ID: 1022494735

View in Genome Browser
Species Human (GRCh38)
Location 7:30845734-30845756
Sequence CTGTGAAAGCAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 1, 2: 9, 3: 71, 4: 550}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022494723_1022494735 19 Left 1022494723 7:30845692-30845714 CCACCTCAGATGTTGCCCACCAC 0: 1
1: 0
2: 2
3: 16
4: 178
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550
1022494724_1022494735 16 Left 1022494724 7:30845695-30845717 CCTCAGATGTTGCCCACCACATC 0: 1
1: 0
2: 2
3: 28
4: 404
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550
1022494732_1022494735 0 Left 1022494732 7:30845711-30845733 CCACATCTGGTGGGGAAATGGTT 0: 1
1: 0
2: 1
3: 16
4: 114
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550
1022494729_1022494735 4 Left 1022494729 7:30845707-30845729 CCCACCACATCTGGTGGGGAAAT 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550
1022494719_1022494735 30 Left 1022494719 7:30845681-30845703 CCTGGAGGCCCCCACCTCAGATG 0: 1
1: 0
2: 2
3: 38
4: 266
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550
1022494730_1022494735 3 Left 1022494730 7:30845708-30845730 CCACCACATCTGGTGGGGAAATG 0: 1
1: 1
2: 0
3: 25
4: 331
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550
1022494721_1022494735 21 Left 1022494721 7:30845690-30845712 CCCCACCTCAGATGTTGCCCACC 0: 1
1: 0
2: 1
3: 20
4: 257
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550
1022494720_1022494735 22 Left 1022494720 7:30845689-30845711 CCCCCACCTCAGATGTTGCCCAC 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550
1022494722_1022494735 20 Left 1022494722 7:30845691-30845713 CCCACCTCAGATGTTGCCCACCA 0: 1
1: 0
2: 1
3: 16
4: 204
Right 1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG 0: 1
1: 1
2: 9
3: 71
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022494735 Original CRISPR CTGTGAAAGCAGATGGAGGA TGG Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900927799 1:5717127-5717149 CTGGGAGAGCAGATGCAGGCTGG + Intergenic
901089770 1:6633465-6633487 CTGTCCAGGCTGATGGAGGAGGG - Exonic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903907439 1:26696608-26696630 CTGGGAAAGGAGCTGCAGGACGG + Exonic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
907297986 1:53467782-53467804 CTATGGAAGGAGCTGGAGGAAGG - Intergenic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
908778885 1:67670104-67670126 CTTTCAAATCAGATGGATGAAGG + Intergenic
909025587 1:70478054-70478076 CTTTGTAAGCACATGGATGAAGG - Intergenic
909220286 1:72950603-72950625 CTGTGAAGGCTGATAGAGGTGGG - Intergenic
910239365 1:85069766-85069788 CTGGGATAGCATATGGAGAAGGG + Intronic
910726991 1:90349791-90349813 CTGTGAAAGCAGATGGGAAGGGG + Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
912314459 1:108654402-108654424 CTCTAAAGGGAGATGGAGGAGGG + Intronic
912579088 1:110704298-110704320 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
913018615 1:114764404-114764426 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
913229667 1:116731325-116731347 CTGTGAAGGCTGAGGGAGAAAGG - Intergenic
915366784 1:155321288-155321310 CCCTGAAAGGAGGTGGAGGATGG - Intronic
915718864 1:157968906-157968928 CTGTGCAAGCTGATGAAGGAGGG - Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915728599 1:158036847-158036869 CTGGGAGAGCAGATGAATGAGGG + Intronic
915900317 1:159842037-159842059 CTGTGTAAGCATCTGGGGGAAGG + Intronic
916392140 1:164342412-164342434 CTGGCAAAGCAGTGGGAGGAGGG - Intergenic
916818495 1:168375605-168375627 CTTTGAAAGGAGGTGGAGAAAGG + Intergenic
918484998 1:185019346-185019368 CTGTGAAGGCACAGGGAGTAAGG - Intergenic
918752416 1:188289674-188289696 CTGTGAAAGCAGCTGGGAGGAGG - Intergenic
919833111 1:201555849-201555871 CTGTGAAGGGAGATGGGGGGCGG + Intergenic
920455733 1:206099719-206099741 CTTTGACAGCAGGTGGATGATGG - Exonic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
921419753 1:214932714-214932736 ATGTGAAAGCACATTGAGGAAGG + Intergenic
921506224 1:215974007-215974029 ATTTGACAGCATATGGAGGAAGG + Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
921938238 1:220814429-220814451 CTGTGAAAGCTGACTGAGGCTGG + Exonic
