenic
923953152 1:238983589-238983611 ACATTTTAGCAACCCTTAAAAGG - Intergenic
924321752 1:242857925-242857947 AAGTATTAGCCACTGTTAAAAGG + Intergenic
924828144 1:247563452-247563474 AAATATTAAATACAATTAAAAGG - Intronic
1063301858 10:4856305-4856327 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1063332217 10:5171751-5171773 ACATATTGGCTAAGGTTAAAGGG - Intergenic
1064175269 10:13069302-13069324 ACATATTAACTACATTCAAATGG + Intronic
1066083900 10:31958583-31958605 ATACATTAGCTAAAATTAAAGGG - Intergenic
1067326936 10:45278126-45278148 ATATATTGGCTAAAGTTGAAAGG - Intergenic
1067464057 10:46481150-46481172 ACATATTGGCTAAATTTAAAGGG + Intergenic
1067623138 10:47903501-47903523 ACATATTGGCTAAATTTAAAGGG - Intergenic
1067822902 10:49546246-49546268 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1068564461 10:58557564-58557586 AGAAATTATCTAAAGTTAAATGG - Intronic
1068634622 10:59335009-59335031 AAATATTAGCTCCTCTTAAAAGG + Intronic
1069086644 10:64147851-64147873 ACACAATAGCTAAAATTAAAAGG - Intergenic
1069206191 10:65689468-65689490 ACAAGTTAGCCACAGTTAAAAGG - Intergenic
1069681113 10:70286086-70286108 AAATATGAGCTACAATTACAGGG + Intergenic
1069936081 10:71917810-71917832 ACATATTGGCTAAGGTTAAAGGG - Intergenic
1070483064 10:76904170-76904192 ACATTTTTTCTACTGTTAAATGG - Intronic
1071392178 10:85186885-85186907 ACATATTGGCTAAAGTTGAAAGG - Intergenic
1073531320 10:104234407-104234429 ACATACTGGCTAAAGTTACAGGG + Intergenic
1074661447 10:115662524-115662546 ACAAATTGGCTACAGGTAACTGG - Intronic
1074959488 10:118428364-118428386 ACATATTAGTTAGTTTTAAATGG + Intergenic
1075224458 10:120613879-120613901 AAATATTAATTACAGTCAAATGG + Intergenic
1075505855 10:123021382-123021404 ACATATTGACTACATTCAAAAGG - Intronic
1075681096 10:124332409-124332431 ACAGATTACCTACAATTAGATGG + Intergenic
1075984872 10:126776222-126776244 GGATTTTAGCTAAAGTTAAAAGG + Intergenic
1076929270 10:133518866-133518888 ACATATTAGGGAAAGTTATAGGG - Intergenic
1077398572 11:2340280-2340302 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1079235534 11:18686617-18686639 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1079717662 11:23768906-23768928 ACATATTGCCCAAAGTTAAAAGG - Intergenic
1080058319 11:27930739-27930761 ACATATTGGCTAAAATTAAAGGG - Intergenic
1080288445 11:30642858-30642880 ACATACTGGCTAAAGCTAAAGGG + Intergenic
1080321742 11:31018008-31018030 ACAAAATATCCACAGTTAAAAGG - Intronic
1080443954 11:32320147-32320169 ACATATTGGCTTCAATTAAAAGG + Intergenic
1081250810 11:40830895-40830917 ACTTATTAGCTGCAGTAAAGTGG + Intronic
1081387411 11:42487924-42487946 ACATTTTAAATACAGGTAAAAGG + Intergenic
1082733800 11:56832824-56832846 ACAAATAAGTTAAAGTTAAAAGG + Intergenic
1082866580 11:57905237-57905259 ACACATTGGCTAAAGTTAAAGGG - Intergenic
1083001426 11:59295262-59295284 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1083001443 11:59295605-59295627 ACATATTGGCTACAGTTAAAGGG - Intergenic
1083011452 11:59404254-59404276 ACATATTGGATAAAGTTAAAGGG + Intergenic
1083089796 11:60188081-60188103 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1083390907 11:62349324-62349346 ACATTTAGGCTATAGTTAAAAGG - Intronic
1084878460 11:72152015-72152037 ACATGTTGGCTAAAGTTAAAGGG - Intergenic
1085239694 11:75042706-75042728 ACATATTAGCTAAAGTTAAAGGG + Intergenic
1086973556 11:93108607-93108629 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1086987376 11:93265220-93265242 ACATATTGGCTAAAGTTAAAAGG + Intergenic
1087227044 11:95613070-95613092 ACCTATTGGCTAAAGTTAAATGG - Intergenic
1087640132 11:100747557-100747579 ACACATTGGGTAAAGTTAAAGGG - Intronic
1087825084 11:102755953-102755975 ACAGATTAGCCACATTTCAAAGG - Intergenic
1090407911 11:126488391-126488413 ACATATTAGCTCCACTTTACAGG - Intronic
1090455657 11:126846892-126846914 ACATATTGGCTAAAGTTAAGGGG + Intronic
1091814607 12:3427406-3427428 ACATATTGACTAAAGTTAAAGGG - Intronic
1092630284 12:10369302-10369324 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1092653354 12:10658085-10658107 ACATATCGGCTAAAGTTAAAGGG + Intronic
1093519514 12:20032045-20032067 AGATATTAGTTACACTCAAATGG + Intergenic
1093594227 12:20942270-20942292 ACATATTAGCTAAAGTTGAAGGG - Intergenic
1093920984 12:24858941-24858963 AAATATTAGCTAAAGTTAAAGGG + Intronic
1094100306 12:26754723-26754745 ACATATTGGCTAAAGTTAAAGGG + Intronic
1094594267 12:31849762-31849784 ACAGATTGGCTAAAGTTAAAGGG + Intergenic
1095365044 12:41393311-41393333 ACATATTAGATTTATTTAAAAGG + Intronic
1096658903 12:53109978-53110000 ACATATTGGCTAAAGTTAAAGGG - Intronic
