ID: 1022493664

View in Genome Browser
Species Human (GRCh38)
Location 7:30839681-30839703
Sequence TTGCAGATAGAGCTGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022493661_1022493664 13 Left 1022493661 7:30839645-30839667 CCTTCTTAGGCTGATCATTGAGA 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG 0: 1
1: 0
2: 3
3: 28
4: 304
1022493660_1022493664 25 Left 1022493660 7:30839633-30839655 CCACTAGAGGGGCCTTCTTAGGC 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG 0: 1
1: 0
2: 3
3: 28
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022493664 Original CRISPR TTGCAGATAGAGCTGGAGAA AGG Intronic
904922549 1:34020342-34020364 CTGCAAATATAGCTGGATAAAGG + Intronic
906394899 1:45454058-45454080 TTGCTGATAGAACTGTAAAATGG + Intronic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
908145058 1:61232809-61232831 TTGGAGATGGAGCTTGAGATGGG - Intronic
908511824 1:64855643-64855665 TTTCAGATCGAGGTGCAGAAGGG - Exonic
909056340 1:70825522-70825544 CTGCAGATAGAGATGGAATAAGG + Intergenic
910199021 1:84678626-84678648 TGGCAGGTAGAGGTGGAGAAAGG + Intronic
910374343 1:86552671-86552693 TTGCAGATGGAGCTGGGGCACGG + Intronic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
911410080 1:97493266-97493288 TTGCAGAGAGCACTGGAGAGAGG + Intronic
911411650 1:97516835-97516857 TTGGAGATAGAGAGAGAGAAGGG - Intronic
912390506 1:109299502-109299524 TTGCTGATTGAGCTGGAGGAAGG - Intronic
912974876 1:114320144-114320166 AAGCAGATAGAAATGGAGAAAGG + Intergenic
914963093 1:152224294-152224316 GTGGAGATAGAGGTGGAGATGGG - Intergenic
915331588 1:155116232-155116254 TACCAGATTGGGCTGGAGAAGGG - Intergenic
915603686 1:156937962-156937984 TGTCAGAGAGAGCTGGAGGAAGG + Intronic
919064252 1:192673247-192673269 TTGGAACAAGAGCTGGAGAAGGG + Intergenic
920095511 1:203483912-203483934 GTCCAGGTAGAGCTGGTGAATGG - Exonic
920208062 1:204307531-204307553 TTTCAGTTAGCGCTGGAGCAAGG - Intronic
921633901 1:217468584-217468606 TAGAAGAGAGAGCTGGAGAAGGG + Intronic
921980494 1:221252181-221252203 TTGCAGACTGAGCTGGAGGGTGG - Intergenic
923287029 1:232506107-232506129 TGGCAGAGAGGGCTGGGGAAAGG - Intronic
924166241 1:241286356-241286378 TATCAGACAGAGCTGAAGAAGGG - Intronic
924867413 1:247999874-247999896 TAACACATAGAGCTGGAAAATGG - Intronic
924871304 1:248048679-248048701 TTGCACATAGGGCTGGGAAATGG - Intronic
1063705866 10:8430262-8430284 GTGTAGATAGAGCTCTAGAATGG - Intergenic
1066589719 10:36981336-36981358 GTGAAGATGGAGCTGGAGATGGG + Intergenic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1067372579 10:45699230-45699252 TTGCTTTTAGAGCTGGAGATGGG - Intergenic
1067447077 10:46357713-46357735 TTGCTTTTAGAGCTGGAGATGGG - Intergenic
1067504281 10:46836946-46836968 TTGCTTTTAGAGCTGGAGATGGG - Intergenic
1067590306 10:47503047-47503069 TTGCTTTTAGAGCTGGAGATGGG + Exonic
1067637426 10:48011149-48011171 TTGCTTTTAGAGCTGGAGATGGG + Intergenic
1067758591 10:49025889-49025911 CTTCAGAGAGAGCTGCAGAATGG - Intronic
1067876063 10:50009185-50009207 TTGCTTTTAGAGCTGGAGATGGG - Exonic
1068352844 10:55871363-55871385 TTGAAGACAGAGCAGGAGATAGG + Intergenic
1069244443 10:66185249-66185271 TAGTAGATAGAGTTGGAGGATGG + Intronic
1069817424 10:71207226-71207248 GTGCTGATTGAGCTGGAGAGAGG - Intergenic
1070134023 10:73675578-73675600 TTGCTTTTAGAGCTGGAGATGGG + Exonic
1071607687 10:87008829-87008851 TTGCTTTTAGAGCTGGAGATGGG - Intergenic
1072240200 10:93488931-93488953 ATGCAAAGAGAGGTGGAGAAAGG - Intergenic
1072517790 10:96202865-96202887 TTCCACAAAGAGCTGGTGAAAGG - Intronic
1073364872 10:102931260-102931282 TTGGCCATAGAGCTGGAGCAGGG + Intronic
1075603371 10:123787202-123787224 GTGCAGACAGAGATGGAAAAGGG + Intronic
1076121729 10:127941725-127941747 TTGTAGAAAGAGCAGGGGAATGG - Intronic
1078338678 11:10483714-10483736 ATGCAGGCAGAGCTGGAGAGGGG - Intronic
1080032121 11:27672864-27672886 TTGCAAGTAGAACTGGAGACTGG + Intronic
1080871095 11:36237681-36237703 TTGCAGAAAGAGCTGGTGGAGGG + Intergenic
1083397423 11:62401382-62401404 TTGCACATGGTGCCGGAGAATGG - Intergenic
1083478782 11:62930316-62930338 TTGCAGCTGCAGCTGGAGAGAGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1085297487 11:75439262-75439284 TTTTAGACAGAACTGGAGAAGGG + Intronic
1085505015 11:77053427-77053449 TGACAGAGAGACCTGGAGAATGG - Intergenic
1086404919 11:86491427-86491449 TTGCAGACCGGGCTGGGGAACGG + Intronic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087565779 11:99855409-99855431 TTACAGAGAAAGCTGGAAAATGG - Intronic
1088016569 11:105067909-105067931 TTGCAGATAAAAATGTAGAAAGG + Intronic
1088095935 11:106101579-106101601 TTGCAAATAGAGGTGGGGGAGGG + Intergenic
1088972819 11:114788388-114788410 TTGCAGACACTGCTGGAGGAAGG + Intergenic
1089153193 11:116380496-116380518 TTGCAGAGACACATGGAGAAAGG - Intergenic
1089199689 11:116716593-116716615 ATGCAAAGAGAGCTGGAGAAGGG - Intergenic
1089429114 11:118406525-118406547 TTGAAGAAAGAGGTGAAGAAAGG - Intronic
1089809550 11:121120589-121120611 ATGGAGACAGTGCTGGAGAAGGG - Intronic
1090284936 11:125491662-125491684 TTGTAGGTAGAGATGGAGAATGG - Intronic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1091096681 11:132829506-132829528 TTGCAGACAGTGTTTGAGAAGGG + Intronic
1091501608 12:1023106-1023128 TTCTACATAGAGCTTGAGAATGG + Intronic
1092800213 12:12157344-12157366 ATGCAGGTAGACCTGGACAATGG - Intronic
1092974319 12:13729669-13729691 TAGCTGAAAGAGATGGAGAATGG + Intronic
1093252516 12:16824596-16824618 TTACAGCAAGAGCAGGAGAAAGG + Intergenic
1095172931 12:39056504-39056526 TTGCAGAGAGGGCTAGAAAAAGG - Intergenic
1095418492 12:42000841-42000863 GGGCAGATTGAGATGGAGAAAGG - Intergenic
1095499095 12:42817029-42817051 TTGTAGTTGGTGCTGGAGAAGGG + Intergenic
1096841106 12:54379567-54379589 TTGCAGAGGAAGCTGGGGAAGGG - Intronic
1098165402 12:67692103-67692125 TTTAAGATATAGCTGAAGAAAGG - Intergenic
1098203248 12:68079502-68079524 TTGCAGATAGAAGTGGCCAATGG - Intergenic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1100284966 12:93156488-93156510 TTTCAGATCTAGCTGGAGAGAGG - Intergenic
1100840974 12:98611500-98611522 CTGTAGATAGAGATGGAGACAGG - Intergenic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1103083164 12:118041491-118041513 TTGCTAAAAGAGCAGGAGAAAGG + Intronic
1103166913 12:118778197-118778219 TTGAAGACAGAGGTGGAGACTGG + Intergenic
1104276632 12:127334521-127334543 GTGCAGCTAGAGCTGGAGCAGGG - Intergenic
1104715821 12:131015552-131015574 TTGGAGATGGAGATGGAGATGGG + Intronic
1105758802 13:23494416-23494438 CAGCAGACAGGGCTGGAGAAAGG - Intergenic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1106474130 13:30082767-30082789 TTGAAGATGGAGCTGGAGAGAGG + Intergenic
1109137126 13:58666458-58666480 TCGCAGATGGAGCATGAGAAAGG - Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109530895 13:63645214-63645236 TTACAGATATATCTGAAGAAAGG - Intergenic
1110338051 13:74355032-74355054 TTGCAGAGAGGGATGGAGAGGGG + Intergenic
1113015477 13:105823860-105823882 GAGCAAATAGAGCTAGAGAAAGG - Intergenic
1114549878 14:23526554-23526576 CTGGAGATGGGGCTGGAGAAGGG + Exonic
1114588376 14:23835896-23835918 GTGAAGATTCAGCTGGAGAAAGG + Intergenic
1115733964 14:36303276-36303298 CTAAAGAAAGAGCTGGAGAAAGG + Intronic
1116467155 14:45247343-45247365 TTTCAGATAGAACTTCAGAAGGG + Exonic
1119971012 14:78970724-78970746 CTGCACATAGAGCTGTAGATAGG - Intronic
1121227055 14:92328761-92328783 TTGCAGATTGATCTGGCCAAGGG + Intronic
1122038512 14:98965322-98965344 ATGCAGAGAGAGCTGGGGATGGG - Intergenic
1122869128 14:104626964-104626986 TTGGAGAAATAACTGGAGAAGGG + Intergenic
1126915531 15:53461917-53461939 TTGCAGATAGAGCTATTGGAAGG - Intergenic
1127291012 15:57571193-57571215 TAGCATATAGAGCTGGACAAAGG + Intergenic
1128798627 15:70482487-70482509 ATGGCGATGGAGCTGGAGAAGGG + Intergenic
1129081540 15:73045478-73045500 TTGGAAATGGAACTGGAGAATGG - Intergenic
1130840034 15:87689959-87689981 ATGAATATAGAGCTGGAGAATGG - Intergenic
1131667351 15:94584797-94584819 TTGCTGAAATAGCTGGAGAATGG - Intergenic
1131864421 15:96692150-96692172 TCAGAGACAGAGCTGGAGAATGG + Intergenic
1133314635 16:4875117-4875139 TTGGAGATTGAGCTGGCAAAGGG - Exonic
1136609027 16:31355192-31355214 TTGCAGGAAGAGCTGGACCAAGG - Intronic
1137396793 16:48121824-48121846 TTCCAGATGCAGCTGCAGAAAGG - Exonic
1138149961 16:54647717-54647739 CCCCAGAAAGAGCTGGAGAAGGG + Intergenic
1138157480 16:54719548-54719570 TTGGTGGTAGAACTGGAGAAAGG + Intergenic
1138182661 16:54952756-54952778 AAGAAGATAGAGATGGAGAAAGG - Intergenic
1138309351 16:56009929-56009951 CTGAAGTTGGAGCTGGAGAAGGG + Intergenic
1140377696 16:74458012-74458034 TTGCAGACAGAGCTTTTGAAGGG + Intronic
1141455093 16:84136060-84136082 CTGCAGGTGGAGCTGAAGAAGGG - Intronic
1143412842 17:6722388-6722410 TTGCAGTTTGGGCTGGGGAATGG - Intergenic
1143767909 17:9149703-9149725 TTGCTGATAGATCTGGAGCTTGG + Intronic
1143834437 17:9679030-9679052 TTACAGTTGGAGGTGGAGAAGGG - Intronic
1145823960 17:27862604-27862626 CTGCAGATAGAGTTCAAGAAAGG + Intronic
1146437489 17:32864215-32864237 TTACAGGTAGAGGTGGAGTAGGG - Intronic
1148716435 17:49719376-49719398 TACCAGGTAGAGATGGAGAAGGG + Intronic
1148879374 17:50714036-50714058 TAGCAGATGAAGTTGGAGAAGGG + Intergenic
1149037483 17:52151430-52151452 TTGTAGATACAAGTGGAGAAGGG - Intronic
1149394601 17:56226729-56226751 TTGGAGAGAGTGCTGGAGAGAGG + Intronic
1150265267 17:63828132-63828154 CTTCAGATGGAGCTGGAGGAGGG + Exonic
1152126432 17:78450100-78450122 CTGCAGATGGAGCTGGAAGAGGG - Intronic
1152349466 17:79776700-79776722 TTGCAAAGAGGGCAGGAGAAAGG - Intergenic
1152930394 17:83106380-83106402 ATTCAGATATAGCTGGAGGATGG + Intergenic
1153183855 18:2465798-2465820 TTTCAGTCAGAGATGGAGAAGGG - Intergenic
1153331797 18:3881349-3881371 TTAAAGATAGAACTGGAGAGGGG + Intronic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1156506787 18:37600877-37600899 TGGCATACAGAGCAGGAGAAGGG + Intergenic
1156848800 18:41701469-41701491 ATGGAGATAGAGCAGGAGAGAGG - Intergenic
1156911068 18:42411575-42411597 TTTCCCATAGAGCTTGAGAAAGG - Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157230788 18:45913917-45913939 TTGCTGATTGAGCTTGAGATAGG - Intronic
1159676472 18:71289289-71289311 AAGAAGAGAGAGCTGGAGAAAGG - Intergenic
1162447029 19:10729738-10729760 TCCCAGGTAGAGCTGGAGGAAGG - Intronic
1163105987 19:15123343-15123365 TTGCAGAGAGGGCTGGGGACTGG - Intronic
1164483691 19:28636666-28636688 TTGTAGATAGAGATTGAGAGGGG + Intergenic
1164662310 19:29986578-29986600 TTTGAGAATGAGCTGGAGAATGG + Intronic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1166643083 19:44511328-44511350 TTGCAGATCCAGCAGGAAAAAGG - Intronic
1166728780 19:45045841-45045863 TTGCTGATAGAACTGGAGTTTGG + Intronic
1168471888 19:56646743-56646765 TTGCTGATGGATGTGGAGAAGGG + Intronic
925587366 2:5476698-5476720 TTGCAGCTAGTGCCAGAGAAAGG + Intergenic
928700450 2:33893679-33893701 TTGGAGATAGGGATGGAGATGGG - Intergenic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
933438656 2:82281929-82281951 TTGCAGAAAGAGCAGGAGGTAGG + Intergenic
934544820 2:95206126-95206148 TTGGAGATTCTGCTGGAGAAAGG + Intergenic
934761873 2:96861038-96861060 CTGCGGGAAGAGCTGGAGAAAGG - Exonic
934779086 2:96957732-96957754 AAGAAGAAAGAGCTGGAGAAAGG - Intronic
935406047 2:102709996-102710018 TTGCTGGTGGAGGTGGAGAAGGG - Exonic
936409084 2:112238094-112238116 TTGTAGAGGGAGCTGGAGGATGG - Intronic
936724497 2:115296484-115296506 TTGAAGAGAGAGCAGGGGAATGG + Intronic
938506175 2:131886029-131886051 TCACTGATAGAGTTGGAGAAGGG - Intergenic
938961859 2:136351430-136351452 TGGAAGAAAGAGCTGAAGAACGG + Intergenic
940694544 2:156961881-156961903 TTAAAGAAGGAGCTGGAGAAAGG - Intergenic
940776711 2:157892298-157892320 TTATAGAGAGAGTTGGAGAAGGG + Intronic
941069978 2:160944868-160944890 TAGCACATAAGGCTGGAGAAGGG + Intergenic
941115426 2:161466822-161466844 CTTCAGATAGAGCTGGAGAAAGG - Intronic
941645572 2:168036801-168036823 TTCCAGAGAGAGGTTGAGAAAGG + Intronic
942386802 2:175451374-175451396 TTGCAGATAGACATGGAGTGGGG + Intergenic
942394000 2:175526968-175526990 ATGCAGATAAAGATGGGGAAGGG - Intergenic
943413963 2:187575442-187575464 TTTCACATAGAGTTGGGGAAAGG - Intergenic
944404729 2:199370707-199370729 TTGAAGATATAGCAGGAGCAAGG - Intronic
944441453 2:199747764-199747786 GTGCAGAATGAGCTGGAAAATGG - Intergenic
945432032 2:209775927-209775949 CTTCAGAGAGAGCTGGAGAGAGG - Exonic
945538822 2:211056605-211056627 GTGCAGATAGAGATGAAAAATGG - Intergenic
945814612 2:214589115-214589137 TTGCAGATAGAGCTATGAAAGGG - Intergenic
946134358 2:217633576-217633598 TTCCAGCCAGAGCTGGAGGAAGG + Intronic
946337452 2:219047936-219047958 TTGCAGACAGAGCTGGGAATGGG - Intergenic
946434270 2:219641576-219641598 TTGGAGGAGGAGCTGGAGAATGG + Intronic
946830670 2:223725280-223725302 CTGCAGATAAAGCTTCAGAAAGG + Intergenic
947926552 2:233926827-233926849 CTGGCCATAGAGCTGGAGAAGGG - Intronic
948402396 2:237693073-237693095 CTGCATATTGAGCTGGACAACGG - Intronic
948608354 2:239151006-239151028 TTGCAGAAACTGCTGGAGAGGGG - Intronic
1168784852 20:529409-529431 TGGCATATACAGCTGGACAAAGG - Intronic
1168824544 20:801025-801047 TGGCAGAGAGCGCTGGAGAGTGG + Intergenic
1169204021 20:3730171-3730193 TTGCAGATAGAGATGGACTGGGG + Intergenic
1169598456 20:7227866-7227888 AGGCAGATAGAACTGAAGAAAGG + Intergenic
1170262005 20:14419557-14419579 TAGCAGCTAGAGCGGGAGGAGGG - Intronic
1171413061 20:24959410-24959432 CTGCAGAGAGAGCAAGAGAACGG + Intronic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1173503048 20:43567244-43567266 TGGGAGATAGAGCTGGGGAAAGG - Intronic
1175717127 20:61262704-61262726 TTGCAAATGGAGGTGGATAAAGG + Intronic
1177168962 21:17634505-17634527 TTGCAGATGTAGCTAGAGAAAGG + Intergenic
1179330004 21:40390694-40390716 GTGAAGATAGAGGTGGAGATTGG - Intronic
1179509787 21:41864976-41864998 TTGCAGAGAGGGCTGGGGAGAGG - Intronic
1179531056 21:42019966-42019988 GTGCAGCTAGAGGTGGTGAAAGG - Intergenic
1180597100 22:16984809-16984831 GAGCAGAGTGAGCTGGAGAAGGG - Intronic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1182031865 22:27165462-27165484 TTTCAGGTAGAGTTGGAGGAGGG + Intergenic
1182423846 22:30261708-30261730 TGGCAAATAGAGCTGGGGATGGG - Intergenic
1183274723 22:36886650-36886672 GTGGAGAAAGAGGTGGAGAAAGG - Intergenic
1185101205 22:48841811-48841833 CTGCAGATGGAGCTGGGGGATGG + Intronic
949110527 3:255012-255034 TTGTAGCTAGAGATGGAGATAGG - Intronic
949362777 3:3249298-3249320 CAGAAGATAGAGCTTGAGAAAGG - Intergenic
950434950 3:12973904-12973926 GTGCAGAAGGAGCTGGGGAAAGG - Intronic
952860102 3:37805990-37806012 TTGCAGATTGCCCTGTAGAAAGG + Intronic
953127043 3:40101196-40101218 TTGCAGATATACTGGGAGAATGG - Intronic
955701495 3:61686278-61686300 TGACAGATAGAGCTGGAGCTAGG + Intronic
956085462 3:65604379-65604401 TAGCAAATACTGCTGGAGAAAGG + Intronic
956550313 3:70451266-70451288 TTGCCGATGGGGATGGAGAATGG - Intergenic
956883942 3:73539616-73539638 TTGCAGTTGGTGCTGGACAATGG - Intronic
959077068 3:101760473-101760495 TTGTAGAGAGAGCAGGGGAAGGG + Intronic
959556859 3:107729671-107729693 TAGCAGATTGAGCAGGAGAAAGG + Intronic
959873392 3:111353646-111353668 TTACTCATAGATCTGGAGAATGG - Intronic
960058898 3:113298392-113298414 TTGGATCTAGAGATGGAGAAAGG + Intronic
960236030 3:115283189-115283211 TAGTGGATAGAGCAGGAGAAGGG - Intergenic
961572406 3:127809268-127809290 TTGCAGCTAGAGCTGGCTATAGG - Intronic
963374494 3:144446579-144446601 TTGGAGATAGGACTAGAGAAAGG - Intergenic
965350778 3:167609335-167609357 TTGCTGGTAGGGGTGGAGAAGGG - Intronic
966435451 3:179878649-179878671 TTCAAGATAGATCAGGAGAAAGG - Intronic
966483270 3:180436535-180436557 TTGTAGATAGAAATGGAAAATGG + Intergenic
966545479 3:181142097-181142119 ATGCTGATAGAGCTGGGGAGGGG - Intergenic
966809296 3:183829147-183829169 TTTCAGATTGTGCTGGAGAGGGG + Intergenic
967273472 3:187750317-187750339 TGGCAGGGAGAGCTGGAGAGCGG + Intergenic
969244146 4:5921647-5921669 TGGCAGGCAGAGCTGGAGAGAGG + Intronic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971949373 4:33324909-33324931 TTGCAGAAATATCTGCAGAATGG + Intergenic
973249697 4:48048069-48048091 TTGCAGGTGGAGCTGGTGACTGG - Intergenic
973621399 4:52729749-52729771 TTGAAGACAGAGCTGGAGTAAGG + Intronic
973756710 4:54081936-54081958 TAGATGATAGAGGTGGAGAAAGG + Intronic
976422203 4:84858822-84858844 ATGGAGATAGATCTGGAAAAAGG + Intronic
976439444 4:85056334-85056356 GTGAAGAAAGAGGTGGAGAAAGG - Intergenic
976785283 4:88812540-88812562 AGGCAGAGAGAGGTGGAGAAAGG - Intronic
976815353 4:89141041-89141063 TTTCAGAAAGATCTGGAGGATGG + Intergenic
977293721 4:95190619-95190641 GTGCAGATAGAACTGTACAAGGG - Intronic
978842396 4:113229851-113229873 TTGTAGATAGATCAAGAGAAAGG - Intronic
979083726 4:116378822-116378844 TTGCAGATTGGGATGGAAAATGG + Intergenic
979212566 4:118122906-118122928 TTCCAGTGAAAGCTGGAGAAAGG + Intronic
980398532 4:132248017-132248039 TTGCTGAAAGAGTTGGAGAATGG - Intergenic
980948510 4:139347703-139347725 TTGCAGATAGTGATGGAGTTAGG - Intronic
981328102 4:143475704-143475726 ATGGAGATTGAGCTGGACAATGG + Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
982108285 4:152030163-152030185 GTGCAGAAAGACCTGGAAAAGGG - Intergenic
983631142 4:169850619-169850641 TTGAAGCTAGAGCTGGCAAAAGG + Intergenic
990107751 5:52285569-52285591 TACCAGATAAAGCTGGATAAAGG + Intergenic
991254475 5:64599286-64599308 TGGTACATAGAGGTGGAGAAAGG + Intronic
992229330 5:74648459-74648481 CTGCAGATTGTGCTGGAGAAGGG - Intronic
992229536 5:74650504-74650526 CCGCAGATTGGGCTGGAGAAGGG + Intronic
993854369 5:93055164-93055186 TAATAGATAGAGATGGAGAATGG - Intergenic
994233697 5:97337561-97337583 ATACAGATAGAGCTTCAGAAAGG + Intergenic
994612443 5:102060870-102060892 TTGTGGATGGAGCTGCAGAAAGG + Intergenic
994874211 5:105394019-105394041 CTGCACATTGATCTGGAGAAAGG + Intergenic
995364750 5:111345897-111345919 TGTCAGATGGAGCTGCAGAATGG + Intronic
996624138 5:125549553-125549575 TTGCAGAAACAGCTAAAGAAAGG - Intergenic
998662096 5:144250296-144250318 TTGCAGAAAGAGCTAGAGTGTGG - Intronic
