ID: 1022490947

View in Genome Browser
Species Human (GRCh38)
Location 7:30817182-30817204
Sequence GACCTTTGGTGTTACAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022490947 Original CRISPR GACCTTTGGTGTTACAGACA AGG (reversed) Intronic
903335211 1:22619965-22619987 GCCCTTTGATGTGACAGAGATGG + Intergenic
903498165 1:23785696-23785718 GTCCTTTGATGATACAGAAAGGG + Exonic
904538523 1:31217169-31217191 GACTTTTTGTTTTAGAGACAGGG + Intronic
911170595 1:94767286-94767308 GACCTTTTGTTTTATAGAAAAGG - Intergenic
913244883 1:116862808-116862830 GACATTTGGTGTCAAAGACCCGG + Intergenic
915915828 1:159940362-159940384 GACCTGTAGTGTTACAGAACAGG + Intronic
918325366 1:183404819-183404841 GACCATTTGGGTTGCAGACAGGG - Intronic
921830122 1:219718664-219718686 GACCTTTTCTGGCACAGACATGG - Intronic
1065269016 10:24007580-24007602 TTCCTTTGGTGTTGCGGACAGGG + Intronic
1065397774 10:25258854-25258876 GACTGTTTATGTTACAGACAAGG - Intronic
1065439563 10:25737152-25737174 GCACTTTTATGTTACAGACATGG - Intergenic
1067259801 10:44679514-44679536 GCCCTTTGATGTTACAGAGTGGG - Intergenic
1069433227 10:68356132-68356154 GCCCTTTGGGGTCACAGACAAGG - Intronic
1071508517 10:86247037-86247059 CACCTGTGGTGTTCCAGGCACGG - Intronic
1074027360 10:109650314-109650336 GACCTTTTGTGATACAGCCCAGG - Intergenic
1075834564 10:125442810-125442832 GACCCTTCATGTTACAGACCAGG - Intergenic
1081592783 11:44436432-44436454 GAGCCCTGGTGTTACACACAGGG + Intergenic
1082632626 11:55559796-55559818 GACATTTGGTGCTGAAGACATGG + Intergenic
1083143923 11:60743748-60743770 GACCATTGGTGGCACTGACAGGG - Exonic
1086229609 11:84552449-84552471 GAACTTTGACGTTAAAGACATGG - Intronic
1087869485 11:103274351-103274373 GATGTTTGTTTTTACAGACATGG - Intronic
1090109731 11:123893917-123893939 GACCTATGGTGTTAGAAAAATGG + Intergenic
1091310435 11:134571566-134571588 GACCTTTGCTGATTCAGGCAAGG - Intergenic
1091536571 12:1415732-1415754 GACTTTTGATATGACAGACAAGG + Intronic
1093290244 12:17310899-17310921 CATACTTGGTGTTACAGACAGGG - Intergenic
1094290732 12:28846322-28846344 GAACTTTTGTTTTACAGTCATGG - Intergenic
1095787748 12:46128742-46128764 GACCTTTGGTGTTATAAGAATGG - Intergenic
1097252066 12:57640617-57640639 GGCTTTGGGTGTTTCAGACATGG + Intergenic
1099388976 12:82055043-82055065 GTCCTTTGGTTTTACAAACTAGG - Intergenic
1099703110 12:86114741-86114763 GACCTTTAGAGTCAGAGACATGG - Intronic
1101004533 12:100388994-100389016 GACCTTTGGTCCCACAGCCATGG - Intronic
1101818158 12:108161875-108161897 GAGCTTTTGTTTTACAGATAAGG - Intronic
1102791274 12:115647903-115647925 GACCTTTAATGGAACAGACATGG - Intergenic
1105464635 13:20626812-20626834 AACCACTGGTGTTACAGACTAGG - Intronic
1106220280 13:27741130-27741152 GACCCTTGGTCTTTCATACAAGG - Intergenic
1115050240 14:29051459-29051481 GACCTTTGGGGTTATATAGATGG - Intergenic
1117540720 14:56744142-56744164 GATCTTTGCTGATACTGACAGGG + Intergenic
1119316617 14:73701441-73701463 GATCTTGGATGTAACAGACATGG - Exonic
1123940594 15:25214735-25214757 GAGCTTTGGTGTCACATCCAGGG + Intergenic
1124067329 15:26356572-26356594 TAATTTTGGTGTTACAGAAATGG + Intergenic
1129231531 15:74199654-74199676 GACCTCAGGTGATACAGAAAGGG - Intronic
