ID: 1022496322

View in Genome Browser
Species Human (GRCh38)
Location 7:30855210-30855232
Sequence TGGAAGATGGAGCAGTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022496320_1022496322 -9 Left 1022496320 7:30855196-30855218 CCTCATCTGGAAAATGGAAGATG 0: 1
1: 1
2: 16
3: 139
4: 953
Right 1022496322 7:30855210-30855232 TGGAAGATGGAGCAGTTATCAGG 0: 1
1: 0
2: 0
3: 17
4: 170
1022496317_1022496322 19 Left 1022496317 7:30855168-30855190 CCTTGGGAAAGTCACTGGGTCTC 0: 1
1: 0
2: 8
3: 137
4: 734
Right 1022496322 7:30855210-30855232 TGGAAGATGGAGCAGTTATCAGG 0: 1
1: 0
2: 0
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022496322 Original CRISPR TGGAAGATGGAGCAGTTATC AGG Intronic
904096027 1:27978082-27978104 TGGAAGATGGGGCACATCTCAGG + Intronic
905623864 1:39473934-39473956 ATGAAGATGGAGAAGGTATCAGG + Intronic
907009217 1:50947358-50947380 AGGAAGAAGGAGGAGTTTTCAGG - Intronic
910238070 1:85056307-85056329 TGGCAGGAGGAGCAGGTATCTGG + Intronic
911210847 1:95136835-95136857 TGGAAGATGGGGCAGTATTGTGG + Intronic
912090684 1:106071563-106071585 TGGAAGATAGAGGTGATATCAGG - Intergenic
913189708 1:116403133-116403155 TGGAAGGTGGTTCAGTTATTCGG + Intronic
913322408 1:117598217-117598239 AGGAACATGGAGAAGTCATCTGG - Intergenic
914886028 1:151585081-151585103 GGGAAGATGGGGCAGTTGTTCGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920606928 1:207397967-207397989 TGGGAAATGGAGCAGAAATCAGG + Intergenic
921502918 1:215928526-215928548 TGGAAGATTGACAAATTATCAGG + Intronic
922469531 1:225867348-225867370 TGGAAGGTTGAGAAGTTATCAGG - Intronic
923655434 1:235911934-235911956 TGGAAGATGTGGAAGTAATCGGG - Intergenic
1064153693 10:12886377-12886399 TGGCATAGGGAGCAATTATCAGG + Intergenic
1064716139 10:18178685-18178707 TGGAAGGTTGAGCAGATATTCGG + Intronic
1067362864 10:45597996-45598018 TGTAAGATGGACCAATCATCAGG - Intergenic
1069145008 10:64880720-64880742 TGGAAGCTGGAGGAGCTATTTGG + Intergenic
1069585486 10:69598196-69598218 TGGATGATGGAGGAGTCACCAGG - Intergenic
1073495882 10:103890593-103890615 TGGAAGTTGGAGAAGCTATGGGG - Intronic
1074279895 10:112041081-112041103 GGGAAAATGGAGCAGTTACAAGG + Intergenic
1077262620 11:1630819-1630841 TGAAAGAAGGAGCAGCTGTCAGG - Intergenic
1079417760 11:20255451-20255473 TGGAAGATGGGACAGCTATGTGG + Intergenic
1084010098 11:66343108-66343130 TGGCAAATGGAGCAGTTAGGTGG - Intronic
1086646058 11:89222048-89222070 AGGAACATGGAACAGTTACCAGG + Intronic
1086744993 11:90413908-90413930 TAGAAGATGAGGGAGTTATCTGG + Intergenic
1087156004 11:94904483-94904505 TAGAAGCTGCAGAAGTTATCCGG - Intergenic
1094427733 12:30332899-30332921 TGTTAGGTGGAGCAGTTATAGGG - Intergenic
1095127976 12:38504393-38504415 TGGAAAATGGAACAGTTCTAAGG + Intergenic
1096488029 12:51996690-51996712 GGGAAGATGGAGCAGGTCTTTGG + Intronic