999436371 5:151566623-151566645 TTTGACATAGAGCTGGAGACAGG - Exonic
1000310274 5:160036772-160036794 TTTCAAATAGAGCTGCAGCAAGG + Exonic
1002067874 5:176661253-176661275 CGCCCGATAGAGCTGGAGAAAGG + Intergenic
1002271907 5:178078006-178078028 TAGCAGAGACAGCTGGATAAAGG - Intergenic
1002449169 5:179309286-179309308 TGGTGGATAGAGCTGGAGAAAGG + Intronic
1004117375 6:12782675-12782697 TGTTAGATAGAGCTGGATAATGG + Intronic
1006762896 6:36479035-36479057 TTCCAGAATGAGGTGGAGAAGGG + Intronic
1007953270 6:45892340-45892362 TGGCAGTTAGAACTGCAGAAAGG + Intergenic
1008286138 6:49653429-49653451 TTGTAGCTAGAGCTGGATTAAGG - Intergenic
1009038641 6:58150022-58150044 TTACATATAGAGGTGGAGCATGG - Intergenic
1009214529 6:60904879-60904901 TTACACATAGAGGTGGAGCATGG - Intergenic
1010064401 6:71664209-71664231 TTGCCCATAGATATGGAGAAGGG + Intergenic
1010666055 6:78630541-78630563 TGGGAGATAGAGCTAGAGTAAGG - Intergenic
1011336109 6:86261410-86261432 TTGGAGGGAGAGCTGGGGAATGG - Intergenic
1011547667 6:88499166-88499188 TTTGAGAAAGACCTGGAGAAGGG + Intergenic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1012950882 6:105516484-105516506 GTGAAGATGGAGCTAGAGAATGG + Intergenic
1013086207 6:106859872-106859894 CTGCAGCTGGAGCTGGGGAAAGG + Intergenic
1014493393 6:122090239-122090261 CTGTAAGTAGAGCTGGAGAAAGG + Intergenic
1016725278 6:147358035-147358057 TTACAGACAGAGCTGGGTAAAGG + Intronic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1018632787 6:165835101-165835123 GTGCAGAGAGAGGTGGGGAAGGG + Intronic
1018633368 6:165839799-165839821 ATGGGGATGGAGCTGGAGAAGGG - Intronic
1019882412 7:3874603-3874625 CTGCAGATAGGGCAGGGGAACGG - Intronic
1021786915 7:24161382-24161404 TTTGAGATAGAGGTTGAGAAAGG + Intergenic
1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG + Intronic
1023234573 7:38070904-38070926 TTGCTGAAAGAGCCAGAGAAAGG - Intergenic
1023628877 7:42143127-42143149 TTGCAGTAAGAGCTGGAGTGAGG - Intronic
1023913495 7:44571436-44571458 TTGAAGATAGAGATGGAAAGGGG - Intronic
1023942200 7:44776408-44776430 TTGCAGAGAGATCTGGATCACGG + Intergenic
1028976841 7:96924024-96924046 GGGCAGAGAGAGCTAGAGAAAGG - Intergenic
1030170582 7:106598922-106598944 TTGCAGCTAGAGCAGTGGAACGG - Intergenic
1030638251 7:111974556-111974578 TTGCAGAGAGAGGAGGAGGAAGG + Intronic
1031162062 7:118180260-118180282 TTGAAGACAGAGCTTAAGAAAGG - Intergenic
1031905627 7:127457422-127457444 CTGCAGCTTGAGGTGGAGAAGGG - Intergenic
1033337134 7:140463444-140463466 TTGCAGGTATAGCTAGAGGAAGG - Intronic
1034206414 7:149319584-149319606 TTACAAATAGAGTTGGGGAAGGG + Intergenic
1035708870 8:1697363-1697385 CTGCAGATAGAGCATGACAACGG + Intronic
1035734443 8:1877855-1877877 TTACTGATAGAGATGGTGAACGG + Intronic
1036091436 8:5669851-5669873 GTGCATATAGAGGAGGAGAATGG - Intergenic
1036752074 8:11449702-11449724 TGGCACACAGAGCTGCAGAAAGG - Intronic
1037985899 8:23290329-23290351 CTGCAGCTAGACCTGGAAAAGGG + Exonic