922292360 1:224218999-224219021 AGCTGAAAGCAGATGGAGGAGGG + Intergenic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
923049674 1:230381893-230381915 CTGTGAGAGTGGATGTAGGATGG - Intronic
923218601 1:231873040-231873062 CTGTGGAAGAAGATGGTGGGAGG + Intronic
923263651 1:232291488-232291510 CTGAGAAGGAAGATGGAAGAAGG + Intergenic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923405156 1:233652405-233652427 ATCTGAAAGCAGATGCATGATGG - Intronic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
924154363 1:241160916-241160938 GTGTGAAATCAGAAGGAGTATGG + Intronic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
924690749 1:246347707-246347729 CTGTGACATCACATGGTGGAAGG - Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063432862 10:6006195-6006217 CAGTGAGAGGAGATGAAGGAGGG + Intergenic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1063958647 10:11287971-11287993 ATGTGGCAGCAGCTGGAGGAAGG - Intronic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1065875686 10:29995516-29995538 GCTTGAAAGCAGATGGGGGATGG + Intergenic
1065972346 10:30815619-30815641 CTGTGAAAGCAGAGGCTCGAGGG - Intergenic
1066098760 10:32098284-32098306 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1066615641 10:37290973-37290995 CTGCCAATGGAGATGGAGGAAGG + Intronic
1066680225 10:37930977-37930999 CTGTGACAGCTGATGGAGAAGGG - Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068110851 10:52679053-52679075 CTGTGAAAGATAATGAAGGAGGG + Intergenic
1068252135 10:54456235-54456257 CTGTGAAAGCAGCTGAAGGGGGG + Intronic
1070654843 10:78264292-78264314 CTGTGCAGGCACATGGAGGGAGG + Intergenic
1071035423 10:81238842-81238864 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1071265056 10:83957644-83957666 CTGGGAAAGGAGCTGGAGGGAGG + Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071738280 10:88326798-88326820 CTGTGAAAGCAGCTGGGAGGAGG + Intronic
1071889307 10:89985301-89985323 CTGTGAAGGTACATGGAGGTGGG - Intergenic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1072486183 10:95858200-95858222 CTGTGAAAGCAGATAACAGAGGG + Intronic
1072613046 10:97031681-97031703 CGGAGGAAGGAGATGGAGGAAGG + Intronic
1073219598 10:101859338-101859360 CTGAGACAGCAGCTGCAGGAAGG + Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074231104 10:111536175-111536197 TTATGTAAGCAGATGTAGGAAGG - Intergenic
1075542451 10:123326399-123326421 ATATGAAAGCAGAGGCAGGAAGG - Intergenic
1076140723 10:128077020-128077042 CTGAGAAGGCACCTGGAGGAGGG - Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1077067829 11:651638-651660 CTTTGAAAGGAGACTGAGGAGGG + Intronic
1077223615 11:1428089-1428111 AAGTGAAAGAAGATGGAGGCAGG + Intronic
1077474645 11:2780555-2780577 CTGAGAAAACAGTTGGAGGCTGG - Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1080083715 11:28253234-28253256 CTGAGATAGGAAATGGAGGATGG - Intronic
1080916497 11:36665658-36665680 TTGAGAAAGCAGGTGGAAGAGGG - Intergenic
1081029574 11:38061701-38061723 CTGACAAAGCAGATGGAGTTGGG - Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082148616 11:48702869-48702891 CTGTGAAAGTATATATAGGAGGG - Intergenic
1082708120 11:56518699-56518721 CTGTGTCAGCCCATGGAGGAAGG + Intergenic
1083711722 11:64553855-64553877 ATGTGAAAGCATATGGACGGAGG + Intergenic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1085564121 11:77497497-77497519 CTGTGAAAGCAGTTGGTAAAAGG - Intergenic
1086334022 11:85781871-85781893 CTGTGAAAGCAGTTGGGAGGGGG - Intronic
1086669331 11:89527974-89527996 CTGTGAAAGCATCTGGGAGAGGG + Intergenic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087839871 11:102909600-102909622 CAGTGAAAGGAGATAGAGGTGGG + Intergenic
1087908562 11:103726971-103726993 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089166512 11:116481617-116481639 CTATGAAAGCAGATGGCGTAAGG - Intergenic
1089958627 11:122596141-122596163 CTTTGAAAGCAGATGACAGAGGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090788076 11:130068134-130068156 CTGTGTTCGCACATGGAGGAGGG + Intergenic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1091521471 12:1248386-1248408 CTGTGATAGATGATGGGGGAGGG + Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1095380183 12:41581632-41581654 GGGAGAGAGCAGATGGAGGAAGG + Intergenic