1096923034 12:55110326-55110348 ACATATTGACTACATTCAAAAGG - Intergenic
1098005095 12:65988186-65988208 CCATATTGGCTAAAGTTAAAGGG - Intergenic
1098069910 12:66662206-66662228 AGATATTAGCCACAGTTAGAGGG - Intronic
1098248299 12:68542862-68542884 ACATATTAGCTAAAGTTAAAGGG + Intergenic
1098294246 12:68987724-68987746 ACATATTGGCTACATTTAAAGGG + Intergenic
1099244182 12:80174622-80174644 ACATATTGGCTAAAGTTCAGAGG + Intergenic
1100142159 12:91632431-91632453 AAGTATTGGCAACAGTTAAAAGG - Intergenic
1105778430 13:23684087-23684109 ACATATTGGCTAAAATTAAAGGG + Intergenic
1107922759 13:45227495-45227517 ACATATAAGCTGTAGATAAAGGG - Intronic
1107988316 13:45795100-45795122 ATAAATTAGCTATATTTAAAAGG - Intronic
1108461408 13:50671036-50671058 AAATATTAGAGAGAGTTAAAAGG + Intronic
1109346030 13:61115305-61115327 ACATACTGGATAAAGTTAAAGGG + Intergenic
1109587327 13:64423667-64423689 ACATATTGGATAAAGTTTAAAGG + Intergenic
1109643180 13:65218660-65218682 TTATATCAGCTATAGTTAAAGGG - Intergenic
1109909602 13:68891979-68892001 ACATATTGGCTACATTTAAAGGG - Intergenic
1110712798 13:78668189-78668211 ACATATTAACTAAATTCAAAAGG - Intergenic
1110971874 13:81773917-81773939 AGATAATAGCTAAAGGTAAAAGG - Intergenic
1113898398 13:113781275-113781297 ACATATTGGCTAAAGTTAAAGGG - Intronic
1113990960 14:16026977-16026999 ACATATTTGCTAGAGTTACATGG - Intergenic
1114070464 14:19100948-19100970 TGATATTAGCTGCAGTTAAGCGG - Intergenic
1114091797 14:19299051-19299073 TGATATTAGCTGCAGTTAAGCGG + Intergenic
1114236193 14:20825939-20825961 GCATATTGGCTAAAGTTAAAGGG - Intergenic
1114256523 14:21007069-21007091 AAATATTGGCTAAAGTTAAAAGG + Intergenic
1114334945 14:21678843-21678865 ACATATTGACTAAATTTAAAAGG + Intergenic
1114400093 14:22402218-22402240 CCATATTACCTACATGTAAATGG - Intergenic
1114584025 14:23793358-23793380 ACATATTGGCTAAAATTAAAGGG - Intergenic
1115482224 14:33871938-33871960 ACATATTGGCTAAAGTTAAGGGG + Intergenic
1116423042 14:44755710-44755732 ACATTTTAGCTATTATTAAAGGG - Intergenic
1116725765 14:48560041-48560063 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1117179640 14:53178974-53178996 ACATATTGGCCAAAGTTAAAGGG - Intergenic
1117524636 14:56585732-56585754 AAAAATTAGCAACAGTTAGAAGG - Intronic
1117955294 14:61118451-61118473 ATATATTGGCTAAAGTTAAAGGG - Intergenic
1119822796 14:77633025-77633047 ACATATTGGCTAAAATTAAAGGG - Intergenic
1120174531 14:81278757-81278779 ACATATGAGCTACTGTTCAGGGG + Intronic
1120714537 14:87826268-87826290 ACATATTGTCTAAAGTTAATGGG - Intergenic
1121003928 14:90474684-90474706 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1122174115 14:99904240-99904262 ACATATTGGCTAAAGTTAAAGGG - Intronic
1122382622 14:101320078-101320100 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1122591882 14:102859058-102859080 ACATACTGGCTGAAGTTAAAGGG - Intronic
1122841544 14:104466806-104466828 ACATATTGCCTGCAGATAAAGGG + Intergenic
1202943002 14_KI270726v1_random:412-434 AGAAAATAGCTACAGATAAAAGG + Intergenic
1123478114 15:20606043-20606065 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1123488534 15:20762298-20762320 ACATCATAGCTAATGTTAAAAGG - Intergenic
1123545031 15:21331371-21331393 ACATCATAGCTAATGTTAAAAGG - Intergenic
1123639901 15:22394341-22394363 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1123824289 15:24065965-24065987 ACATATTGGGGAAAGTTAAAGGG - Intergenic
1124178008 15:27444618-27444640 ACATATTAGATATATTAAAAAGG - Intronic
1127013998 15:54662634-54662656 AAATTCTAGCTACAGTTCAATGG - Intergenic
1127612784 15:60653243-60653265 ACATATGAGCCACAGATACAAGG + Intronic
1128831106 15:70769688-70769710 ACATTTTATCTACACTTATATGG - Intergenic
1129529421 15:76251271-76251293 ACATATTAGCAAAATTAAAAAGG + Intronic
1129918134 15:79293266-79293288 TCATATTGGCTACAGTTTAGAGG - Exonic
1129918604 15:79298190-79298212 ACATATTAGAAACATCTAAAAGG - Exonic
1202953377 15_KI270727v1_random:58642-58664 ACATCATAGCTAATGTTAAAAGG - Intergenic
1132901672 16:2258772-2258794 ACATGCTGGCTAAAGTTAAAGGG + Intronic
1137041690 16:35618703-35618725 ACATATTAGCTAAAGTTAAAGGG - Intergenic
1137329375 16:47475843-47475865 TTATATAAGCCACAGTTAAAAGG - Intronic
1137811120 16:51353476-51353498 ATATATTAGCTAAGGTTATAAGG + Intergenic
1138724985 16:59126209-59126231 ATATAGAAGATACAGTTAAAGGG + Intergenic
1139027104 16:62832229-62832251 AAGTATTAGCTACATTTAATAGG + Intergenic
1139240939 16:65391573-65391595 ACATATTCCCTACAGATAAGGGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142123468 16:88398627-88398649 ACATATGAGCCACAGATGAAGGG + Intergenic
1144461447 17:15461773-15461795 AAATATAGGCTACAGATAAAAGG + Intronic
1144552176 17:16250393-16250415 ACATATCATCCACAGGTAAAAGG + Intronic
1144555453 17:16278576-16278598 ACATATTAGCTAAAATTAAAGGG - Intronic
1144746553 17:17619360-17619382 ACATATAGACTAAAGTTAAAAGG + Intergenic
1146670718 17:34735701-34735723 ACATCTTACCTACAGTTGTATGG - Intergenic
1146764062 17:35503254-35503276 ATATATTAGCTAAAGTTAAAGGG + Intronic
1148367582 17:47068054-47068076 ACATATCGGCTAAAGTTAAAGGG - Intergenic
1148632737 17:49124889-49124911 ACATATTGGCTAAAGTTGAAGGG - Intergenic
1148829060 17:50417806-50417828 GCATATTAGCTAAAGTTAAAGGG - Intergenic
1149212831 17:54323564-54323586 AATTATTGGCTAAAGTTAAAGGG - Intergenic
1149812560 17:59691727-59691749 ACTTTTTATCTACAGTAAAAAGG - Intronic
1150349006 17:64427941-64427963 ACATACTGGCTAAAGTTAAAGGG - Intergenic
1150349558 17:64432502-64432524 ATATATTGGCTAAAGTTAAAGGG + Intergenic
1152454836 17:80408341-80408363 ACGTATTAGCTAAAGTTAAAGGG + Intergenic
1153068105 18:1070883-1070905 ACATTCTAGAGACAGTTAAAAGG + Intergenic
1153349382 18:4061402-4061424 ACATATTAGCTAAATTTAAAGGG + Intronic
1153440318 18:5110554-5110576 AAATATAAGATAAAGTTAAAAGG - Intergenic
1153512035 18:5865569-5865591 ACATATTTGCTAAAGTTAAAGGG + Intergenic
1153998831 18:10466105-10466127 AGATTTTAGCTAAAGTTACAAGG - Intronic
1154140978 18:11824111-11824133 ACATATTAGGTACATAAAAAAGG - Intronic
1154365474 18:13704344-13704366 ACATATTGACTAAACTTAAAGGG + Intronic
1155115347 18:22760576-22760598 ACATTTTGGCTACATTTAACAGG + Intergenic
1155746291 18:29359654-29359676 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1155850818 18:30771560-30771582 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1158864230 18:61622001-61622023 ACATATTGGCTAAAGTTGAAGGG + Intergenic
1159204056 18:65227318-65227340 TCATATTATCAACAGTTAAAGGG - Intergenic
1162281803 19:9704436-9704458 ATATATTAGCTAAAATTAAAGGG + Intergenic
1162667639 19:12228085-12228107 ACATATTGGCTAAAGTTGAAGGG - Intronic
1162711701 19:12599864-12599886 ACATATTGGCTAAAGTTAAAGGG + Intronic
1163867184 19:19783582-19783604 ACATATTAGCTAAAGTTAAAGGG - Intergenic
1163929230 19:20372964-20372986 ACATATGAGCTAAAGTTAAAGGG + Intergenic
1163976772 19:20860187-20860209 ACATATTGGCTAAAGTTAAAGGG + Intronic
1163991705 19:21004950-21004972 ACATATTAGCTAAAGTTAAAGGG + Intergenic
1164121662 19:22270968-22270990 ACATATTAGCTAAAGTTAAAGGG - Intergenic
1164130815 19:22359848-22359870 ACATATTGGCTAAAGTTAAAAGG - Intergenic
1164217051 19:23159981-23160003 AAACATCAGCTAAAGTTAAAGGG - Intergenic
1166249185 19:41554818-41554840 ACATATTGACTAAAGTTGAAGGG - Intronic
1166407465 19:42531206-42531228 ACATATAAGGTACAGTGATAAGG - Intronic
1166900811 19:46061060-46061082 ACATGTTGGCTAAAGTTAAAGGG - Intronic
1167879076 19:52440425-52440447 CCATATTTGCTACATTTAAAAGG - Intronic
1167906800 19:52667646-52667668 ACATACTGGCAAAAGTTAAAGGG + Intronic
1168611324 19:57803063-57803085 ACATATTGGCTAAAGTTAAAAGG - Intronic
1168611327 19:57803106-57803128 ACATACTGGCTAAAGTTAAGAGG - Intronic
1168672586 19:58252140-58252162 ATATATTGGCTAAAGTTAAAGGG - Intronic
924987481 2:285473-285495 CCTTATTAGCTACAGTGATAGGG - Intronic
926938348 2:18109610-18109632 ACATATTAGGTACAGGTGATAGG - Intronic
929479170 2:42286510-42286532 ACATATTAGCTATTGCTAAATGG + Intronic
930150998 2:48059829-48059851 ACATATTGGCTAAAATTAAAGGG - Intergenic
930428697 2:51246010-51246032 AAATATTAGCTAAAGGTATAGGG - Intergenic
930504603 2:52267145-52267167 ACATATTGGCTAAAGTTAAAGGG + Intergenic
931851544 2:66256147-66256169 AGATTTAAGCTACAGATAAAGGG - Intergenic
932188164 2:69716267-69716289 ACAAACTAGCTTCAGTTAAAAGG - Intronic
932210651 2:69926832-69926854 ACATATAAGCTACAGCCAATAGG + Intronic
933350705 2:81148749-81148771 ACTGATGAGATACAGTTAAAAGG - Intergenic
933614187 2:84467117-84467139 ACACACTGGCTAAAGTTAAAGGG - Intergenic
934138969 2:89026957-89026979 ACATAATAGCCACGGTGAAATGG + Intergenic
934230276 2:90173604-90173626 ACATAATAGCCACACTGAAATGG - Intergenic
935048259 2:99501253-99501275 ACGTATTGGCTAAAGTTATAAGG + Intergenic
935721577 2:105984193-105984215 ACATATTAGCTAAAGTTAAAGGG - Intergenic
935811490 2:106802112-106802134 ACATCTTGGCTACATTAAAATGG - Exonic
936648498 2:114399734-114399756 ATAGCTAAGCTACAGTTAAAAGG + Intergenic
936658658 2:114517748-114517770 ACAGAATAGCTAAAGTTTAACGG + Intronic
937057342 2:118950374-118950396 ACATATTGGCTAAAGTTAAAGGG - Intronic
937712274 2:124991537-124991559 AAATATTGGCTAAAGTTAAAGGG + Intergenic