1097964938 12:65568884-65568906 TGAAAAATGAAGCAATTATCTGG - Intergenic
1100424651 12:94472973-94472995 GGGAAGAGGAAGCAGTTAGCAGG + Intergenic
1100486021 12:95028281-95028303 TGTAAAATGGTGCAGTTACCTGG - Intronic
1101559603 12:105843994-105844016 TGGAAGATGGAACAGGAATCAGG + Intergenic
1102633004 12:114298681-114298703 CAGAAGATGGAGGGGTTATCTGG - Intergenic
1102711518 12:114932193-114932215 TGAAAGATGGACCTGTTTTCAGG + Intergenic
1103243542 12:119435407-119435429 TGGAAAAGGCAGAAGTTATCAGG - Intronic
1105407024 13:20141828-20141850 TGGACGATGGAGGAGAGATCAGG - Exonic
1105520975 13:21130723-21130745 TGGAAAATGGACCAATTAGCAGG + Intergenic
1107698547 13:43023912-43023934 TGGAAGACGGAGCAGTTCTGAGG + Intronic
1107863207 13:44680908-44680930 TAGCAGAGGGAGCAGTCATCTGG - Intergenic
1109035021 13:57246238-57246260 AGGAACATGGAGAAGTTATGGGG + Intergenic
1111990240 13:95109087-95109109 TAGAGCATGGAGCAGTTAACTGG - Intronic
1112228919 13:97568477-97568499 TGGAAAATGAGGCAGGTATCTGG - Intergenic
1113815032 13:113163647-113163669 AGGCAGATGGAGCAGAAATCTGG - Intronic
1115093919 14:29611806-29611828 TGAAAAATGGAGCAAATATCTGG + Intronic
1115268025 14:31521672-31521694 AGGGAGAAGGAGCAGTTCTCAGG + Intronic
1118514540 14:66510464-66510486 TGAAAGATGCAGCCCTTATCTGG + Intronic
1118915615 14:70100770-70100792 TGGAAGATGAAGCAGTGTTCTGG + Intronic
1119002814 14:70898485-70898507 AGGAAGAAGGAGCAGTGACCTGG + Intergenic
1127093206 15:55486834-55486856 TTGATGATGGAGCAGTTTTCTGG - Intronic
1127316847 15:57804219-57804241 TGGAAATTTGAGAAGTTATCTGG - Intergenic
1129854308 15:78812545-78812567 TCCAAGATGGAGCAGTTCTGAGG - Intronic
1130668352 15:85888610-85888632 TGCAAGGTGGAACAGTTATAAGG + Intergenic
1133199242 16:4192430-4192452 TTGAAGATGTAGAATTTATCGGG + Exonic
1134453628 16:14378669-14378691 TTGAAGATGGACCAGATACCAGG + Intergenic
1134533498 16:15004639-15004661 TAGAAGATAGAGCAATGATCTGG + Intronic
1135140405 16:19916380-19916402 TGGGAGTTCCAGCAGTTATCAGG - Intergenic
1137552208 16:49445367-49445389 TGGAAGAAGGAGAAGGTGTCAGG - Intergenic
1137672015 16:50284542-50284564 TGGGAGATGGAGCAGTTGTGGGG + Intronic
1140190652 16:72812966-72812988 TGGAAGGAGGAGCAGATAGCAGG - Intronic
1140631757 16:76861848-76861870 TGTAAGATGGACCAGTCAGCAGG + Intergenic
1143595656 17:7912125-7912147 TGGAGGGTGGAGCAGTTATGAGG + Exonic
1144916847 17:18730673-18730695 TGGAAAATGGAGGAGCTCTCAGG - Intronic
1146422650 17:32702897-32702919 TGGAACATGGAGCAGGTAAGGGG + Intronic
1146437239 17:32861617-32861639 GTGAAGATGGAGCACTCATCAGG - Intronic
1146658808 17:34651208-34651230 TGGAAGATGGAACAGTGGTTAGG - Intergenic
1150302521 17:64058143-64058165 TGAAAGAGGCAACAGTTATCTGG - Intronic
1151118584 17:71766787-71766809 TGGGAAATGGGGCAGTTACCTGG + Intergenic