1095614518 12:44172405-44172427 ATGTGAATGAAGATGGAGGCAGG - Intronic
1097360437 12:58653809-58653831 CTGTGAAAGCAGCTGGGTGAGGG - Intronic
1097445687 12:59668300-59668322 CTGTGAAAGCAGCTGGGAGGAGG + Intronic
1097559178 12:61180682-61180704 CGGTGATAGCAGTTGGAGGTTGG - Intergenic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098720500 12:73891794-73891816 GGGTGTAAGCAGATGTAGGAGGG - Intergenic
1100854968 12:98750349-98750371 CTGTGAGACCAGATGCTGGAGGG + Intronic
1101922981 12:108947884-108947906 CTGTGAAGGCAGATGGTGCTGGG + Intronic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102295255 12:111731348-111731370 TGGAGAAAGAAGATGGAGGAGGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1103197547 12:119058031-119058053 CTGGGAAAGAAGATGGGGAAGGG + Intronic
1103264638 12:119618480-119618502 CTGTGAAAGCAGCTAGGGAAGGG + Intronic
1103998904 12:124847697-124847719 TTTAGAAAGCAGGTGGAGGAAGG + Intronic
1105207968 13:18238895-18238917 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1105550327 13:21388785-21388807 CTGTGCACGCGGATAGAGGATGG + Intronic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107223705 13:38019774-38019796 TTTTGAAAACATATGGAGGATGG - Intergenic
1108264580 13:48693648-48693670 CTCTGAAAAGAGAGGGAGGAAGG + Intronic
1108790737 13:53966600-53966622 CCATGAAAGCAGCTGGAGGGAGG + Intergenic
1109749636 13:66672638-66672660 CTGTGAAAGCAGTTGGGAGGGGG + Intronic
1110168893 13:72476064-72476086 CTGTGAAAGACGATGGTGAAGGG + Intergenic
1110522754 13:76499996-76500018 CTATGAAAGCACATGGATGGAGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112501188 13:99944678-99944700 CTCTGTAAGCAGGTGGAGGCAGG - Intergenic
1113140280 13:107140169-107140191 CTGTGAAAGCAGACTGTGGTAGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113437452 13:110304474-110304496 GTGTGAAAGCTGCTGCAGGAAGG + Intronic
1114680435 14:24479672-24479694 CTGTGAAAGCAGCTAGAAGTTGG - Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115249332 14:31329608-31329630 CTGTGAAAGTAGGTGGGGCAGGG - Intronic
1115929806 14:38478323-38478345 CCATGAAAGCAGCTGGAGGGAGG + Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118164013 14:63318066-63318088 CTGAGAATGCACTTGGAGGATGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1120591003 14:86373067-86373089 CTGTGAAAGCAGCTTGGAGAGGG + Intergenic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122839433 14:104448678-104448700 GTGTTAAAGAAGATAGAGGAAGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124413008 15:29452198-29452220 CTGAGAAAGCAGATGGTTGTGGG - Intronic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1125539498 15:40461845-40461867 CTCTGAAAGCAGATGGGTGATGG + Intronic
1126296993 15:47150804-47150826 TGGTGAAAGCAGAAGCAGGAGGG + Intergenic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126540897 15:49822173-49822195 TAGTGAAAGCAAATGAAGGAGGG - Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127699191 15:61480545-61480567 CTGTGAAAGCAAATGCAGTCGGG + Intergenic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1128904177 15:71452455-71452477 CTTTGAGAGCTGAGGGAGGAGGG - Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1130408228 15:83622346-83622368 GAATGAAAGCTGATGGAGGATGG - Intergenic
1130665373 15:85864862-85864884 CTTTGAAAGCAGGTGTGGGAGGG - Intergenic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132811259 16:1798947-1798969 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134060536 16:11197127-11197149 CTGTGAAAGCCCACAGAGGATGG + Intergenic
1135054929 16:19223674-19223696 CTGTGAAAGCAGCTGTAGTCAGG + Intronic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1136363225 16:29795102-29795124 CTGTGAAAGCAGGCAGAGGAAGG + Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140782318 16:78307982-78308004 ATGTGGCAGCTGATGGAGGAAGG + Intronic
1141089456 16:81120289-81120311 CTGTGGAGGCAGTTGGAGGAGGG + Intergenic
1141306044 16:82865138-82865160 CTGTGAAAGCAGCTGGGAGTGGG - Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1143593699 17:7901328-7901350 CTGCGAAAGCTGAAGGAGCAAGG + Exonic
1144463421 17:15477438-15477460 CTATTACAGCAGAAGGAGGAAGG - Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1146575182 17:33984779-33984801 TGCTGAAAGGAGATGGAGGAAGG + Intronic
1146848543 17:36201673-36201695 CTGCCAAAGGAGATAGAGGAGGG - Intronic
1147356033 17:39897485-39897507 TTCAGAAAGCAGAGGGAGGAGGG + Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1147834359 17:43319496-43319518 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1149029555 17:52067651-52067673 CTGTGAAAGCAGCTGGGAGGTGG + Intronic
1149130992 17:53302538-53302560 CATTGAGAGCAAATGGAGGAAGG + Intergenic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151272457 17:73007523-73007545 TGGTGAAAGCAAAAGGAGGAAGG + Intronic
1151485007 17:74393553-74393575 CTTTGACAGCAGATGGATGATGG - Intergenic
1152350811 17:79783130-79783152 CCTTGAAAGCTGATGGTGGACGG + Intronic
1152435372 17:80273218-80273240 CTGTAACGGCAGATGAAGGAAGG - Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1155200833 18:23516183-23516205 CTGTGAGAGGACATGGGGGACGG + Intronic
1155864713 18:30950898-30950920 CTGTCATTGAAGATGGAGGAAGG + Intergenic
1156074393 18:33255749-33255771 CTGGGACAGGAGATGGAGCAAGG + Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157378558 18:47189838-47189860 CTGTGAAGGCAGAGGGTTGAGGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158035741 18:53027738-53027760 CTGTAAAAGAAGTTGGAGGCTGG - Intronic
1158600427 18:58851702-58851724 CAGTGAATGAAGTTGGAGGAAGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1160479053 18:79221334-79221356 CTGTGGAAGCAGATGGCTGCAGG - Intronic
1161344130 19:3759599-3759621 CTCTGGAAGAAGATAGAGGAGGG + Exonic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161634196 19:5377060-5377082 CTGTGAGAACATGTGGAGGAAGG + Intergenic
1161676248 19:5651681-5651703 GTGAGAAAGCACAGGGAGGAGGG - Intronic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1162813828 19:13181247-13181269 CTTTGAACGCACATGCAGGACGG - Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164595147 19:29527200-29527222 CTGTGAATGCAGCTGGGGGTGGG - Exonic
1164886357 19:31782038-31782060 CTCTGGAGGCTGATGGAGGAGGG - Intergenic
1165848059 19:38831655-38831677 CTGTTATAGCAGATGTAGGACGG - Intronic
1166907819 19:46125578-46125600 CTGTGCCAGCAAGTGGAGGATGG - Intergenic
1167403534 19:49288893-49288915 CCGTGAAAGCAGCTGGAAGGGGG + Intergenic
1167646643 19:50709477-50709499 CTGAGAAAGGAGATCAAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925436544 2:3843106-3843128 CTGTGATAGCAGGGGGAGAAGGG + Intronic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
926526831 2:13991847-13991869 CTATGAAAGCAGCTGGGGGTCGG - Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927341855 2:21992079-21992101 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927515600 2:23670068-23670090 CTGAGAACCCAGATGCAGGAAGG - Intronic
927815942 2:26217555-26217577 ATCTGAAAGCAGACAGAGGAAGG + Intronic
928109351 2:28494126-28494148 ATGTGAAAGGAGTTAGAGGAAGG + Intronic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
929875888 2:45795997-45796019 GAGTGAAGGGAGATGGAGGATGG - Intronic
930427796 2:51233925-51233947 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932531873 2:72543117-72543139 TTGTGAGAGCACATGGAGTATGG + Intronic
933508069 2:83204004-83204026 CTGTGAAAGCAGCTGGGAGTGGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
934498224 2:94830416-94830438 TTGTGAAAGCACACGGAGGGAGG - Intergenic
935016908 2:99191492-99191514 CTGGGAAATTAGATAGAGGATGG - Intronic
937696795 2:124817327-124817349 TTGTAAAAGCATATGGAGCATGG + Intronic
937856068 2:126672730-126672752 CTGTGAAAGGAGGTGGATAAGGG + Intronic
937856933 2:126678911-126678933 CTGTCAAACCCGGTGGAGGAAGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
940596127 2:155795470-155795492 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
940807707 2:158206507-158206529 CCCTGAAAGGGGATGGAGGAGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942396175 2:175551989-175552011 CTAGCAAAGCAGATGGGGGAGGG + Intergenic
943169830 2:184384656-184384678 ATGTGAGAACAGATGGAGAACGG - Intergenic
943286414 2:186007135-186007157 CTGTGAAAACAGAGAGAGGGAGG - Intergenic
943609424 2:190015000-190015022 CTGTGAAAGCAGCTGGGAGGTGG - Intronic
943641828 2:190368005-190368027 CTGTGAATGCACTTGTAGGATGG - Intronic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
944455302 2:199887489-199887511 CTGAGAAAGCAGGTGTAGAATGG + Intergenic
945036630 2:205709092-205709114 CTAAGACAGCAGATGGAGGACGG + Intronic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
946180404 2:217945664-217945686 TGGTGAAAGCAGATGGACTATGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948855061 2:240726312-240726334 CATTAAAAGCACATGGAGGATGG + Intronic
1168753499 20:299757-299779 CTGAGAAATCACCTGGAGGAGGG + Exonic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169783102 20:9330189-9330211 CTGGGAAAGCAGGTGGAGTCTGG - Intronic
1170152126 20:13236892-13236914 CCCTGAAAGCAGCTGGAGGGAGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1170974301 20:21147991-21148013 GTGTGGCAGCAGATGAAGGAAGG + Intronic
1171113609 20:22505355-22505377 CTGGGAAAGATGATGGAGAATGG + Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172061034 20:32187709-32187731 CTCTGCAAGCAGGGGGAGGAGGG + Intergenic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1173040605 20:39458965-39458987 CAGTGAAAGCCCATGGAAGAGGG + Intergenic
1173583127 20:44161286-44161308 GTATGAAACCATATGGAGGAAGG + Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175801825 20:61805366-61805388 CTGTGTTGGCAGATGGAGGTGGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176877717 21:14149860-14149882 CCATGAAAGCAGCTGGAAGAGGG - Intronic
1177474971 21:21608364-21608386 CTGTGAATGAAGATTCAGGAAGG - Intergenic
1177551071 21:22623256-22623278 TTGAGAAAGCAGATGAAGGTGGG + Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178425870 21:32477972-32477994 CGGTGACAGCATATGGCGGAGGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179029127 21:37704521-37704543 CTGTGAAAGCGGACGGATAATGG - Intronic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1180036905 21:45254767-45254789 TTGTGAAAGCAGAGGGAGCCTGG + Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180758533 22:18180780-18180802 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180768820 22:18364572-18364594 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180777492 22:18497823-18497845 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180810214 22:18755133-18755155 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1180826695 22:18867796-18867818 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181196356 22:21189385-21189407 CTCTGCAAGCAGCTGGATGAAGG - Intergenic
1181213171 22:21303739-21303761 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1184270804 22:43381857-43381879 CTGCGAGAGCTGCTGGAGGATGG - Intergenic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185032796 22:48453563-48453585 CTGAGAGAGCAGATGGGGCAAGG + Intergenic
1185380443 22:50505326-50505348 AGGTGAAAGCTGGTGGAGGAGGG + Exonic
1185387768 22:50544194-50544216 CTGTGGCCGCAGTTGGAGGATGG - Intergenic
1203230442 22_KI270731v1_random:105456-105478 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
1203276838 22_KI270734v1_random:93706-93728 CTCTGCAAGCAGCTGGATGAAGG + Intergenic
949942192 3:9163575-9163597 CTGTCAAAGCAGAGGGGGCAGGG + Intronic
950108921 3:10406065-10406087 CTGAGAAAGCAGTTGGGGCAGGG - Intronic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950704876 3:14773436-14773458 GTAAGAAAGAAGATGGAGGAGGG + Intergenic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
951099411 3:18669395-18669417 ATATGAAAGCAGGTGGAGGGGGG - Intergenic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
952070252 3:29625773-29625795 CTGTCAAAGCTGATGGATGGTGG - Intronic
952504476 3:33995582-33995604 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
953136100 3:40183065-40183087 TTCAGACAGCAGATGGAGGAAGG + Intronic
953472130 3:43176721-43176743 CGGAGAAAGGAAATGGAGGAAGG + Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
956064355 3:65381251-65381273 ATCTGAAGGCAGTTGGAGGAAGG + Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
957358690 3:79125849-79125871 CTGAGAGAGCATATGGAGGAGGG + Intronic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
957502055 3:81069775-81069797 TTATAAAAGCAGATGAAGGATGG - Intergenic