938703060 2:133896424-133896446 ACATATTGGCTAAAGTTAAAGGG + Intergenic
939323272 2:140651902-140651924 ACATATTACCTTCAGAAAAAGGG + Intronic
939796550 2:146652399-146652421 ACAAAGTAGGTACAGTTAATAGG - Intergenic
939843662 2:147218817-147218839 ACATATTAGCTAAAGTTAAATGG - Intergenic
939971361 2:148664959-148664981 ATATAGTAGTTACATTTAAAAGG + Intronic
940144088 2:150526533-150526555 TCCCATTAGCTCCAGTTAAAGGG - Intronic
940377254 2:152970093-152970115 ACATATTGGCTAAAGTCAGAAGG - Intergenic
940499111 2:154472624-154472646 ACATATTGGCTAAATTTAAAGGG - Intergenic
940591505 2:155734014-155734036 ATATATTAGCTTCCTTTAAATGG - Intergenic
940924937 2:159354097-159354119 ATACATTATCTAAAGTTAAAAGG - Intronic
942091737 2:172498650-172498672 ACATTTTATTTACAGTCAAAGGG - Intronic
942194109 2:173500043-173500065 ACATATTCGCTAAAAGTAAATGG + Intergenic
943466706 2:188237345-188237367 ACATATTGACTAAAGTTAAAGGG + Intergenic
943666214 2:190611567-190611589 ACATATTGGCCAAAGTTAAAGGG - Intergenic
943969313 2:194383098-194383120 GAACATTAGCTAAAGTTAAAGGG - Intergenic
944040194 2:195344913-195344935 ACATATTTACTGCAGATAAAAGG + Intergenic
944110528 2:196127088-196127110 ACATATTAACTAAATTCAAAAGG - Intergenic
944291490 2:198011971-198011993 ACACATAGGCTACAGTAAAAGGG - Intronic
944452926 2:199861241-199861263 CAATATCAGCTACAGATAAATGG - Intergenic
945596243 2:211797994-211798016 ATACATTAACTACAGTAAAATGG + Intronic
945693189 2:213068129-213068151 ACATATAAGGTATAGTTAAAGGG + Intronic
947885297 2:233564580-233564602 CCAAATTAGCTAAATTTAAAAGG - Intronic
948156107 2:235783285-235783307 AAATGTTAGCTATAGGTAAAAGG - Intronic
1168822955 20:788512-788534 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1169114296 20:3053110-3053132 ATATATTAACTACTGTTAAGGGG + Intergenic
1171442059 20:25172840-25172862 ACATATTGGCCAAAGTAAAAGGG - Intergenic
1171770924 20:29322732-29322754 ACGTATTTGCTAGAGTTACATGG + Intergenic
1171905613 20:30896839-30896861 ACATATTTGCTAGAATTACATGG - Intergenic
1177346446 21:19878436-19878458 ACATATTACCTCCAGCCAAAAGG + Intergenic
1177414841 21:20780275-20780297 AAATATTAGGTATACTTAAAAGG - Intergenic
1177965697 21:27724210-27724232 ACATATTAGCTAAAATTAAAAGG - Intergenic
1178201915 21:30416648-30416670 ACATATTGGCTAAAGTTAAAGGG + Intronic
1178435805 21:32557381-32557403 ACATATTGGCTAAAATTAAAGGG - Intergenic
1178739253 21:35182377-35182399 GCATATTAACTAAAGTTACATGG + Intronic
1178814653 21:35917715-35917737 ACATATTTGCAACAATTAACAGG + Intronic
1180316310 22:11280548-11280570 ACATATTTGCTAGAGTTACATGG + Intergenic
1180339024 22:11602933-11602955 ACATATTTGCTAGAATTACATGG - Intergenic
1180488937 22:15823512-15823534 TGATATTAGCTGCAGTTAAGCGG - Intergenic
1182311751 22:29413817-29413839 AAACATTGGCTAAAGTTAAAGGG - Intronic
1182688523 22:32139509-32139531 ACATATTGGCTAAAGTTAAAGGG + Intergenic
949610067 3:5694945-5694967 ACATATTGGCTAAAGTTAAAGGG - Intergenic
949611047 3:5703853-5703875 ACATACTGGCTAAAGTTAAAAGG - Intergenic
950594490 3:13966947-13966969 ACATATTGGCTAAAGTTAAAGGG - Intronic
951897015 3:27619208-27619230 TCACATTAGCTACATTTGAAGGG + Intergenic
952294963 3:32053400-32053422 ACATACTGGCTAAAGTTAAAGGG + Intronic
952819536 3:37474309-37474331 TCATATTAGCCACATTTAAGTGG + Intronic
953336461 3:42098456-42098478 AATTATTAGCTGGAGTTAAATGG + Intronic
953416315 3:42720755-42720777 ACATACTGACTAAAGTTAAAGGG + Intronic
953424837 3:42786657-42786679 CAATATTAGTTTCAGTTAAAAGG + Intronic
954459930 3:50620577-50620599 ACAGAATAGCAACAGTTACAAGG - Intronic
954604636 3:51899608-51899630 ACATATTGGCTAAAGTTAAAGGG + Intronic
955381069 3:58438718-58438740 ACATATTGGCTAAAGTTAAAGGG - Intergenic
955626309 3:60923359-60923381 TCATATTACCTACAGGGAAATGG - Intronic
957501993 3:81069183-81069205 ACATATTGGCTAAAGTTGAAGGG + Intergenic
958056956 3:88426019-88426041 ATATATCAGCTACAGTTTCATGG + Intergenic
959568507 3:107857362-107857384 TCACATTAGCTACACTTCAAGGG + Intergenic
959710566 3:109381803-109381825 GCATATGTGCTACAGTTTAAAGG - Intergenic
959874758 3:111369650-111369672 ACATATTACCCACAGATAAGTGG - Intronic
960152135 3:114261090-114261112 ACATATTGGCTAAAGTTAAAGGG - Intergenic
960386899 3:117031358-117031380 ACATAATGGCTAAAGTTAGAGGG + Intronic
960514840 3:118592052-118592074 ACATATTAGCTAAAGATAAAGGG + Intergenic
960720459 3:120620225-120620247 ACATATTCGCTAAAGTTAAAGGG - Intergenic
961337859 3:126194617-126194639 ACATATTGACTAAATTTAAAGGG - Intronic
962066418 3:131986056-131986078 ACATATTAGTAACTGCTAAATGG + Intronic
