ID: 1022491583

View in Genome Browser
Species Human (GRCh38)
Location 7:30824664-30824686
Sequence TGGGAGGATCGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022491583_1022491588 0 Left 1022491583 7:30824664-30824686 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1022491588 7:30824687-30824709 TTTCAGCCTCCTGAGTAGCTGGG 0: 367
1: 13386
2: 123391
3: 222765
4: 239200
1022491583_1022491587 -1 Left 1022491583 7:30824664-30824686 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1022491587 7:30824686-30824708 ATTTCAGCCTCCTGAGTAGCTGG 0: 116
1: 3298
2: 28872
3: 139391
4: 235549
1022491583_1022491590 8 Left 1022491583 7:30824664-30824686 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1022491590 7:30824695-30824717 TCCTGAGTAGCTGGGATTACAGG 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022491583 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr