ID: 1022496596

View in Genome Browser
Species Human (GRCh38)
Location 7:30856800-30856822
Sequence CAGCATGCAGAGCTGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022496590_1022496596 8 Left 1022496590 7:30856769-30856791 CCGAGACCAAGAGCTTCGTGACT 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG No data
1022496591_1022496596 2 Left 1022496591 7:30856775-30856797 CCAAGAGCTTCGTGACTTCCCTA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022496596 Original CRISPR CAGCATGCAGAGCTGGTACA AGG Intronic
No off target data available for this crispr