962097276 3:132305305-132305327 ACATATTAGCTAAAGTTAAAGGG + Intergenic
962245924 3:133792835-133792857 ACATATTGACTAAATTTAAAGGG + Intronic
962623905 3:137205707-137205729 AAATGTTAACTGCAGTTAAAGGG - Intergenic
963612795 3:147493198-147493220 CCATATTAGCAATAGTTAAGAGG + Intronic
964855909 3:161145306-161145328 ACATATTGCCTAGAGTTTAAGGG + Intronic
964933153 3:162049925-162049947 ACATATTAGCTAAAGTTAAAGGG - Intergenic
965008133 3:163052933-163052955 ACATATTAACTAAATTCAAAAGG - Intergenic
965089583 3:164145509-164145531 TCATATTGGCTAAAGTTAAAGGG + Intergenic
965435943 3:168651706-168651728 ACAGAATAACTACATTTAAAAGG + Intergenic
965588230 3:170338443-170338465 ACATGTTGACTAAAGTTAAAGGG - Intergenic
966721383 3:183065758-183065780 ACATATTGTCTAAAGTTAAAGGG + Intronic
969143135 4:5097415-5097437 ACACATTAGCTTCATTTAGAAGG + Intronic
969634821 4:8361549-8361571 ACAAATGGGCTAAAGTTAAAGGG + Intergenic
970092706 4:12428220-12428242 ACATATTGGTTAAGGTTAAAGGG - Intergenic
971006522 4:22380183-22380205 ACATATTGGCTAAAGTTAAAGGG + Intronic
971944208 4:33253284-33253306 ACATGCTGGCTAAAGTTAAAGGG - Intergenic
972784883 4:42317408-42317430 ACATATTGGCTAAAGTTAAAGGG + Intergenic
972986901 4:44775770-44775792 TCATGTTGGCTAAAGTTAAAGGG + Intergenic
972991426 4:44825992-44826014 ACATATTGGCTAAAGTTAAACGG - Intergenic
973887847 4:55340868-55340890 AAACATTGGCTAAAGTTAAAGGG + Intergenic
974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG + Intergenic
974665450 4:64955148-64955170 ACATATTAACTAAAATCAAAAGG + Intergenic
974781129 4:66554905-66554927 ACATTTTAGCTGCAGACAAAAGG + Intergenic
974922754 4:68262312-68262334 ACATATTGGCTAAAGTTAAAGGG + Intergenic
974998925 4:69196497-69196519 AGATATTAGCTACAGGGGAATGG + Intronic
975043322 4:69771176-69771198 ACATACTGGCTAAAGTTAAAGGG + Intronic
975102703 4:70532414-70532436 ACTTTTTACCTACATTTAAAAGG + Intronic
975205555 4:71640889-71640911 ACATATTAGCTGAAGTTAAAGGG + Intergenic
975480379 4:74872630-74872652 ACAAATTAGCTACATTTAAATGG - Intergenic
975756315 4:77575065-77575087 ACATATTAACTAAATTCAAAAGG + Intronic
976643805 4:87366204-87366226 ACATATTAGCTAAAGTTAAAGGG + Intronic
977043668 4:92043502-92043524 ACATATTAGCTAAAGTTAGAGGG - Intergenic
977047774 4:92089138-92089160 ACATATTAGCTAAATTTAAAGGG - Intergenic
977500009 4:97826423-97826445 ACATATTGGCTAAAGTTAAAGGG + Intronic
977674082 4:99728981-99729003 ACATATTGGCTAAAATTAAAAGG - Intergenic
978034123 4:103973635-103973657 ACACATTGGCTAAAGTTAAAGGG + Intergenic
978314075 4:107416679-107416701 ACATATTGGCTAAAGTTAAAGGG + Intergenic
979591471 4:122485526-122485548 ACATATTGGCTAAAGCTAAAAGG - Intergenic
979647755 4:123091966-123091988 ACATAATAGTTACATTCAAAGGG - Intronic
980438900 4:132815835-132815857 ACATATTGGCTAATGTTAAAGGG - Intergenic
980778571 4:137466926-137466948 ACATATTGGCTAATGTTAAAGGG + Intergenic
981028841 4:140103425-140103447 AAATGTTAGGTACATTTAAATGG + Intronic
981456190 4:144955702-144955724 ACATATTAACTAAATTCAAAAGG + Intergenic
982625681 4:157763186-157763208 CCCTCTAAGCTACAGTTAAAGGG - Intergenic
982869341 4:160556814-160556836 ACATATTTTCAACAGTAAAAGGG + Intergenic
983306098 4:165989195-165989217 AAATATTAGCTACCTGTAAAAGG - Intronic
984329818 4:178299881-178299903 GCAAATTAGGTAGAGTTAAAAGG + Intergenic
984650620 4:182266413-182266435 ACATACTGGCTAAAGTTAAAAGG + Intronic
984985644 4:185326938-185326960 ACATATTGGCTAAAGTTGAAGGG - Intronic
985026305 4:185742713-185742735 ATATATTTGCTATAGTGAAAAGG + Intronic
985066968 4:186131936-186131958 AACAATTAACTACAGTTAAAGGG - Intronic
986085494 5:4441171-4441193 ACATCAAAGCTAGAGTTAAAAGG - Intergenic
986849484 5:11794366-11794388 ACACAATAGCTACTGATAAAAGG + Intronic
987166012 5:15199151-15199173 ACATATTGGCTAAAGTTAAAGGG - Intergenic
987522859 5:19009738-19009760 ATATATTAGATAGAGTTGAACGG - Intergenic
988145837 5:27306920-27306942 ACATTTTAGCTAATGCTAAAAGG - Intergenic
988568293 5:32338802-32338824 ACATACTGGCTAAATTTAAAGGG - Intergenic
988770261 5:34426260-34426282 AGCAAATAGCTACAGTTAAAAGG + Intergenic
988773168 5:34451823-34451845 ACATATCAGTTACAATCAAAAGG + Intergenic
989096141 5:37783172-37783194 ACATATTAGCTAAAGTTAAAGGG - Intergenic
990070717 5:51779753-51779775 ACATATTGCCTAAAATTAAAGGG - Intergenic
990401885 5:55446316-55446338 GCAGATTAGATACAGTGAAAGGG - Intronic
991305975 5:65176529-65176551 ACATATTGGCTAAAGTTAAAGGG + Intronic
991311735 5:65250827-65250849 AAATATTAGCTACTATGAAAAGG - Intronic
991582361 5:68169542-68169564 TTTTATTAGCTTCAGTTAAATGG + Intergenic
