ID: 1022495349

View in Genome Browser
Species Human (GRCh38)
Location 7:30849846-30849868
Sequence CAAAATAAGGACAATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 364}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022495349 Original CRISPR CAAAATAAGGACAATGTGGC TGG (reversed) Intronic
901697247 1:11017495-11017517 TAAAATAACAAGAATGTGGCCGG - Intronic
902699680 1:18163241-18163263 AAAAAAAAAGGCAATGTGGCAGG + Intronic
903100629 1:21025638-21025660 TAAAATAAGGCCAGTATGGCTGG - Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905945960 1:41901643-41901665 CAAAGTTAGGACAATGTCACTGG + Intronic
906222135 1:44089113-44089135 TAAAATAAGGGCAATAAGGCAGG + Intergenic
907342824 1:53749048-53749070 CAAAAGAAGGGCAGTGTGACTGG + Intergenic
907420173 1:54341935-54341957 CAAAAGAAGCCCAATGTGGCTGG + Intronic
907469817 1:54665992-54666014 CAGAAAAAGGCCAGTGTGGCAGG - Intronic
909064766 1:70921994-70922016 TAAAATAAGGACAATTTTGTTGG + Intronic
909379369 1:74980446-74980468 GAAAATAATGTAAATGTGGCTGG + Intergenic
909592725 1:77370087-77370109 CAGAATAAGTCCAAAGTGGCAGG + Intronic
909674313 1:78222036-78222058 CAAAATAAGGTCACTGCAGCTGG + Intergenic
910720660 1:90282627-90282649 TAAAATAAACACAATGTGGCTGG + Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
912079968 1:105923693-105923715 CAAAAGAAGGCCTATGTGGCTGG + Intergenic
912179049 1:107195675-107195697 AACAAGGAGGACAATGTGGCTGG - Intronic
913310109 1:117481452-117481474 CAAAAAAAGGACAATGTACTAGG + Intronic
913417191 1:118621601-118621623 AAAAATAGGCAAAATGTGGCCGG - Intergenic
914406654 1:147381118-147381140 GAAAAAAAGGTCACTGTGGCCGG - Intergenic
914568855 1:148895347-148895369 AAAAACAAGGACAATTTGGTAGG - Intronic
914603973 1:149234909-149234931 AAAAACAAGGACAATTTGGTAGG + Intergenic
914724092 1:150312887-150312909 TAAAATAAGGATAATGGGGCCGG + Intergenic
915113300 1:153578564-153578586 TAAAAGAAGGCCAGTGTGGCTGG + Intergenic
915186599 1:154111084-154111106 CCAAATAAGTAAAATCTGGCTGG + Intronic
915415294 1:155737338-155737360 TTCAATAAGGAGAATGTGGCAGG - Intronic
916173057 1:162015737-162015759 CAAAATGATGACATTGTGGATGG - Intronic
916357759 1:163932191-163932213 CAATGAAAGGACAATGTAGCAGG + Intergenic
916818746 1:168377979-168378001 CAGAATGGGGACAATGTGGCTGG + Intergenic
917180388 1:172290450-172290472 AATAAAAAGGCCAATGTGGCTGG + Intronic
917816319 1:178713373-178713395 CAAAAAAAGGCCAATGGGTCTGG + Intergenic
918180285 1:182081388-182081410 CATGCTAAGGACAGTGTGGCTGG - Intergenic
918949784 1:191122699-191122721 CAAAATAAAGACAATATGTATGG + Intergenic
1064410244 10:15098199-15098221 TCAAATAAGTTCAATGTGGCTGG - Intronic
1065208133 10:23376157-23376179 CAAAATTATGACAATGTGTAGGG - Intergenic
1066674199 10:37871515-37871537 CAGAGAAATGACAATGTGGCAGG - Intergenic
1067513589 10:46916193-46916215 CAATATAAGTACTATGAGGCTGG - Intronic
1067648663 10:48135641-48135663 CAATATAAGTACTATGAGGCTGG + Intergenic
1069433893 10:68362493-68362515 GAACAAAAGGAAAATGTGGCTGG + Intronic
1069436110 10:68384965-68384987 AAAAATTAGGCCAATTTGGCTGG + Intronic
1069555769 10:69396979-69397001 AAAAATAAGGAAATTATGGCCGG - Intronic
1070299587 10:75193522-75193544 CAAAAAAAGGAGAATGTGTTTGG - Intergenic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071382592 10:85083025-85083047 CTTAATAAGAACAATGTGGAAGG - Intergenic
1071466775 10:85947817-85947839 CAAAATAAGAACAAGGTCGAAGG - Intronic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1073365579 10:102938001-102938023 TAAAATAATGACAATGTGTGGGG + Intronic