1129759891 15:78123252-78123274 GACCCCTGGTCTAACAGACAGGG + Intronic
1130288923 15:82579575-82579597 TACTTTTGTTGTTACAGAGAAGG + Intronic
1131279639 15:91010250-91010272 GACCTTGGGAGACACAGACAAGG + Intronic
1134249365 16:12563590-12563612 GAGATGTGGTGATACAGACATGG - Intronic
1137972608 16:53000930-53000952 AACCTCTTGTGTTACAGACGTGG + Intergenic
1138974605 16:62188633-62188655 GACCTGTGGTGTCTCAGACGAGG + Intergenic
1139491700 16:67289392-67289414 GGCCTTTGGTGTCTCAGAGAAGG + Exonic
1145880537 17:28349619-28349641 GTCCTTTGTTTTTAGAGACAGGG - Intronic
1151180186 17:72321641-72321663 GAGCTTTGGGATTACACACAGGG + Intergenic
1153594649 18:6712609-6712631 GACTTTTTTTTTTACAGACAGGG + Intergenic
1157147132 18:45175186-45175208 GTCCTTTGCTATTACAAACAAGG - Intergenic
1159187493 18:64994669-64994691 GGCATTTGGTGAAACAGACAAGG - Intergenic
1163741179 19:19013930-19013952 GCCCCTTGGTGTTCCAAACAAGG + Intronic
1164219086 19:23177386-23177408 GACATTTGGTGTTGAAGACCTGG + Intergenic
1168260119 19:55188689-55188711 GGCCTTTGCAATTACAGACAGGG - Intronic
926154652 2:10446958-10446980 AACCATTTTTGTTACAGACATGG + Intronic
929749927 2:44700079-44700101 GCACTTTTGTGTTACAGAAATGG + Intronic
931008288 2:57878318-57878340 GGACTTTGGTGATACAGATACGG - Intergenic
935047154 2:99492489-99492511 GACCTTTGGAGGGACAGCCATGG + Intergenic
935172775 2:100623554-100623576 GAACTCTGCTGTTACAGAGAGGG + Intergenic
936302152 2:111312157-111312179 GAGCTTTGGAGTTACAGAGCCGG - Intergenic
937925968 2:127167730-127167752 ACCCTTTGGTTTTACAGGCAGGG + Intergenic
938766849 2:134465547-134465569 GACCTTTGGGATGACAGAGAGGG - Intronic
940614939 2:156038314-156038336 GGCCTTTGGTCTGACACACAGGG + Intergenic
940628273 2:156204478-156204500 AACCTTTGGTTTTACAGAAGAGG + Intergenic
941668752 2:168268073-168268095 GACTCTTGCTGTTACAAACAGGG + Intergenic
946690504 2:222305605-222305627 GCCCTTTGGCCTTAGAGACAGGG + Intergenic
948831351 2:240599711-240599733 GCCCTTTTGTTTTAGAGACAGGG + Intronic
1173719531 20:45242463-45242485 GTCCTATAGTGGTACAGACAAGG - Intergenic
1175473485 20:59251410-59251432 TCCCTTTGGGGTTGCAGACACGG - Intronic
1179194168 21:39150158-39150180 GACTTTTGGGGTTACAGGGATGG + Intergenic
1184401760 22:44278637-44278659 AACCTTTGGGGGTACAGAGAGGG + Intronic
1184940197 22:47759273-47759295 GAGATTTGTTATTACAGACAGGG + Intergenic
949886108 3:8695528-8695550 TACCTTTGATGTCACAGACGGGG - Intronic
960369450 3:116815863-116815885 GACCTTGGGTGTTATAGTCAGGG - Intronic
961383079 3:126508518-126508540 GGCCTATGGAGTTGCAGACAGGG + Intronic
963519409 3:146345889-146345911 GGCCTTTGGTCTGACACACATGG - Intergenic
965184258 3:165443264-165443286 TATCTTTGGTCTTACAGAGAGGG + Intergenic
967792779 3:193566743-193566765 GACATTTGGGGTCAGAGACAGGG - Intronic
968054450 3:195680775-195680797 GCCCTGTGGTGATACACACAAGG - Intergenic
968101440 3:195968383-195968405 GCCCTGTGGTGATACACACAAGG + Intergenic
968855391 4:3116512-3116534 GACCTCTGGTTTTAGAAACAGGG - Intronic
969126048 4:4948969-4948991 GACTTTTGGTTTTATAGCCAGGG - Intergenic
971732522 4:30404088-30404110 CACCTTTGGTGTTGAAGTCATGG - Intergenic