1151362350 17:73596271-73596293 TGGCATATGGGGCAGTGATCAGG + Intronic
1153698320 18:7666410-7666432 CTGAAGAGGGAGCAGGTATCAGG + Intronic
1157297358 18:46456059-46456081 TGGAAGATGGAGAAGATGTGAGG + Exonic
1157427578 18:47597135-47597157 AGGAAGATGGATCAATTATCAGG - Intergenic
1157539005 18:48485884-48485906 TGGGAGATGGAGCTGTTGACTGG - Intergenic
1157991418 18:52501256-52501278 TTAAAGATGGAGCAGGTATCTGG + Intronic
1158639117 18:59188281-59188303 TAGAAGATGAAGCACTCATCAGG + Intergenic
1159800514 18:72893831-72893853 TGGAAGAGGGACCAGGTGTCTGG + Intergenic
1161906150 19:7158131-7158153 AGGAAGAGGTAGCAGGTATCAGG - Intronic
1163411773 19:17159340-17159362 AGGGAGATGGAGGACTTATCAGG - Intronic
928442703 2:31305227-31305249 TGGAAAATGAAGCAGTCATGGGG + Intergenic
929636118 2:43522471-43522493 TGGAAGATGTACCAGATAGCTGG + Intronic
929714065 2:44292973-44292995 AGGAGGATGGTGCAGTAATCGGG + Intronic
930980336 2:57517925-57517947 TGGAAGATGGCCCATTTACCAGG - Intergenic
931970556 2:67581488-67581510 TGGAAGATGGAGGAGTTGGAAGG + Intergenic
932314779 2:70772715-70772737 TGGAGGATGTAGTAGTTTTCTGG - Intergenic
933117295 2:78490150-78490172 TGGCTGAGGGAGCTGTTATCTGG - Intergenic
935210734 2:100937915-100937937 TGGAAGGTGGTGCAGGTGTCAGG + Intronic
940167035 2:150785296-150785318 TGGAACAGGGAGCATCTATCTGG - Intergenic
943365404 2:186963091-186963113 TGTAAGATGGACCAATTAGCAGG + Intergenic
944917729 2:204378156-204378178 TGGAAGAAGGAGCAGCCATATGG + Intergenic
946809986 2:223513361-223513383 TGGAAGATGGAGCATAGTTCTGG + Intergenic
1169028730 20:2391685-2391707 TGGAAGATTGATTAGATATCTGG - Intronic
1170749593 20:19133705-19133727 TGGATGCTGGAGCTCTTATCTGG + Intergenic
1173691784 20:44966523-44966545 GGGAGGATGGAGCAGTGAGCGGG + Exonic
1178618938 21:34157805-34157827 AGGAAGATGAATCAGTTCTCAGG + Intergenic
1178684525 21:34700801-34700823 TGGAAAAGGAAGCAGTTCTCTGG + Intronic
1180619611 22:17152324-17152346 GAGAAGATGGAGCATTTACCTGG + Intronic
949736386 3:7176817-7176839 TAGAAGATGGATGAGTTTTCTGG - Intronic
950092526 3:10306065-10306087 TGGAAGAGGGAGCTGTGATTAGG - Intronic
951112557 3:18821896-18821918 TGGAAGGTGAAGGAGCTATCAGG + Intergenic
953039961 3:39247318-39247340 TGCAACATGGAGCATATATCAGG - Intergenic
953749912 3:45601194-45601216 TGGAAGATGGAGAAGGAATCAGG + Intronic
956128699 3:66035492-66035514 TGGAAGAGGGAGCAGAAAACTGG + Intronic
964786695 3:160403212-160403234 TTGAAAATGTAGCAGTTAGCCGG + Intronic
967016641 3:185488434-185488456 TGGAACCTGGAGCATTTCTCAGG + Exonic
967188526 3:186965677-186965699 TGGAGGATGGAGCACTGCTCAGG + Intronic
968062532 3:195736927-195736949 TGGAAGATGGGGCCGTGACCTGG - Intronic
975769223 4:77703373-77703395 TGGAGGGTGGAGCAGTTTTTTGG - Intergenic
976605046 4:86974926-86974948 TGGAAGAGGCAACAGTTAGCTGG - Intronic