958870946 3:99558322-99558344 CTGGGACAGTAGATGGGGGAAGG + Intergenic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961369776 3:126422361-126422383 CTCTGACAGCAGATCCAGGAGGG - Intronic
961486983 3:127223503-127223525 CTGTGAAGACAGATGTGGGAGGG + Intergenic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
961864319 3:129942524-129942546 AGCTGAAAGGAGATGGAGGAGGG + Intergenic
963115849 3:141728329-141728351 ATGGGAAAGAATATGGAGGAGGG + Intergenic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
964630810 3:158808331-158808353 CGGTGTAAGGATATGGAGGAAGG + Intronic
965511538 3:169573138-169573160 CTGTGAAAGCAGAGGGTGAGGGG - Intronic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
966314759 3:178633119-178633141 CTGTGAAAGGAGCTGGCGGGGGG - Intronic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
966974083 3:185069891-185069913 CTGGGAAAGCAGCTGCAAGAGGG - Intergenic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968358259 3:198124813-198124835 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971537892 4:27777401-27777423 CTCTGAAGGCTGAGGGAGGAGGG + Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971962579 4:33507888-33507910 CTATGAAAGCAGATGGGAGGGGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972250382 4:37293652-37293674 TTATGAAACCAGATGGTGGATGG + Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974177697 4:58345222-58345244 CTGTGAAAGCAGGCAGAGCAGGG + Intergenic
974269563 4:59633165-59633187 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
974566652 4:63586301-63586323 TTGTTAAAGTATATGGAGGATGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
975381886 4:73710125-73710147 CTGAGAAAGGAGATGTAGAAAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977796254 4:101168497-101168519 CAGTGAATGTAGATAGAGGAGGG + Intronic
977932015 4:102759979-102760001 CAGCAAAAGCAGTTGGAGGATGG + Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978470004 4:109054992-109055014 CTCTGAATGTAGCTGGAGGATGG - Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
978974027 4:114846606-114846628 TTTTGACAGCATATGGAGGAGGG - Intronic
978991294 4:115085006-115085028 CTGTGAAAGCAGATGTGAGGGGG + Intronic
979293373 4:119002734-119002756 CTTAGGAAGCAAATGGAGGAAGG - Intronic
979645216 4:123060149-123060171 CTGTGAAAGCAGCCAGAGGGAGG - Intronic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
979972894 4:127159601-127159623 GGGGGAAAGGAGATGGAGGAAGG + Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
984121352 4:175749013-175749035 CTGTGAAGGCTGATTGAGGTGGG - Intronic
984516953 4:180752829-180752851 CCATGAAAGCAGCTGGAGGGAGG - Intergenic
984651148 4:182271887-182271909 CTGTGAGAGCAGGTGCAGCAGGG + Intronic
984998937 4:185465890-185465912 TGGTGAGAGCAGATGGATGAGGG + Intronic
985225072 4:187751316-187751338 CTGTGAAAGCAGCTGGGTGGGGG + Intergenic
985394362 4:189525958-189525980 TTGTGAAAGCAGCTGGAAGGGGG + Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
986105291 5:4653981-4654003 CTGTGGAAGCAGCTTGGGGATGG - Intergenic
986118084 5:4800485-4800507 CTGTGAAGGCAGGTGGAGCTGGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986507745 5:8470467-8470489 CAGTGAAAGCACATGGGAGAGGG - Intergenic
986798155 5:11232349-11232371 CTGTGAAAGCAGCTGGGAGTGGG + Intronic
987216531 5:15743534-15743556 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
987323529 5:16792456-16792478 ATGTGAGAGCTGATTGAGGATGG - Intronic
987585048 5:19843708-19843730 CTGTGAAAGCAGCCAGAGCAGGG + Intronic
988080715 5:26411095-26411117 TTGTTAAAGCAGTTGGAAGAGGG + Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989501833 5:42177205-42177227 CTTTGAAAGCAGCTGGAAGGGGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
991009767 5:61870735-61870757 CTATGATAGCAGATGGAGGCAGG - Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992013675 5:72555735-72555757 CTGAGAAAGCTAATGGAAGATGG - Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992776493 5:80093722-80093744 GCGTGAATGCAGATGGAGGCTGG - Intergenic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
995293891 5:110494994-110495016 CTATGAAAGCAGTAGGAGAATGG + Intronic
995392356 5:111653173-111653195 CCGTGAAAGCAGCTGGGGGGAGG - Intergenic