993055234 5:82973009-82973031 ACATATTGGCTAAAGTTAAAGGG - Intergenic
993939559 5:94042199-94042221 ATATATTGGCTAAAGTAAAAGGG + Intronic
993980817 5:94541560-94541582 ACATGTTGGCTAAAGTTACAGGG + Intronic
994556185 5:101307488-101307510 CCATACTAACTACAGTTAAGAGG + Intergenic
995325378 5:110883800-110883822 ATATATTGGCTAAAGTTAAAGGG + Intergenic
995393769 5:111666387-111666409 ACTTATTAACTAAATTTAAAGGG - Intronic
995895275 5:117004293-117004315 ACATATTGGCTAAAATTAAAGGG - Intergenic
996057484 5:118997788-118997810 ACATATTGGCTAAAGTTAAAAGG - Intergenic
996101081 5:119446501-119446523 ACATATTAGCTAAAGTTAAAGGG + Intergenic
997012889 5:129900153-129900175 ACATATTTGAAATAGTTAAAGGG + Intergenic
997497823 5:134345411-134345433 ACATACTAGGTCCTGTTAAAAGG + Intronic
998260435 5:140626942-140626964 ACATACTGGCTAAAGTTAAAGGG - Intergenic
998849169 5:146338078-146338100 ACATATTAGGAACTCTTAAACGG + Intronic
998938774 5:147258253-147258275 ACATATTGGCTAAAGTTTAAGGG - Intronic
999850312 5:155530690-155530712 AAATAAGAGCTACTGTTAAACGG - Intergenic
999923889 5:156354182-156354204 ATAAATTAGCTAAAGTTAGAGGG + Intronic
1000061177 5:157656867-157656889 ATATATTAGTTAAAGTTAAAGGG + Intronic
1000066557 5:157697793-157697815 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1000277066 5:159747415-159747437 AGATTTTAGCTAGAGTTACATGG + Intergenic
1000415804 5:160982527-160982549 ACATATAGGCTAAAGTAAAAGGG + Intergenic
1001558536 5:172653570-172653592 ACATATTGGCTAAAGTTAAAAGG - Intronic
1003418148 6:5931662-5931684 ATATAATATCTACACTTAAAAGG - Intergenic
1004168763 6:13279419-13279441 ATATCTTAGCTACAGTTAAGAGG + Intronic
1004432476 6:15557382-15557404 ACACATTGGCTAAAGTTAAAGGG + Intronic
1005453416 6:25995652-25995674 ACAGAATAGCTAATGTTAAAAGG - Intergenic
1005461838 6:26076645-26076667 ACATATTGGCTAAAGTTAAGGGG + Intergenic
1006326033 6:33354711-33354733 ACATATTGGCTAAGGTTAAAAGG - Intergenic
1008123382 6:47643084-47643106 ACATATTAGCTAAAGTTAAAGGG + Intergenic
1008559259 6:52707276-52707298 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1008826818 6:55704941-55704963 ACATATCAGGAACAGTCAAATGG - Intergenic
1010317758 6:74470272-74470294 ACATATTAGCTAAAGTTAAAAGG + Intergenic
1010810784 6:80296741-80296763 ACATATTGGCTAAAGTTAAAAGG - Intronic
1011341689 6:86322593-86322615 ACATATTGTCTATATTTAAAGGG + Intergenic
1011449942 6:87481830-87481852 CCATATTGGCTAAAGTTAAAGGG - Intronic
1011939157 6:92821120-92821142 ACATATTTGCTAGTGTTTAAAGG - Intergenic
1012225228 6:96695606-96695628 TCAGATTATCTAAAGTTAAAGGG + Intergenic
1013102966 6:107002437-107002459 ACATATTGGCTAAAATTAAAGGG + Intergenic
1014097503 6:117476698-117476720 ACATATTAGCTAAAAGTTAAAGG - Intronic
1014110994 6:117618342-117618364 ACATATTGGCTAAAGCTAAAGGG + Intergenic
1014200522 6:118604342-118604364 ACATATTGACTAAAGTTAAAGGG - Intronic
1014207661 6:118673674-118673696 AAATATTAGATACAGTCAATGGG - Intronic
1014720361 6:124910719-124910741 ACTTATTAGCTACAGTAATTTGG - Intergenic
1015286540 6:131491632-131491654 ACAGAATAGCTACAGATAGATGG - Intergenic
1015377667 6:132529030-132529052 ACATATTGGCTAAATTTAAAGGG + Intergenic
1015509054 6:134019605-134019627 TAATATTAGCTACAGAAAAATGG + Intronic
1016108584 6:140192666-140192688 ACATATTGGCTAAAGTTAAAAGG + Intergenic
1017348572 6:153413509-153413531 ACATATTGGCTAAAATTAAAGGG - Intergenic
1018065243 6:160120636-160120658 ACATATTGACTACACTAAAAAGG - Intergenic
1018078287 6:160235607-160235629 ATATATTGGCTAAAGTTAAAGGG + Intronic
1018137435 6:160791132-160791154 ACATATTGGCTAAAGTTAAATGG + Intergenic
1018138109 6:160798070-160798092 ACATATTGACTAAAATTAAAGGG + Intergenic
1018191478 6:161312891-161312913 ACATATTGGGTAAAGTTAAAGGG - Intergenic
1018725579 6:166610658-166610680 ACATAATCACTGCAGTTAAAAGG + Intronic
1018920936 6:168173138-168173160 ACAAATTAGGTAAATTTAAATGG + Intergenic
1020042488 7:5014689-5014711 ACAAACTGGCTTCAGTTAAAAGG - Intronic
1020285457 7:6676163-6676185 ACAGATTTGCTACATTTATAGGG - Intergenic
1020989274 7:15176731-15176753 ACTTATTAGCTATAGTCAACAGG + Intergenic
1021418636 7:20419682-20419704 AAATATGAGCTACTGCTAAAAGG + Intergenic
1021849452 7:24793345-24793367 ACATATTAGCTAAAGTTAAAGGG - Intergenic
1022457996 7:30575900-30575922 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1022490100 7:30810525-30810547 ACATATTAGCTACAGTTAAAGGG + Intronic
1022579972 7:31541925-31541947 ACATTTTGGCTAAAGCTAAAGGG - Intronic
1023436445 7:40145085-40145107 ACATATTGGCTAAAGTTAAAGGG - Intronic
1023587651 7:41747787-41747809 CTATATTGGCTAAAGTTAAATGG - Intergenic