1073579946 10:104656249-104656271 GAAAGGAAGGACAGTGTGGCTGG + Intronic
1074728118 10:116336314-116336336 AATAATAAGGCCACTGTGGCTGG + Intronic
1075293959 10:121256130-121256152 AAAAATAATGAAGATGTGGCAGG + Intergenic
1077620051 11:3713419-3713441 AAAAATAAAGAGAATTTGGCTGG + Intronic
1078984127 11:16574191-16574213 AAAAATAAGAATAAGGTGGCAGG + Intronic
1079349607 11:19681260-19681282 TCAAATAATGACAATGTGCCAGG + Intronic
1079442541 11:20529656-20529678 TAAAATAAGGACAATTAGGCTGG - Intergenic
1080576440 11:33603823-33603845 AAAAAGAAGGCCACTGTGGCTGG + Intronic
1080708132 11:34718769-34718791 TAAAAGAAGGCCAATGTGGCTGG + Intergenic
1080795708 11:35561149-35561171 CAAAATGAGGACAATGTTGGTGG - Intergenic
1081279377 11:41189397-41189419 CAAGAGAAGGGCAATGTGACTGG + Intronic
1081389064 11:42507574-42507596 CAAAATAAGGAAAATGAAGAGGG + Intergenic
1082790059 11:57340919-57340941 GAAAAGAAGGTCATTGTGGCTGG + Intronic
1083251243 11:61468820-61468842 TAAAATATGGACAATGTGGCTGG + Intronic
1083768504 11:64853690-64853712 CAAAAAAAGACCAAGGTGGCTGG + Exonic
1083825433 11:65200637-65200659 CAAAAAAAGAACAAGGCGGCCGG - Intronic
1083831310 11:65235613-65235635 GAAAATGAGGACAATGGGCCGGG + Intergenic
1085373450 11:76034586-76034608 TAACATAAGGTCAATGTGGGTGG + Intronic
1086061644 11:82706115-82706137 TAAAATAAGGAGAAACTGGCTGG - Intergenic
1086121670 11:83311347-83311369 CAAAATTATGATAATGTGCCAGG + Intergenic
1086260604 11:84935469-84935491 CAAAACAAGTTCAATGTGGCTGG - Intronic
1086505663 11:87501385-87501407 CAAAAAGAGGACAAGGTGGGAGG + Intergenic
1086898439 11:92339767-92339789 CAAAAAAAGGCCAGTGTCGCTGG + Intergenic
1086915242 11:92522584-92522606 CAAAGTTAGGACAATTTGCCTGG - Intronic
1087140724 11:94763191-94763213 AAAAAGGAGGACAATGTGGAGGG - Intronic
1088962300 11:114681132-114681154 CTAAAGAAAGACAATGTGGATGG - Intronic
1088997308 11:115012407-115012429 CAAAATAAGGTCAATGTTTTAGG + Intergenic
1089232278 11:116989422-116989444 GAAAATAAGCAAAATGTTGCTGG + Intronic
1089276697 11:117341418-117341440 CAAAAAAAGGCCAATGTGACTGG - Intronic
1090314776 11:125776581-125776603 CAAAATGCTGATAATGTGGCAGG - Exonic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090992205 11:131828097-131828119 ACAAATAAGGAAAATTTGGCAGG - Intronic
1091152933 11:133345611-133345633 CAAAAAAAGAACATTGTGGTAGG - Intronic
1091237275 11:134030804-134030826 AAAAATTAGGACAATGTCCCAGG + Intergenic
1091313693 11:134595800-134595822 AGAAATAAGGACAGAGTGGCAGG - Intergenic
1092494161 12:8975194-8975216 CAAAAAATAGAAAATGTGGCTGG - Intronic
1092744562 12:11661287-11661309 CAAAATGAGGACAAAATGGCTGG - Intronic
1092818442 12:12331353-12331375 CAAATTAAGGAAAAGGTGGGAGG + Intronic
1094192602 12:27712237-27712259 GGGAAGAAGGACAATGTGGCAGG + Intronic
1094482868 12:30898780-30898802 CAAAATTAGGATTATGGGGCGGG + Intergenic
1094559011 12:31532305-31532327 CAAAATAAGCCCAATGTGTCTGG + Intronic
1097259390 12:57707693-57707715 TAAAATAACGAACATGTGGCGGG - Intronic
1098286972 12:68917115-68917137 CAAAAGAAGTTCAGTGTGGCTGG - Intronic
1098731789 12:74044523-74044545 CTAAATAAGGACATTATAGCTGG - Intergenic
1099658192 12:85522165-85522187 TAAAAAAAGGCCAACGTGGCAGG - Intergenic
1099769870 12:87037513-87037535 CAAAATAAGGGCTATGTGGTAGG + Intergenic
1100021811 12:90077793-90077815 AAAAAAGAAGACAATGTGGCTGG - Intergenic
1101259176 12:103011928-103011950 CAAAAAAAGGTAGATGTGGCTGG + Intergenic
1101344501 12:103873690-103873712 AAAAAGAAGGCCAATGTGGCTGG + Intergenic
1101658170 12:106742575-106742597 CTAAATGATGACAATGTGGTTGG - Intronic