978068254 4:104433238-104433260 TTGAAGACTGAACAGTTATCTGG - Intergenic
978624801 4:110672761-110672783 TGGATGATGTATTAGTTATCTGG + Intergenic
979602626 4:122603293-122603315 TGGAACATAGGGCAGTTGTCAGG - Intergenic
980484352 4:133436008-133436030 TGGAAGATACAGTAGTTAGCAGG + Intergenic
984847468 4:184120188-184120210 GGGAAGAAGGAGCAGGAATCAGG - Intronic
986144439 5:5064220-5064242 TGGATGAGGCAGCAGCTATCTGG - Intergenic
986573424 5:9188835-9188857 TGGAGGATTGATGAGTTATCTGG - Intronic
994647641 5:102490978-102491000 TGTAAAATGGAGCAGTCAGCAGG - Intronic
995116231 5:108482608-108482630 TGGGAGAGGGGGCAGTGATCAGG - Intergenic
997178921 5:131807895-131807917 TGGAAGATGGCCTAGATATCAGG - Intronic
997348927 5:133216278-133216300 AGGAAGATGGAGCAGGGATCTGG - Intronic
997957747 5:138293323-138293345 TGGAAGATGGAGAAATAATTAGG + Intronic
998189521 5:140011301-140011323 AGGAAGATTAAGGAGTTATCAGG - Intronic
1001416450 5:171547775-171547797 TGGAAGATGAAATAGTTTTCTGG - Intergenic
1001501235 5:172236646-172236668 TGGAAGATGGCACAGTAAGCAGG + Intronic
1003103664 6:3196660-3196682 TGAAACATGAAGCAGTTTTCCGG + Intergenic
1005569097 6:27127289-27127311 TGGAACAGGGAGGAGTTCTCCGG - Intronic
1006658573 6:35619154-35619176 TTGAAGATGGAGGCATTATCCGG - Exonic
1006986123 6:38176851-38176873 TGGAAGAAGGAACACTTATAAGG - Intronic
1007612863 6:43161461-43161483 TGGCAGATGAAGGAGTTTTCAGG + Intronic
1010874692 6:81087870-81087892 TGGCAGATGGGGCAGTTGTATGG - Intergenic
1011431663 6:87293880-87293902 TGGAAGACGGAGAAATTACCAGG + Intronic
1012077629 6:94712275-94712297 GGGAAGATGAAGCAGTAAACAGG - Intergenic
1012879434 6:104767871-104767893 AGTAAGATGGGGCAGGTATCAGG - Intronic
1015455255 6:133419806-133419828 TGCAAGATGAAGCAGTCATGGGG - Intronic
1015535260 6:134261072-134261094 TGCAAGATGAATCAGTTATCTGG + Intronic
1017079152 6:150650641-150650663 TGGAACATGGATGAGCTATCAGG - Intronic
1018839106 6:167506247-167506269 CGGGAGATGGAGCAGCAATCGGG - Intergenic
1019585059 7:1796166-1796188 TGGAAGGTGGAGATGTTTTCTGG - Intergenic
1019984885 7:4648357-4648379 TGGATGTTGGAGCAGTTTTGAGG - Intergenic
1020743511 7:12052310-12052332 TGGTAGAAGAAGCAGTTCTCTGG + Intergenic
1022496322 7:30855210-30855232 TGGAAGATGGAGCAGTTATCAGG + Intronic
1023223163 7:37941793-37941815 TTGAATATGGAGCAGATATCAGG + Intronic
1025714216 7:63940015-63940037 TTGTAGATGGTGCAGTTATTTGG - Intergenic
1028350835 7:89845637-89845659 TGGAGGTAGGAGCAGTTTTCTGG - Intergenic
1030320114 7:108157692-108157714 TGGAGTAGGCAGCAGTTATCTGG + Intronic
1031058061 7:117015700-117015722 TGGGAGGTGAAGCAGTGATCAGG + Intronic
1032233737 7:130101461-130101483 AGGAAGATGGAGCAGTTTTGGGG + Intronic
1034231499 7:149532204-149532226 CAGAAGATGCAGCAGTTATAAGG - Intergenic