974463602 4:62223297-62223319 GTCCTTTGCTGTCAAAGACAAGG - Intergenic
978303470 4:107295455-107295477 GACATTTGGTGTTGAAGACCTGG - Intergenic
983151471 4:164287345-164287367 GTCCTTTGGAGTGACAGGCAAGG - Intronic
984003249 4:174276845-174276867 GACCTTAGGTATTTCAAACAAGG + Intronic
984937522 4:184902028-184902050 GATCAGTGGTGATACAGACAAGG + Intergenic
986701918 5:10418419-10418441 GACCTTTGCTGTGACTTACATGG - Intronic
986791703 5:11167433-11167455 GATCTTTGCTGTTGCATACAAGG + Intronic
987664256 5:20916167-20916189 GACCCTTGGAGTTACACCCATGG - Intergenic
988469881 5:31527920-31527942 GACCTTTGGTTTTCAAGACAAGG - Intronic
989634279 5:43517651-43517673 GCCCTTTTATGTTACAGAGATGG - Intergenic
994899947 5:105759166-105759188 GCACTTTAGTGTTACAGAGATGG + Intergenic
998385680 5:141755959-141755981 GCCCTTTTGTTTTACAGATAGGG - Intergenic
998485873 5:142501692-142501714 GACATTGGATGTTACAGAGAAGG + Intergenic
999731388 5:154478602-154478624 GCCTTTTGATTTTACAGACAAGG + Intergenic
1000326229 5:160174660-160174682 GCCCTTTTGTGTTACTGACCAGG - Intergenic
1002347449 5:178557777-178557799 GACTTCTGGTGTTGGAGACAGGG + Intronic
1004628060 6:17394599-17394621 GACCTTTGGTTTTATAGTTATGG + Intronic
1006604133 6:35244111-35244133 CACCTTTGGTGTCACAGTCTTGG - Exonic
1015827192 6:137326815-137326837 TTACTTTGGTTTTACAGACAAGG - Intergenic
1022009049 7:26292807-26292829 AACCTTTCATTTTACAGACAGGG + Intronic
1022234577 7:28448510-28448532 AACCTTTAGTGTTAGTGACATGG + Intronic
1022316245 7:29247996-29248018 GAGCTCTGCTCTTACAGACATGG - Intronic
1022490947 7:30817182-30817204 GACCTTTGGTGTTACAGACAAGG - Intronic
1027366118 7:77460156-77460178 TACCTTTGGTCTTGCAGACCTGG - Intergenic
1029079853 7:97964246-97964268 TACTTTTGATGTCACAGACAGGG + Intergenic
1038130392 8:24724057-24724079 GAACTTTTGTGTTACAGAGATGG - Intergenic
1042334094 8:67612255-67612277 AACCTTTGGGCTTTCAGACAAGG - Intronic
1049570180 8:143366258-143366280 GAATTTTGGTGTGACAGGCAGGG - Intergenic
1052568054 9:30183927-30183949 TAACTTTGGTTTTACAGCCAAGG - Intergenic
1059664668 9:116435187-116435209 GCCCTTTCATGTTACAAACAAGG + Intronic
1061028535 9:128066274-128066296 GTCCTGTGGGGATACAGACACGG + Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1061730573 9:132610901-132610923 GACCATTGGTCTTGCAGTCAGGG - Intronic
1062211569 9:135367021-135367043 GACCTTTTGTGTTTCAGAAGAGG + Intergenic
1186639952 X:11444883-11444905 TTCCTTTGGTGTTAAAGATAGGG - Intronic
1189081922 X:37982092-37982114 GACATGTGATGTAACAGACAAGG + Intronic
1190006435 X:46743890-46743912 GAACTTGGGTGTGACATACAGGG - Intronic
1192183367 X:68929925-68929947 GACTGTGGGTATTACAGACAAGG + Intergenic
1192294380 X:69832079-69832101 TACTTTTGGTGTTTCAGTCATGG + Intronic
1195903977 X:109826220-109826242 GACTTTTGGTGTTAAAACCAGGG - Intergenic
1196847569 X:119908558-119908580 GACCTTTGGGGTAATAGAAACGG - Intronic
1200711164 Y:6486208-6486230 GACCTTTTCTGTAAGAGACAAGG + Intergenic
1201022771 Y:9675778-9675800 GACCTTTTCTGTAAGAGACAAGG - Intergenic
1201791084 Y:17841110-17841132 GTCTGTTGGTGTTACAGATAGGG + Intergenic
1201810470 Y:18064879-18064901 GTCTGTTGGTGTTACAGATAGGG - Intergenic