1102066101 12:109977095-109977117 CAAAATAAGGACATTCTAACAGG - Intronic
1102679018 12:114677791-114677813 GATAATAAGGAAACTGTGGCAGG + Intronic
1103077012 12:117991811-117991833 CAAAATAAGCAGAATGTTACTGG + Intergenic
1103865488 12:124048660-124048682 TAATATAAGGACAATGTGGCTGG - Intronic
1103981901 12:124742228-124742250 CCACATAAGGACACTGTGCCCGG - Intergenic
1104499064 12:129267112-129267134 TAAAAGAAGGCCAGTGTGGCTGG - Intronic
1105253104 13:18718753-18718775 TAAAATACACACAATGTGGCTGG - Intergenic
1106180960 13:27369024-27369046 CCAAATAATGACAATGGGGAAGG + Intergenic
1107569938 13:41646260-41646282 AAAAATCAGGAAAATTTGGCCGG - Intronic
1107602078 13:42023848-42023870 AACATAAAGGACAATGTGGCTGG + Intergenic
1107945479 13:45414320-45414342 CCAAATAAGGAAAAGGGGGCGGG + Intronic
1108596072 13:51950705-51950727 AAAAACAAGGATAATGTGACTGG + Intronic
1108842855 13:54642170-54642192 CAAAATAATGAGAAAGTAGCCGG + Intergenic
1109338293 13:61021380-61021402 CAAGATAAGGAATTTGTGGCAGG - Intergenic
1110425040 13:75357492-75357514 CAAATTGAGGCCAGTGTGGCTGG - Intronic
1112185157 13:97120894-97120916 CAATATAAGAACAAAGAGGCTGG - Intergenic
1112230078 13:97580968-97580990 CAAAACTAGGATAATGAGGCCGG - Intergenic
1112752175 13:102594673-102594695 CAAAAAAAGAAAAATCTGGCCGG + Intergenic
1113457868 13:110461829-110461851 TTAAATAATTACAATGTGGCCGG - Intronic
1114506219 14:23216581-23216603 AATAATAAGGCCAATCTGGCTGG + Intronic
1115089184 14:29553576-29553598 CAAGATAAGGCCATTCTGGCAGG + Intergenic
1115226682 14:31110297-31110319 TAAAAAAAAGAAAATGTGGCCGG - Intronic
1115346527 14:32348707-32348729 CAAAAGAAACACAATGGGGCTGG - Intronic
1115646661 14:35372808-35372830 CAAAACAAAAACAATGAGGCTGG + Intergenic
1117154949 14:52929560-52929582 CTAAAAAAGGCCAGTGTGGCTGG - Intronic
1118203960 14:63704227-63704249 AAAAAGAAGAACAATGTGGAAGG + Intronic
1119663306 14:76466292-76466314 AAACACAAGGAGAATGTGGCTGG - Intronic
1119997475 14:79269343-79269365 CAAAATAAGAAAAATAGGGCCGG - Intronic
1120121721 14:80688348-80688370 CAAAATGAAGACAATGCAGCAGG - Intronic
1120525368 14:85570879-85570901 AAAAATAAGGGGAATTTGGCCGG - Intronic
1121664547 14:95661929-95661951 GCAAATAAGAATAATGTGGCCGG - Intergenic
1124942000 15:34226838-34226860 AAAAGTAATGGCAATGTGGCCGG - Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1127493762 15:59490297-59490319 CAAAAGAAGAACAAAGTGGAGGG + Intronic
1128280838 15:66392956-66392978 ATAAATAAGTAAAATGTGGCAGG - Intronic
1128304590 15:66589656-66589678 CATACAAAGAACAATGTGGCTGG + Intronic
1128496477 15:68201245-68201267 CAAAGTCAGGACCAGGTGGCAGG + Intronic
1129638350 15:77347141-77347163 CAAAAGAAGGCCAGTGTAGCTGG + Intronic
1130225024 15:82050096-82050118 CAAAATCATGTCATTGTGGCTGG - Intergenic
1132112978 15:99115872-99115894 GAAAATAAAGACAGTGAGGCCGG - Intronic
1133006764 16:2886502-2886524 AAAAAAAAGGACAAAGGGGCAGG - Intronic
1134023737 16:10939477-10939499 CAAAAGGAGGCCCATGTGGCTGG - Intronic
1134509817 16:14836999-14837021 TAAAATAAGTAAAATGGGGCCGG - Intronic
1134557070 16:15174534-15174556 CAAAATGAGGCAGATGTGGCTGG - Intergenic
1134862684 16:17574772-17574794 CAAAATAAAGACACAGTTGCTGG - Intergenic
1134917652 16:18086252-18086274 CAAAATGAGGCAGATGTGGCTGG - Intergenic
1135621817 16:23962362-23962384 CAAAAGCAGCACAATGGGGCTGG - Intronic
1135624879 16:23985775-23985797 GAAAATAAGGATAATGAGGGTGG + Intronic
1136389649 16:29955043-29955065 CAAAATATGCAAAGTGTGGCTGG - Intronic
1136530582 16:30865873-30865895 AAAAATTAGGGCACTGTGGCGGG - Intronic
1136582556 16:31162060-31162082 AAAAATAAGGACAATGCGCCGGG + Intergenic