1023588509 7:41756454-41756476 ACATATTGGCTAAAGTTAAAAGG - Intergenic
1023799004 7:43817067-43817089 ACATACTGGCTAAAGTTAAAGGG + Intergenic
1023799401 7:43820710-43820732 ACATACTGGCTAAAGTAAAAGGG + Intergenic
1023933360 7:44721310-44721332 ATATATTGGCTAAAGTTAAGGGG - Intergenic
1024128389 7:46324356-46324378 ACATATCTGCTGCAGATAAAAGG - Intergenic
1024146922 7:46526399-46526421 ATATATTCTCTAAAGTTAAAAGG + Intergenic
1024894176 7:54238042-54238064 ACATATTAGATACTGTCAAATGG - Intergenic
1024906630 7:54389981-54390003 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1025634523 7:63310154-63310176 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1025648174 7:63438020-63438042 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1025741485 7:64200896-64200918 ACATATTGGCTAAAGTTAAAGGG - Intronic
1025769020 7:64486191-64486213 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1026334970 7:69386344-69386366 ACATATTATCTATACTTAGATGG + Intergenic
1027453993 7:78364589-78364611 TCATTTTAACTACAGTTATATGG + Intronic
1028712046 7:93920887-93920909 AGACTTTAGTTACAGTTAAAGGG + Intergenic
1028793664 7:94880593-94880615 ACATATTGGCTACAGTTAAAGGG + Intergenic
1029876863 7:103763639-103763661 ATATATGAGCTACAGTGATAGGG + Intronic
1030144297 7:106337460-106337482 ACATATTGACTAAATTTAAAGGG + Intergenic
1031022605 7:116644521-116644543 ACATAATAGGCACATTTAAAAGG - Intergenic
1031105688 7:117539557-117539579 ACATATAAGCTACAGAGAAGTGG - Intronic
1031238294 7:119205666-119205688 ATATTTTAGATATAGTTAAAAGG - Intergenic
1031680987 7:124674465-124674487 ACATCTTTGTAACAGTTAAAAGG + Intergenic
1031791457 7:126110320-126110342 ACATATTACCTTCAAATAAAAGG - Intergenic
1032088742 7:128898804-128898826 ACATATTGGTTAAAGTTAAAGGG + Intronic
1032170459 7:129580132-129580154 ACATATTGGCTGAAGTTAAAGGG + Intergenic
1032671673 7:134089148-134089170 ACATATTGGCTGAAGTTAAAGGG - Intergenic
1033161805 7:139003686-139003708 ACATGTTGGCTAAAGTTAAAGGG + Intergenic
1033478602 7:141715861-141715883 ACATATGTGCAACTGTTAAATGG - Intronic
1035868968 8:3116041-3116063 GCCTATTAGTTACAGTTATATGG - Intronic
1036666020 8:10739992-10740014 ACAGATTAGCTAAAGGTAAAAGG + Intronic
1037002969 8:13743471-13743493 ACAAATTAGTTACATTTAAAGGG + Intergenic
1037537813 8:19843217-19843239 ATATATTAGCTACAAAGAAAGGG + Intronic
1038089565 8:24238213-24238235 ACATATTAGCTAAAGTTAAAGGG + Intergenic
1038501933 8:28052168-28052190 ACATATCAGCTGAAGTTAAGTGG - Intronic
1040844167 8:51818977-51818999 ACATATTTGCTAGAGTTACATGG - Exonic
1041248941 8:55916330-55916352 TCCTATTACCTACTGTTAAATGG + Intronic
1041393677 8:57370277-57370299 ACCTATTGGCTAAAGTTAAAGGG + Intergenic
1041810278 8:61901132-61901154 ACATATTGGCTACGGTTAAAGGG - Intergenic
1043070332 8:75628970-75628992 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1044184685 8:89237427-89237449 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1044342285 8:91060210-91060232 AGCTAATAGCTACAGATAAAAGG - Intergenic
1044378370 8:91502643-91502665 ACATATTGGCTAAAGTAAAAGGG - Intergenic
1045130594 8:99147490-99147512 AAATATTTGCTACAGATAGATGG - Intronic
1045339360 8:101238698-101238720 AAATGTTACCTACAGTGAAAAGG - Intergenic
1045744551 8:105402730-105402752 ACAAACTAGCTAAAGATAAAAGG - Intronic
1046080619 8:109366136-109366158 ACATTTTAGCTAGATTTAAAAGG - Intronic
1046385513 8:113503898-113503920 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1046387406 8:113522117-113522139 GAATATTAGCTACAATTAAAGGG + Intergenic
1047461895 8:125073488-125073510 ACATATGGACTACAGTTATAGGG + Intronic
1047461898 8:125073555-125073577 ACATATGGACTACAGTTATAGGG + Intronic
1049461508 8:142731219-142731241 ACATATTGGCTAAAGCTAAAGGG - Intronic
1050923216 9:11232153-11232175 ACATATTAGCTAAAATTGAAGGG - Intergenic
1051225449 9:14893874-14893896 ACATATTGGCTAAAGCTAAAGGG + Intronic
1051829482 9:21259307-21259329 TCATATTGGCTAAAGTTAAAGGG + Intergenic
1052507987 9:29379790-29379812 AAACATTAGCTAAAGTTAAAGGG + Intergenic
1052521381 9:29551993-29552015 ACATATTGGCTAAAGTTAAAGGG + Intergenic
1055541395 9:77309422-77309444 ACATATTCCCTGCAGATAAAAGG - Intronic
1056422476 9:86442602-86442624 ACATATTATCTATAAATAAATGG - Intergenic
1056440171 9:86612895-86612917 ACCTATTAGCCACTTTTAAATGG - Intergenic
1056727569 9:89134355-89134377 ACATATTATCTAGAGTTAAAGGG + Intronic
1059398618 9:114054645-114054667 AAACATTAGCCACAGTGAAAGGG - Exonic
1059593916 9:115695224-115695246 AGAAATTATCTACAGATAAATGG + Intergenic