996013760 5:118508313-118508335 CTTAGAAAGGAGCTGGAGGAGGG + Intergenic
996839849 5:127836323-127836345 CTATGAAAGCAGCTGGGGCAGGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998980602 5:147698025-147698047 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG + Intergenic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000051243 5:157564618-157564640 AGGAGAAAGCAGATGGGGGAAGG - Intronic
1000189935 5:158900432-158900454 CTGTCATCGGAGATGGAGGAGGG + Intronic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002892974 6:1352805-1352827 CCATGAAAGCAGCTGGAGGGAGG - Intergenic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1003693290 6:8376137-8376159 CTGTGGGAGCATATGTAGGATGG - Intergenic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1005093414 6:22083126-22083148 CCGAGAAAGCAGATGCAGGTTGG - Intergenic
1005499557 6:26418050-26418072 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1006376957 6:33676994-33677016 CGCTGAAAGCAGAGAGAGGAAGG - Exonic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006817674 6:36863911-36863933 CTGTGAAAGCAGAGGGGCGGAGG - Intronic
1007018750 6:38497275-38497297 CTGTGACAGCAGTGGGAGGTGGG - Intronic
1007291825 6:40793365-40793387 ATTAGAAAGCAGATGGAGCAGGG + Intergenic
1007298240 6:40845164-40845186 TTGGGAAAGCAGGTGGGGGAAGG + Intergenic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1009051636 6:58283173-58283195 CTGTGAAAGCAGATGTAAATGGG + Intergenic
1009355510 6:62739882-62739904 CATTGAAAGTAGATGGAGGGAGG + Intergenic
1010630149 6:78189439-78189461 CTGTGAAGGCAGCTGGAAGGTGG - Intergenic
1010835879 6:80586900-80586922 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1011169411 6:84489372-84489394 CTGTGAAAGCAGCTGGGAGGGGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011700380 6:89949922-89949944 CTTTCAAAGCAGGTGTAGGAGGG + Intronic
1011805865 6:91071992-91072014 CTGTGAAAGTAGCTGGGGCAAGG + Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1012988114 6:105896795-105896817 CTGTGAAAGCAACTGAAGGATGG - Intergenic
1013677963 6:112488205-112488227 CTGTGATAGGAAAGGGAGGAAGG - Intergenic
1013910744 6:115272944-115272966 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014143563 6:117971350-117971372 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
1014288698 6:119533590-119533612 GTAAGAAAGCAGATGAAGGAGGG + Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017786563 6:157761760-157761782 CCGTGGAAGCAGGTGCAGGAAGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018638291 6:165884046-165884068 ATGTCAAAGCAGGTGGAGGAAGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019890146 7:3940039-3940061 GTCAGAAAGCAGGTGGAGGATGG + Intronic
1019890157 7:3940108-3940130 GTCAGAAAGCAGGTGGAGGATGG + Intronic
1019890168 7:3940177-3940199 GTCAGAAAGCAGGTGGAGGATGG + Intronic
1019967668 7:4513307-4513329 CCGTGAAGGCAGATTTAGGAAGG - Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020378439 7:7514760-7514782 CTGTGGAAGGAGTTGGAGGTGGG - Intronic
1021267949 7:18547924-18547946 TTGTGAATGCAAATGGAGGGAGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022909100 7:34882915-34882937 CTATGAAAGCAGCGGGAGGGGGG - Intergenic
1023682029 7:42696968-42696990 CTCTGAAACCAGAGGGAGCATGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024633103 7:51265262-51265284 CTGGGAAAGCAGGTGGGGGTTGG + Intronic
1026814355 7:73498510-73498532 TTGTGAAAGAGGATGAAGGAAGG - Exonic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1029794248 7:102876731-102876753 TTTAGCAAGCAGATGGAGGAGGG + Intronic
1030885344 7:114929803-114929825 AGATGAAAGGAGATGGAGGAGGG + Intronic
1031137576 7:117901595-117901617 CTGTGACAGCACAAGGAGCAAGG + Intergenic
1031726162 7:125242179-125242201 CTTTTAAATCAGTTGGAGGAGGG + Intergenic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034904752 7:154934260-154934282 CCGTGAAAGCAGCTGGCGGGGGG - Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1036095142 8:5715787-5715809 CTGTGAAAGCAAGGGAAGGAGGG + Intergenic
1036657031 8:10683375-10683397 CTGAGAAATCAGATGTGGGAAGG - Intronic
1036981533 8:13474584-13474606 CCGTGAAAGCAGCTGGGAGAGGG + Intronic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1038214737 8:25551149-25551171 CTGTGACAGCAGTAGGAGGTGGG - Intergenic