1138245459 16:55463761-55463783 CAGAAGAAGGCCACTGTGGCTGG - Intronic
1138621471 16:58214637-58214659 AAAAATAAGAATAATGGGGCTGG + Intergenic
1140151134 16:72367628-72367650 CAAAATAAACACAATTTGGGTGG - Intergenic
1140244442 16:73235377-73235399 TAAAATAAAGAAAAAGTGGCCGG - Intergenic
1142231815 16:88903608-88903630 CCAAAGAAGGTGAATGTGGCAGG + Intronic
1143313773 17:6015834-6015856 CAAAATAAGATCAATTAGGCCGG + Intronic
1143556260 17:7662918-7662940 CAAAATAATGACAATAAGGCCGG - Intronic
1143565846 17:7720052-7720074 CAAAAAAAGGACTCAGTGGCAGG - Intronic
1144588910 17:16507124-16507146 CATAATAATGTGAATGTGGCTGG + Intergenic
1146675384 17:34769787-34769809 CAAATGAAGGTCACTGTGGCTGG - Intergenic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148610069 17:48959148-48959170 AAAAATAAGTAAAATGAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149171907 17:53822357-53822379 CAAAATGAGTAGAATGTAGCAGG - Intergenic
1151497054 17:74464456-74464478 AAAAATAAAAAAAATGTGGCGGG - Intergenic
1151625940 17:75275821-75275843 AAAAATTAGGACATGGTGGCGGG + Intronic
1151730293 17:75907080-75907102 AAACAAAAGGACAAGGTGGCCGG - Intronic
1153664366 18:7354940-7354962 CAAAATAATGAATCTGTGGCAGG - Intergenic
1154093243 18:11384702-11384724 AAAAATAATGATAATATGGCTGG + Intergenic
1154974466 18:21443501-21443523 CAAACAAATGACAATATGGCTGG - Intronic
1155423135 18:25677234-25677256 AAAAAAAAGGTCAAAGTGGCAGG - Intergenic
1155433335 18:25785172-25785194 CAAAATAATGGCAATTAGGCTGG + Intergenic
1155681809 18:28496089-28496111 GAAAAAAAGGTCATTGTGGCTGG + Intergenic
1156090413 18:33461178-33461200 AAAAATTAGGACAGTGTGCCTGG + Intergenic
1157558077 18:48626295-48626317 AGAAATAAAGACAATGTGGCCGG - Intronic
1157623398 18:49028990-49029012 CAAAGAATGGAGAATGTGGCTGG - Intergenic
1158071053 18:53470839-53470861 CAAGAGAAGGACAAAGTGGGAGG - Intronic
1158826925 18:61232028-61232050 TAAGATAAGGCCAATGTAGCTGG - Intergenic
1158971799 18:62674964-62674986 AAAAAAAACAACAATGTGGCAGG - Intergenic
1159511977 18:69406421-69406443 CCAAATACAGACATTGTGGCTGG + Intronic
1159723242 18:71919675-71919697 CCAACTATGGCCAATGTGGCTGG - Intergenic
1161491773 19:4566330-4566352 CAAAATAAGTAAAATGGAGCAGG - Intergenic
1162722565 19:12671029-12671051 CAAAATAATAATAATCTGGCCGG + Exonic
1164073197 19:21788280-21788302 CACAATTAGGACAATTGGGCTGG + Intergenic
1165683452 19:37797311-37797333 CCAAATAAGAACAAAGAGGCTGG + Intronic
1166279116 19:41778765-41778787 TAAAACAAGGACAAAGCGGCCGG - Intergenic
1166513126 19:43424409-43424431 TTAAAAAAGGACAATGCGGCCGG + Intergenic
926828963 2:16939181-16939203 CAGAATAAGGTCACAGTGGCAGG + Intergenic
927885972 2:26718902-26718924 GAAAATATGAAAAATGTGGCTGG - Intronic
929217169 2:39427246-39427268 CAAAATAAAGACAATGAGGAGGG + Intronic
929424951 2:41834940-41834962 TGAAAGAAGGCCAATGTGGCTGG + Intergenic
930363383 2:50410024-50410046 GACAAAAAGGTCAATGTGGCAGG - Intronic
930511690 2:52353262-52353284 CAAAATGAGAAAAATGTGGTTGG + Intergenic
930973638 2:57427578-57427600 CAAAATAATGACAATCTGGCAGG + Intergenic
931451023 2:62367662-62367684 CAAAAACAAAACAATGTGGCCGG - Intergenic
932821767 2:74907405-74907427 AAAAATGAGGAAAAAGTGGCTGG + Intergenic
933144349 2:78833155-78833177 CAAAATAAGGCTAAAGGGGCAGG + Intergenic
933504452 2:83160208-83160230 TCAAATAAAGACAATGAGGCTGG + Intergenic
933883162 2:86692219-86692241 TATAAAAAGGATAATGTGGCTGG + Intronic
934487573 2:94730762-94730784 TAAAATACACACAATGTGGCTGG - Intergenic
934931183 2:98425456-98425478 CAAAATGAGTAAAATGGGGCAGG + Intergenic