1060394781 9:123308091-123308113 ACATATTCTCTACAGATAAGGGG - Intergenic
1060681669 9:125570818-125570840 ACATATTGGCTAAAGTTAAAGGG + Intronic
1203364611 Un_KI270442v1:246499-246521 ACATATTTGCTAGAGTTACATGG + Intergenic
1187069401 X:15873331-15873353 ACATTTTAGCTGTAGTTAAATGG - Intergenic
1187330784 X:18337389-18337411 ACATATAAACTACAAGTAAAGGG + Intronic
1188164127 X:26840421-26840443 ACCTAATAGCTAGAGTTACAAGG + Intergenic
1189072994 X:37884942-37884964 ACATATTGGCTAAAGCTAAAGGG - Intronic
1189079892 X:37959717-37959739 ACATATTAGGGAAAGTTATAGGG - Intronic
1189086362 X:38029173-38029195 ACATATTGGCTAAAGTTAAAGGG - Intronic
1189855235 X:45216969-45216991 ACATATAAGCTAGAAATAAAGGG + Intergenic
1190270120 X:48856391-48856413 ACATATTAGCTAAAGTTAAAGGG + Intergenic
1190771124 X:53515350-53515372 ACATATTAGTTAAAGTTAAAGGG + Intergenic
1190920736 X:54850035-54850057 ACATATTGGGTAAAGTTAAAGGG - Intergenic
1190963385 X:55274214-55274236 ATATATTGGCTAAAGTTAAAGGG + Intronic
1191189635 X:57652741-57652763 ACATATTGGCTAAATTCAAAAGG + Intergenic
1191918071 X:66223650-66223672 ACATATTAGCTAATGTTAAAGGG - Intronic
1192542510 X:71986827-71986849 ACATATTCGCTCAAATTAAAGGG - Intergenic
1192657450 X:73005775-73005797 ACATATTAGATATAGATATAGGG + Intergenic
1192864794 X:75119374-75119396 ACATACTGGCTAAAGTTAAAGGG + Intronic
1192888700 X:75364741-75364763 ACATATTGGCTAAAATTAAAGGG + Intergenic
1192915567 X:75647729-75647751 AAATATTAGCTAAAGTTAAAGGG - Intergenic
1193313792 X:80040784-80040806 ACATATTGGCTAAATTTAAAGGG - Intergenic
1193338182 X:80315008-80315030 ACATATTAACTAAACTCAAAGGG + Intergenic
1193411247 X:81165879-81165901 AGATATCAGCTGCAGTTAATTGG + Intronic
1193699758 X:84746602-84746624 ACATATTGACTAAATTTAAAAGG + Intergenic
1193705446 X:84815600-84815622 GAATATTGGCTAAAGTTAAAGGG - Intergenic
1194032957 X:88838083-88838105 AAATATTAGCTAAAGTTGTAGGG - Intergenic
1194040767 X:88939563-88939585 ACATTTTGGCTAAAGTTAAAGGG - Intergenic
1194059477 X:89179588-89179610 ACATATTAGCTAAATTCAAACGG - Intergenic
1194086032 X:89530103-89530125 ACATACTGGCTAAATTTAAAGGG - Intergenic
1194187911 X:90796272-90796294 ATATATTAGCTAAATTTAAAAGG + Intergenic
1194268987 X:91786151-91786173 ACACATTAGAGACAATTAAAAGG - Intronic
1194850459 X:98862548-98862570 ACATATTGGCTAAAGTTAAAAGG + Intergenic
1195153254 X:102096274-102096296 ACATATCAACTAAAGTTAAAAGG + Intergenic
1195219744 X:102735365-102735387 ACATATTGGCTAAAGTTAAAGGG - Intronic
1195472056 X:105241717-105241739 ACATATTGGCTAAATTTAAAGGG - Intronic
1195846996 X:109239443-109239465 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1195923947 X:110006911-110006933 AGATATTAGCTGAAGTGAAAGGG + Intronic
1196074326 X:111558317-111558339 ACATATTGGCTAAAGTTAAAGGG - Intergenic
1196162145 X:112497679-112497701 ATATATTGGCTAAAATTAAAGGG - Intergenic
1196460185 X:115921541-115921563 ACATATTAGCCAAAGGTAAAGGG - Intergenic
1196874478 X:120145104-120145126 ACATTTTGGCTAAAGGTAAAGGG + Intergenic
1197384285 X:125784566-125784588 ACATATTAACTACATTCAAAAGG - Intergenic
1197932345 X:131709003-131709025 ACATATTAGCTAAAGTTAAAGGG - Intergenic
1198742373 X:139854864-139854886 ACATATTGGCTAAGGTTGAAAGG + Intronic
1198844658 X:140897931-140897953 ACGCATTGGCTAAAGTTAAAAGG - Intergenic
1198855620 X:141012501-141012523 ACATACTGGCTAAAGTTAAAGGG + Intergenic
1198876514 X:141233695-141233717 ACATACTGGCTAAAGTTAAAGGG - Intergenic
1198907075 X:141574867-141574889 ACATACTGGCTAAAGTTAAAGGG - Intergenic
1198909716 X:141599541-141599563 ACATACTGGCTAAAGTTAAAGGG + Intronic
1198917370 X:141688605-141688627 ACATACTGGCTAAAGTTAAAGGG - Intronic
1198931855 X:141870462-141870484 ACATATTAACTAAACTCAAAAGG - Intronic
1198993564 X:142545933-142545955 ATGTATTAGCAACAATTAAAAGG - Intergenic
1199736114 X:150688260-150688282 AGATATTAGCCACTGATAAAAGG - Intergenic
1199795091 X:151187238-151187260 ACATATCATGTACAGTTAAATGG + Intergenic
1199994562 X:153013204-153013226 ACATATTGGCTAACATTAAAGGG - Intergenic
1200438688 Y:3185975-3185997 ACATACTGGCTAAATTTAAAGGG - Intergenic
1200534501 Y:4378219-4378241 ATATATTAGCTAAATTTAAAAGG + Intergenic
1200586203 Y:5007163-5007185 ACACATTAGAGACAATTAAAAGG - Intronic
1200734896 Y:6783624-6783646 ACATCCTGGCTAAAGTTAAAGGG + Intergenic
1200763374 Y:7060062-7060084 ATATATTGGATAAAGTTAAAGGG - Intronic
1201308815 Y:12575808-12575830 ACATATTGGCTAAAGTCAAAGGG + Intergenic
1201324943 Y:12746485-12746507 ACATATTAACTAAATTAAAAAGG - Intronic
1201636691 Y:16130696-16130718 ACATATTGGCTAAAGTTAAAGGG + Intergenic