1038210117 8:25510212-25510234 TTGCAGAGAGAGCTGCAGAGAGG - Intergenic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1039550494 8:38439712-38439734 TTGGAGAGAGAGAAGGAGAAAGG - Intronic
1042918018 8:73894219-73894241 TTGTAGATAGAGATGGGGAGAGG - Intergenic
1045219384 8:100182540-100182562 GGGCAGGGAGAGCTGGAGAAAGG + Intronic
1045537711 8:103047881-103047903 TTGCAGACAGAGAGAGAGAAAGG - Intronic
1045554447 8:103201925-103201947 TGGCAGATAAAGGTGGAAAATGG + Intronic
1046247555 8:111584700-111584722 ATGCAGAAGAAGCTGGAGAATGG + Intergenic
1048577775 8:135706472-135706494 TCTCAGATAGAGGTGAAGAAGGG - Intergenic
1048742505 8:137577561-137577583 TCAGAGATAGAACTGGAGAAGGG + Intergenic
1050135015 9:2453527-2453549 TTACACATAGAGCTGGGCAAGGG - Intergenic
1050150225 9:2612604-2612626 TTGTGGATAGAGATGGAGAGGGG - Intergenic
1050778678 9:9302400-9302422 TTGCATATGCAGCTGGAGAAGGG - Intronic
1051072597 9:13190151-13190173 CAGCACATAGAGCTGGAGAAAGG - Exonic
1051091299 9:13412025-13412047 TCCCAGAAGGAGCTGGAGAAAGG - Intergenic
1053000895 9:34576926-34576948 CTGCAGAAAGGGCAGGAGAAGGG + Intronic
1054723148 9:68623703-68623725 GTGGTGATAGAGATGGAGAAAGG + Intergenic
1055000865 9:71447334-71447356 TTGCAGAGAGAGGGGAAGAAAGG - Intergenic
1056208829 9:84345663-84345685 TGGCAGGTACAGTTGGAGAATGG - Intergenic
1057113126 9:92493061-92493083 ATGTAGCTGGAGCTGGAGAAAGG + Intronic
1057313841 9:93956920-93956942 CAGCAGCTGGAGCTGGAGAAAGG - Intergenic
1057921646 9:99103494-99103516 TTGCAAATAGAGCAGCAAAAAGG + Intergenic
1058455409 9:105133682-105133704 TTGCAGTTAGAGAAGGTGAAAGG + Intergenic
1058468258 9:105250476-105250498 TTGCAGTTTGAGCAGGGGAAAGG - Intronic
1058531619 9:105911538-105911560 TTTGAGCTGGAGCTGGAGAATGG - Intergenic
1060600087 9:124871450-124871472 CTGCAGATAGAGCGGCAGCATGG + Intronic
1061759930 9:132843557-132843579 GTGCAGGTTGACCTGGAGAAAGG + Intronic
1062532031 9:137006260-137006282 TGGCAGAAAGAGGTCGAGAAAGG - Intergenic
1186617580 X:11205357-11205379 TTGCTGTTACAACTGGAGAAGGG - Intronic
1190114585 X:47618412-47618434 TTGAAGAAGTAGCTGGAGAACGG + Intronic
1190938278 X:55015780-55015802 TTGGAGATGGAGCTGGGGAAGGG - Intronic
1193820317 X:86154445-86154467 TTGCAGGTTGAGATGGTGAAAGG - Intronic
1193848689 X:86508026-86508048 TTGCTGACAGAACAGGAGAAGGG + Intronic
1193996875 X:88375814-88375836 TTGAAGCTGGAGCTGGATAATGG - Intergenic
1194945337 X:100060007-100060029 TAACAGGAAGAGCTGGAGAATGG + Intergenic
1195906403 X:109848680-109848702 TTGGAGGAAGAGCTAGAGAAAGG + Intergenic
1195998884 X:110760046-110760068 ATGCAGCTAGAGCTGGGGAATGG - Intronic
1197734370 X:129839868-129839890 TTGAAGATAGGGCTGGAGGAGGG - Intronic
1197969397 X:132099413-132099435 TCACAGTTAGAGCTTGAGAAAGG - Intronic
1198317380 X:135482183-135482205 ATATAGATAGAGCTGGATAATGG - Intergenic
1198839794 X:140844264-140844286 GTGTAGTTTGAGCTGGAGAATGG + Intergenic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1199996542 X:153029967-153029989 CTGCAGATGGCCCTGGAGAAGGG + Intergenic