935365474 2:102285130-102285152 CAAAAGCAGGCCAGTGTGGCTGG - Intergenic
937184844 2:120030542-120030564 TAAAATAAAGATAATTTGGCAGG - Intronic
938747297 2:134291639-134291661 CGAAGTAAGGTCAGTGTGGCTGG + Intronic
941636846 2:167944161-167944183 CAAGAAAAGGACAGTCTGGCTGG - Intergenic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
942207114 2:173630146-173630168 AAAAATAAGGAAAATATGGCTGG + Intergenic
942374913 2:175327018-175327040 CAAAATAATTACTATTTGGCTGG - Intergenic
942431847 2:175920446-175920468 AAAAAAAAAGACAATGAGGCTGG + Intergenic
942948069 2:181691188-181691210 CACCATAGAGACAATGTGGCTGG + Intergenic
944749240 2:202691116-202691138 CAAAATAATAATAATCTGGCTGG + Intronic
948998929 2:241600980-241601002 AAAAAAAAGGACAATCTGGCCGG + Intronic
1169223216 20:3839189-3839211 CAAAAGAAAGACTATGTAGCGGG - Intergenic
1169788696 20:9386878-9386900 AAAAAAAAGGACAATTTGGTTGG - Intronic
1169882269 20:10359807-10359829 CACAATAGCGACACTGTGGCTGG - Intergenic
1170295451 20:14819804-14819826 CATTGAAAGGACAATGTGGCTGG + Intronic
1170349359 20:15422066-15422088 CAAAAGGAGACCAATGTGGCTGG + Intronic
1170522688 20:17204500-17204522 CCAAATAATCCCAATGTGGCTGG + Intergenic
1170654389 20:18272654-18272676 GAAGATAAGGACAATGAGACAGG - Intergenic
1170701925 20:18711713-18711735 CTAAATAAGCACAATGAAGCAGG - Intronic
1172166969 20:32905464-32905486 AGAAATAAGGACATTGGGGCTGG + Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172726279 20:37044633-37044655 CAGAATAAGGCCACAGTGGCCGG - Intronic
1173017092 20:39235543-39235565 CCAAATACGGACAAGGAGGCGGG - Intergenic
1173200779 20:40953608-40953630 GAAAAAAAGGCCAATGTGGCTGG + Intergenic
1173522773 20:43711763-43711785 CAAGATAAGGACAGTGTCTCTGG + Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1176838609 21:13818638-13818660 TAAAATACACACAATGTGGCTGG - Intergenic
1176936481 21:14873808-14873830 CAAAACAAGGTCAATGGGTCAGG - Intergenic
1177597134 21:23259107-23259129 CAAAATCAGCAAAATGAGGCAGG + Intergenic
1179276175 21:39893681-39893703 TGAAATAAGGACAATGTTGAAGG + Intronic
1180102327 21:45594712-45594734 GAAAATAATGATAATGTGTCCGG - Intergenic
1180207138 21:46267898-46267920 TAAAAAAAAGACAATGGGGCTGG + Intronic
1180229616 21:46419048-46419070 GAAAAAAAGGACGGTGTGGCAGG - Intronic
1180241154 21:46507067-46507089 GAAAACAAGCACAATTTGGCTGG - Intronic
1180620011 22:17154919-17154941 AAAAATAAGGACATTCTGGCTGG - Intronic
1180675321 22:17582376-17582398 AAAAAAAAGGAGAATGTGGTAGG + Intronic
1180718196 22:17886506-17886528 AAAAATTAGAACAATTTGGCCGG + Intronic
1182227267 22:28808644-28808666 CTAAGGAAGGGCAATGTGGCAGG - Intergenic
1182852790 22:33490331-33490353 GAAAATAAGGACAAAATGACAGG - Intronic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1184770432 22:46594019-46594041 AAAAATAACGAAAATATGGCTGG - Intronic
1184863243 22:47188804-47188826 ACAAATAAGGACAATGAGGTTGG + Intergenic
1184954913 22:47879530-47879552 AAAAATAAGGCCAAGGGGGCAGG - Intergenic
949680681 3:6511044-6511066 AAAAATATGGATATTGTGGCTGG - Intergenic
950280940 3:11707450-11707472 CAAGATAAGGACAATACAGCTGG + Intronic
950297359 3:11843438-11843460 AAAAATAAAGTCAGTGTGGCCGG + Intronic
950991349 3:17441527-17441549 GAAAATAAGGCCAAGGTGGCTGG + Intronic
951707911 3:25562330-25562352 GAAATTAAAGACACTGTGGCTGG - Intronic
952444410 3:33366666-33366688 AAAAATAAAAACAATTTGGCTGG + Intronic
952995166 3:38872901-38872923 CAAACTAAGAAAAATGTTGCAGG - Intronic
953430302 3:42834252-42834274 TATAATAATGATAATGTGGCTGG - Intronic
954872616 3:53779146-53779168 CAAAACAAAAACAATGTGCCTGG + Intronic