1039107364 8:34003997-34004019 CTGTGAAAGCAACTGGGGTAAGG - Intergenic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1040721402 8:50329169-50329191 CTGTGAAAGCAGCCAGGGGAGGG - Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041984782 8:63909129-63909151 CTGTGAAAGCAGCTGGGAGGTGG - Intergenic
1042266079 8:66910378-66910400 CTGTGAAAGCAGTGGGGAGAGGG + Intronic
1042407491 8:68422541-68422563 CTGTGAAAGCAGCTGGGAGGTGG - Intronic
1042755156 8:72202482-72202504 CTGTGAGAGCAGATGGGTGGGGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044732435 8:95240044-95240066 GTCTGAAAGCAGATGGGAGAGGG + Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1048450636 8:134530497-134530519 CTCTGAAATCAGATGGATGGTGG - Intronic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048580167 8:135724052-135724074 GTGTGAAAGCAGAAGGACAATGG - Intergenic
1048757198 8:137752978-137753000 CAGTGAAAGCAGATGATGTAGGG + Intergenic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1050063789 9:1737730-1737752 CTGTGAAAGGGAATGCAGGAAGG + Intergenic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051990332 9:23145252-23145274 CCGTGAAAGCAGCTGGGGCAGGG - Intergenic
1052008909 9:23383092-23383114 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1052846355 9:33339955-33339977 CTGTGAAAGCAGCTGGGAGGGGG - Intronic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1055679921 9:78704429-78704451 CTGTGAAAGCAGTTGGGAGGGGG + Intergenic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057218364 9:93242148-93242170 CTGTGATAGCACAGTGAGGATGG + Intronic
1057249488 9:93488754-93488776 ATATCAAAGCAGATGCAGGAAGG - Intronic
1057384200 9:94593077-94593099 ATGAGAGAGCAGATGCAGGAAGG + Intronic
1058404124 9:104652596-104652618 ATGTGAAAGCAGATGGCTCATGG - Intergenic
1059022987 9:110596767-110596789 CAGTGAAAGCAGCTGGGGAAGGG - Intergenic
1059500851 9:114752766-114752788 CAGTGAAAGGAGTTAGAGGAAGG - Intergenic
1060273930 9:122167935-122167957 CGATGAAAGCAGAGGGACGAAGG - Intronic
1061521732 9:131122238-131122260 CTCTGATAGCAGATTGAGGGAGG + Exonic
1061783565 9:133009707-133009729 ATGTGGCAGCAGATGGATGAGGG + Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062249188 9:135585839-135585861 CTGGGAGGGAAGATGGAGGAGGG - Intergenic
1062742131 9:138181346-138181368 CTCTGGAATCAGTTGGAGGAAGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187555540 X:20347858-20347880 CTGTGAAAGCAGAGGAGGAAGGG - Intergenic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1187706319 X:22013033-22013055 ATTAGACAGCAGATGGAGGAAGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1188286811 X:28336558-28336580 CTGTAAAAGCTGCTGGAGCAGGG + Intergenic
1188431950 X:30113575-30113597 CTGTGACATCACATGGTGGAAGG + Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189071253 X:37866373-37866395 CTGTGAAAGCAGCCGGGGGTTGG - Intronic
1189431760 X:40953217-40953239 CTGTGAAAGGAGTTCAAGGATGG - Intergenic
1190336225 X:49264050-49264072 CTGGGAAGGCAGGTGGGGGAAGG + Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1193370777 X:80694521-80694543 CTGTGAAAGCAGCTGGGAAAGGG + Intronic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1194300645 X:92182061-92182083 CAGTAAAAGCAGCTGGAGGGAGG + Intronic
1195206990 X:102611102-102611124 CTGTGAAAGCAGCTGGGAGTGGG + Intergenic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1197581950 X:128294572-128294594 CCGTGAAAGCAGCTGGGAGAAGG + Intergenic
1197966915 X:132073951-132073973 TTGTGAAATCAGATGCAGAAGGG + Intergenic
1198274726 X:135089794-135089816 CTGTGAAAGCAGCTGGGAGGGGG + Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198834986 X:140795456-140795478 CTGTGAAAGCAGCCGGGGGGTGG - Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199070361 X:143468840-143468862 CTGTGAAAGCAGCTGGGTGGGGG - Intergenic
1199185428 X:144910380-144910402 CTGTGAAAGCAGTTGGGAGGGGG - Intergenic
1199908331 X:152259009-152259031 CAGTGACAGCAGATTGGGGAGGG - Intronic
1199909700 X:152272210-152272232 CTGTGAAAGCAGCTGGGAGGGGG + Intronic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202046186 Y:20738972-20738994 CTGTGAAATCCCATGGAGGGTGG - Intergenic