1034987098 7:155523077-155523099 TGGAATAAGGAGCAATTAACAGG + Intronic
1035739906 8:1919160-1919182 TGGGTGATGGAGCTGTTCTCTGG + Intronic
1035739959 8:1919579-1919601 TGGATGATGGAGCTGTTCTGTGG + Intronic
1035739989 8:1919914-1919936 TGGATGATGGAGCTGTTCTATGG + Intronic
1035740000 8:1920013-1920035 TGGATGATGGAGCTGTTCTATGG + Intronic
1035793191 8:2326321-2326343 GGGAAGATGGAGCATTTCTGTGG + Intergenic
1035799613 8:2395384-2395406 GGGAAGATGGAGCATTTCTGTGG - Intergenic
1037697540 8:21238534-21238556 AGGAAGCTAGAGGAGTTATCAGG + Intergenic
1037788243 8:21915591-21915613 TGGAAGCTGGAGGAGTTCTCCGG + Intergenic
1038681139 8:29669699-29669721 TGGAAGAGGGACCAGGTCTCTGG - Intergenic
1041617946 8:59930205-59930227 TGGACACAGGAGCAGTTATCTGG + Intergenic
1042746025 8:72106926-72106948 TGAAAGCTGGAGCACTTAGCAGG + Intronic
1043163613 8:76875528-76875550 TGAATGATGGAGAAGTTATCTGG - Intergenic
1044190747 8:89314318-89314340 AGGAATATGGGGCAGTTCTCTGG - Intergenic
1048195779 8:132330777-132330799 AGGAAGATGCAGCAGCTGTCAGG + Intronic
1049029796 8:140025946-140025968 GGGAAGATGGAGTAGTTCTGGGG - Intronic
1049632859 8:143668264-143668286 TGGATGATGGAGAGGTTCTCTGG - Intergenic
1050405832 9:5307801-5307823 TGGAAGATGGTGCAGGTAGAAGG - Intergenic
1053191767 9:36077143-36077165 AGGGAGAGGGAGCAGTTATATGG + Intronic
1055664179 9:78536740-78536762 TAGAGGATGGAGCTGTTATCGGG + Intergenic
1055732068 9:79288496-79288518 TGGAAGAAGAAGCATCTATCAGG - Intergenic
1056451101 9:86717520-86717542 TGGAAGAGGGTGCAATTAACTGG - Intergenic
1056925189 9:90828485-90828507 TGGTAGATGGTGCAGTTCACTGG + Intronic
1058565830 9:106284153-106284175 TGGGAGAGGCAGCAGATATCTGG - Intergenic
1058843385 9:108932935-108932957 AAGAAAATGAAGCAGTTATCAGG - Intronic
1058991525 9:110258243-110258265 TGGAGGATGGTACAGTTATAAGG + Intergenic
1059362790 9:113758761-113758783 TAGAAGATGGACCAATGATCTGG + Intergenic
1059417053 9:114168719-114168741 ATGAAGATGGAGCTGTTTTCTGG - Exonic
1060021788 9:120137818-120137840 TGGAAGATGGTGCTGTGAGCAGG + Intergenic
1060827773 9:126696290-126696312 TGGAAGATGGAGTCGTTCCCTGG - Exonic
1062091006 9:134678859-134678881 GGGAAGAGGGAGCAGGGATCAGG + Intronic
1062532675 9:137008780-137008802 AGCAAGATGGAGCAGGTGTCTGG - Exonic
1187111655 X:16307868-16307890 TTGAAGATGGAGGGGTTATGTGG + Intergenic
1187387025 X:18858268-18858290 TGGGAGAGGTAGCAGTTCTCGGG - Intergenic
1190396234 X:49988010-49988032 TGGAGGATGGAGGAGTTTTTCGG - Intronic
1193238675 X:79140252-79140274 TGGACGCTGGAGCTTTTATCTGG + Intergenic
1195021647 X:100834196-100834218 AGGAAGGTGGAGCAGTTAGAGGG - Intronic
1196155027 X:112419196-112419218 TGGGAAATGGGGCAGTTACCTGG + Intergenic
1198315830 X:135465068-135465090 GTGAGGATGAAGCAGTTATCAGG + Intergenic
1199628341 X:149760103-149760125 TGACAGATGGAGCAGATTTCAGG + Intergenic