955503822 3:59611370-59611392 TAAATTAAGGCCAGTGTGGCTGG + Intergenic
955821416 3:62899830-62899852 CAATACAAGGACAAAGTTGCTGG + Intergenic
956140742 3:66144252-66144274 CAAAACAATGTCACTGTGGCTGG + Intronic
956959291 3:74379400-74379422 AAAAATGAAGACAATGAGGCAGG - Intronic
959005749 3:101017924-101017946 CAAAATATGGGCAATGAGGTTGG + Intergenic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
959843920 3:111010790-111010812 CAAAAAAATGACAATATGGGAGG - Intergenic
959994477 3:112665163-112665185 CAAAATAAGAGCTATCTGGCAGG - Intergenic
960247156 3:115412476-115412498 CAAAGGAAGGACAATGGGGCTGG - Intergenic
961831602 3:129625839-129625861 CAAAAAAAGTCAAATGTGGCTGG + Intergenic
961958412 3:130828060-130828082 CAAAATAAGGAAGATGGTGCTGG + Intergenic
962623636 3:137203188-137203210 CAAAAGCAGGCCAGTGTGGCTGG - Intergenic
963075395 3:141342028-141342050 CAAAATAGTAACAATGGGGCCGG + Intronic
963154865 3:142085771-142085793 CAAAATGAGGCTAATGTGGGTGG - Intronic
963364845 3:144321798-144321820 TAAAATAAGGACATTATAGCAGG + Intergenic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
965413599 3:168364032-168364054 CAAAATAAGTAGAATTTGGAGGG + Intergenic
966894667 3:184434875-184434897 AAAAAGAAGGACATTCTGGCCGG - Intronic
967894484 3:194385048-194385070 CAAAATGAGGACAAATTGGTAGG - Intergenic
969739954 4:9017176-9017198 AAAAAAAATGACAAAGTGGCTGG + Intergenic
972345763 4:38191064-38191086 CAAGATCAGCACTATGTGGCTGG + Intergenic
973193752 4:47416253-47416275 CAAAATAAGGCCTGTGTGGCTGG + Intronic
974226708 4:59054902-59054924 CAACATAAGGACAATATGAATGG + Intergenic
974286274 4:59871655-59871677 CAAAAACAGGACATTCTGGCAGG - Intergenic
974522667 4:63004708-63004730 CATAAGAAGGAAAATATGGCAGG - Intergenic
974591901 4:63962016-63962038 CAGAACAAGAACAATATGGCAGG - Intergenic
976811835 4:89107331-89107353 CAAACTCAGGACAATGTGAATGG + Intronic
976930463 4:90560543-90560565 CATTATAAAGACAATGTGGTTGG + Intronic
976951950 4:90844445-90844467 AATAAGAAGGCCAATGTGGCTGG - Intronic
977595522 4:98875089-98875111 CAATAGAAGTACACTGTGGCTGG - Intronic
977717894 4:100204057-100204079 AAAAATAAGGACAGTTTGGCTGG + Intergenic
979278309 4:118836916-118836938 TAAAATCAGGACCATCTGGCTGG + Intronic
979609447 4:122673732-122673754 AAAAAGAAGGACACAGTGGCAGG + Intergenic
980345086 4:131604134-131604156 AAAAATAATAAAAATGTGGCAGG - Intergenic
980444331 4:132886294-132886316 CAACAGAAGGACAATATGGACGG + Intergenic
980722132 4:136712099-136712121 CCATATTAGTACAATGTGGCTGG - Intergenic
983054113 4:163081978-163082000 TAAGATAAGTACCATGTGGCCGG + Intergenic
983133546 4:164052224-164052246 AATAATAAAGATAATGTGGCTGG + Intronic
984559075 4:181247211-181247233 CAAAATATGCACGATGTGTCTGG + Intergenic
984591872 4:181626257-181626279 CAAGAAAAGGCCAGTGTGGCTGG + Intergenic
984624462 4:181990265-181990287 CAAAACAAGAAAAATGTTGCTGG + Intergenic
985283589 4:188311713-188311735 CAAAATAAAAACAATTGGGCCGG + Intergenic
985360942 4:189174801-189174823 CAAAATAAGGCAATTTTGGCCGG - Intergenic
986410700 5:7475796-7475818 CGAAATGAGGAGACTGTGGCGGG + Intronic
987372199 5:17203521-17203543 CCAAATAACCACAAGGTGGCAGG - Intronic
987469805 5:18312969-18312991 AAAAAAAAGGACAATGTTGGGGG + Intergenic
987815683 5:22898853-22898875 CAAACTAAAGAAAATGTTGCAGG - Intergenic
988215073 5:28261506-28261528 CAAAATATGCATAATGTTGCAGG + Intergenic
988297287 5:29382064-29382086 CAAAAGAAGGAGAATATGGATGG - Intergenic
988318120 5:29657989-29658011 TAAAATAATGATAATGTGGGAGG + Intergenic
989126534 5:38058519-38058541 CAAAAGAAGTACAATGGGGCAGG + Intergenic
