ID: 1022495127

View in Genome Browser
Species Human (GRCh38)
Location 7:30848313-30848335
Sequence GTGAGATGGAGCAAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022495114_1022495127 18 Left 1022495114 7:30848272-30848294 CCCCACCCCATGTGTATGTGCAA 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495109_1022495127 25 Left 1022495109 7:30848265-30848287 CCCCCACCCCCACCCCATGTGTA 0: 1
1: 2
2: 13
3: 181
4: 1285
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495112_1022495127 22 Left 1022495112 7:30848268-30848290 CCACCCCCACCCCATGTGTATGT 0: 1
1: 1
2: 3
3: 45
4: 451
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495120_1022495127 11 Left 1022495120 7:30848279-30848301 CCATGTGTATGTGCAATGGTGAT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495111_1022495127 23 Left 1022495111 7:30848267-30848289 CCCACCCCCACCCCATGTGTATG 0: 1
1: 0
2: 7
3: 38
4: 463
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495113_1022495127 19 Left 1022495113 7:30848271-30848293 CCCCCACCCCATGTGTATGTGCA 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495119_1022495127 12 Left 1022495119 7:30848278-30848300 CCCATGTGTATGTGCAATGGTGA 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495110_1022495127 24 Left 1022495110 7:30848266-30848288 CCCCACCCCCACCCCATGTGTAT 0: 1
1: 0
2: 9
3: 110
4: 1069
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495115_1022495127 17 Left 1022495115 7:30848273-30848295 CCCACCCCATGTGTATGTGCAAT 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495116_1022495127 16 Left 1022495116 7:30848274-30848296 CCACCCCATGTGTATGTGCAATG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data
1022495118_1022495127 13 Left 1022495118 7:30848277-30848299 CCCCATGTGTATGTGCAATGGTG 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1022495127 7:30848313-30848335 GTGAGATGGAGCAAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022495127 Original CRISPR GTGAGATGGAGCAAAACTGC TGG Intronic
No off target data available for this crispr