ID: 1022495643

View in Genome Browser
Species Human (GRCh38)
Location 7:30851336-30851358
Sequence CTGTTTACTCATCTGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022495637_1022495643 30 Left 1022495637 7:30851283-30851305 CCCAATGCTGTTGCTTATTGGCT 0: 1
1: 0
2: 3
3: 33
4: 208
Right 1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG No data
1022495638_1022495643 29 Left 1022495638 7:30851284-30851306 CCAATGCTGTTGCTTATTGGCTG 0: 1
1: 1
2: 1
3: 16
4: 200
Right 1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022495643 Original CRISPR CTGTTTACTCATCTGGAAAA TGG Intronic
No off target data available for this crispr