991366129 5:65870075-65870097 CAAAAGAATAACAATCTGGCAGG + Intronic
991678026 5:69108024-69108046 AAAAATACAGGCAATGTGGCTGG - Intronic
994757350 5:103810841-103810863 TAAAATAAGACCAATGTGGCTGG - Intergenic
994812299 5:104536255-104536277 CAATAGAAGGAGAATGTGCCTGG - Intergenic
995338080 5:111025700-111025722 CAAAATAAGGCCAAGGGGACTGG + Intergenic
997725429 5:136116486-136116508 CAAAAGAAGGCCAGTGTGGAGGG + Intergenic
998269799 5:140696273-140696295 AAAAATAAGGAGATTGTGGCTGG + Intronic
999447045 5:151648395-151648417 AGAAATAAGGTCAATGTGTCTGG + Intergenic
999725786 5:154436351-154436373 AAAAAAAAGGACAATGTTGTGGG + Intergenic
1000278359 5:159760351-159760373 CCACATACGGACAAGGTGGCTGG - Intergenic
1000473258 5:161672651-161672673 CTGAATAAAGAAAATGTGGCAGG - Intronic
1000717982 5:164670256-164670278 AAAAAAAAGGATAATGTGGGAGG - Intergenic
1001126350 5:169023118-169023140 CAAAATGATGAAAATATGGCTGG - Intronic
1001742478 5:174065340-174065362 AGAAATAAGGACAGTGAGGCCGG + Intronic
1001920401 5:175595213-175595235 AAAAAGAAGGAAAATATGGCCGG - Intergenic
1003777259 6:9381814-9381836 CCAAATAACGTCAATCTGGCTGG + Intergenic
1004118728 6:12797719-12797741 GACAAAAAGGACAGTGTGGCTGG - Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004773723 6:18817998-18818020 CATAATAAGGAAAATGCTGCTGG + Intergenic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005398313 6:25406337-25406359 CAACAGAAGGCCAGTGTGGCTGG + Intronic
1006487657 6:34357071-34357093 AAAAATAACCACAATTTGGCCGG - Intronic
1007828327 6:44618453-44618475 CAAAAGATGGGCAATTTGGCAGG + Intergenic
1009296244 6:61952285-61952307 CACAATAAGGACAATTTATCTGG + Intronic
1009459930 6:63900353-63900375 GAAAATAAGTACAATGGGGGAGG + Intronic
1009888128 6:69649215-69649237 AACAATGAGGTCAATGTGGCTGG - Intergenic
1010014505 6:71088841-71088863 TAAAATAAGGAAATTGTGGCAGG - Intergenic
1013187896 6:107777410-107777432 AAAAATTCTGACAATGTGGCTGG - Intronic
1013331694 6:109108509-109108531 CAAAATAAGAAAAATGGGGCTGG - Intronic
1013525262 6:110968283-110968305 AAAAATAAGTAAAATGAGGCCGG + Intergenic
1013835646 6:114332273-114332295 GAAAATGGGGACAATGTGCCTGG - Intronic
1014167047 6:118237276-118237298 CAAAATAAAGAAAATGTAACTGG - Intronic
1014990868 6:128074760-128074782 TAACAGAAGGACAATGTGGTTGG + Intronic
1015069568 6:129075265-129075287 GGAAAGAAGGCCAATGTGGCTGG + Intronic
1016478676 6:144457424-144457446 CAACATAAAGATGATGTGGCTGG + Intronic
1019109276 6:169696988-169697010 CAAAATAAAGACAGTGTGGGCGG + Intronic
1019454795 7:1121271-1121293 GAAAATAAAAACAATGTGGTGGG + Intronic
1020033687 7:4951007-4951029 CAAAATAAGGAAATTTAGGCCGG - Intronic
1020384726 7:7587314-7587336 CAAAACAAGGATACTGGGGCAGG - Intronic
1020663018 7:11004737-11004759 CAAAAGACGTATAATGTGGCTGG + Intronic
1022380831 7:29858372-29858394 CAAAAGAAGGACAGTGTGTAAGG + Intronic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1027719553 7:81722459-81722481 AAAAATATGAACAATATGGCCGG - Intronic
1029231062 7:99068985-99069007 AAAAATAAGGACAATGTAAGCGG + Intronic
1030411514 7:109186497-109186519 CAAAATAAGTACAAAGTGGAAGG + Intergenic
1031796993 7:126187135-126187157 CAAAAAAATTACAATGTGGGTGG + Intergenic
1032394896 7:131582149-131582171 CAAAATCAGGACAAATGGGCTGG + Intergenic
1032412256 7:131704665-131704687 AAAAATAAAGAAAATTTGGCTGG - Intergenic
1033391746 7:140935526-140935548 AAAAATAAAGTCATTGTGGCTGG + Intergenic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1038465079 8:27754655-27754677 GAAAATAAAGAAAATGTAGCTGG - Intronic
1038835523 8:31116986-31117008 CAAAGTATGGACAAAGAGGCAGG + Intronic
1039066294 8:33611217-33611239 AAAAATAAAGTCAATGTGGACGG + Intergenic
1039415531 8:37390686-37390708 CAAAAAAAGTACATTATGGCGGG + Intergenic
1041012295 8:53557312-53557334 AAAAATGATGACAATTTGGCAGG + Intergenic
1043287110 8:78546555-78546577 CAAAATAAGGGCTGTGTGCCAGG + Intronic
1043334816 8:79162379-79162401 CAAAATAATTACAAGGTGGTTGG - Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044033149 8:87263421-87263443 CAAAATCAGGACATGCTGGCTGG + Intronic
1044199818 8:89421326-89421348 AAGAATAGGGATAATGTGGCCGG + Intergenic
1045982667 8:108209807-108209829 GAAATTAAGGACAGGGTGGCAGG + Intronic
1046533497 8:115477847-115477869 TTAAAAAAGGACAATGTGGATGG - Intronic
1046856545 8:119038882-119038904 CAAAAAAAGGCTAATGTGACTGG - Intronic
1047025211 8:120816178-120816200 CCAAAGGAGGTCAATGTGGCTGG + Intergenic
1048476054 8:134743191-134743213 TAAATTAAGGAAAATGTGCCAGG + Intergenic
1050252607 9:3761099-3761121 CATAATCATGAAAATGTGGCTGG + Intergenic
1051588711 9:18753802-18753824 TAAAATCAAGACAATGTGGTGGG + Intronic
1051654326 9:19364020-19364042 GAAAAAAAGGATAATGTGGCTGG + Intronic
1051729051 9:20120048-20120070 CAAATGAAGGAAAATGTGGGTGG - Intergenic
1051739335 9:20236213-20236235 CAAACTAAGGACAAAGTACCAGG - Intergenic
1052789006 9:32856670-32856692 TATAATAAGGAAAATCTGGCCGG - Intergenic
1053670230 9:40353650-40353672 TAAAATACACACAATGTGGCTGG + Intergenic
1053920019 9:42979910-42979932 TAAAATACACACAATGTGGCTGG + Intergenic
1054381351 9:64493638-64493660 TAAAATACACACAATGTGGCTGG + Intergenic
1054514383 9:66022647-66022669 TAAAATACACACAATGTGGCTGG - Intergenic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1058454153 9:105123665-105123687 TATAATCAGGACCATGTGGCTGG + Intergenic
1058466183 9:105230926-105230948 AAAAATATGAAAAATGTGGCTGG + Intergenic
1059953864 9:119495892-119495914 CAAAATAAGGCCAGTGAGGCTGG + Intronic
1060681923 9:125573693-125573715 CAAAAGAAGGTCAGTGTGACTGG - Intronic
1061154623 9:128850365-128850387 CAAAGTTAGGGCAAAGTGGCTGG - Intronic
1061483393 9:130908432-130908454 AAAGATAAGGACAAGGCGGCAGG - Intronic
1185725775 X:2420446-2420468 TAAAATAAAGAGAATGGGGCCGG + Intronic
1185789648 X:2919169-2919191 CAAAATAAAAATAAAGTGGCAGG + Intronic
1186308532 X:8291185-8291207 TAACATAATGACAATGTGCCTGG - Intergenic
1186772521 X:12831742-12831764 CATCAAAAGGATAATGTGGCTGG - Intergenic
1187207837 X:17199670-17199692 CAAAATGAGGACAATGATGATGG + Intergenic
1187377729 X:18771518-18771540 CAAAATAAGAAAAATGTCACAGG - Intronic
1187427464 X:19191325-19191347 GAAAGGAAGGGCAATGTGGCAGG + Intergenic
1188151126 X:26677137-26677159 GGAAAGAAAGACAATGTGGCTGG - Intergenic
1188323915 X:28775752-28775774 ATAAATAAGGCCAATGTGGTTGG - Intronic
1189006820 X:37004703-37004725 CAAACTAAGTTCAATGTGGTAGG - Intergenic
1189351437 X:40278716-40278738 CACAAGAAGGAAAATGGGGCTGG + Intergenic
1189790033 X:44595189-44595211 CAAAATTAAGACAATGTAGCCGG + Intergenic
1192295189 X:69840107-69840129 AAAAAAAAGGCCAGTGTGGCTGG - Intronic
1193139480 X:78011712-78011734 AAAAATAAGCAAAATTTGGCAGG + Intronic
1194672274 X:96748799-96748821 CAAAATAAAAACCTTGTGGCAGG - Intronic
1194713689 X:97265680-97265702 AAAAAGAAGGCCAATATGGCTGG + Intronic
1196683615 X:118493324-118493346 CAAAAAAAGGCCAGTGTGGCTGG - Intergenic
1198774645 X:140166603-140166625 CAAAAAAAGGACAATCTTGCAGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201284796 Y:12369714-12369736 CAAAATAAAAATAAAGTGGCAGG - Intergenic
1201318264 Y:12669237-12669259 CAAACAAAAAACAATGTGGCCGG - Intergenic