ID: 1022497555

View in Genome Browser
Species Human (GRCh38)
Location 7:30862510-30862532
Sequence CAGGCTCTGCTGAAGGTTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 273}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022497542_1022497555 20 Left 1022497542 7:30862467-30862489 CCCTGCATCCCGGCACCTCCAGC 0: 1
1: 2
2: 27
3: 531
4: 1198
Right 1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 273
1022497543_1022497555 19 Left 1022497543 7:30862468-30862490 CCTGCATCCCGGCACCTCCAGCC 0: 1
1: 1
2: 12
3: 345
4: 1202
Right 1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 273
1022497545_1022497555 12 Left 1022497545 7:30862475-30862497 CCCGGCACCTCCAGCCTTGGCTC 0: 1
1: 1
2: 5
3: 67
4: 455
Right 1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 273
1022497547_1022497555 5 Left 1022497547 7:30862482-30862504 CCTCCAGCCTTGGCTCTCTGAGG 0: 1
1: 0
2: 8
3: 60
4: 656
Right 1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 273
1022497550_1022497555 2 Left 1022497550 7:30862485-30862507 CCAGCCTTGGCTCTCTGAGGGAT 0: 1
1: 0
2: 2
3: 23
4: 204
Right 1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 273
1022497551_1022497555 -2 Left 1022497551 7:30862489-30862511 CCTTGGCTCTCTGAGGGATACCA 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 273
1022497546_1022497555 11 Left 1022497546 7:30862476-30862498 CCGGCACCTCCAGCCTTGGCTCT 0: 1
1: 0
2: 3
3: 70
4: 631
Right 1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG 0: 1
1: 0
2: 2
3: 31
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022497555 Original CRISPR CAGGCTCTGCTGAAGGTTTG CGG Intronic
900367477 1:2317105-2317127 GAGGCCCTGCTGAAGGGGTGAGG + Intergenic
900732464 1:4271344-4271366 CAGGTGCTGCTGAACATTTGGGG - Intergenic
901346802 1:8551820-8551842 CTGGCTCTGCTGTAGCCTTGTGG - Intronic
901470314 1:9451486-9451508 CAGCCTTTGCTGAAGGTCTGAGG + Intergenic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
902272006 1:15311283-15311305 CTGACTCTGCTGAAGACTTGAGG - Intronic
903047060 1:20572618-20572640 CAGGCTATGACGAAGGTTTGAGG + Intergenic
903269086 1:22176692-22176714 CAGACTCTACTGAAGGTTTGGGG - Intergenic
903286253 1:22278633-22278655 CAGGCTCTGCTCCAGGTGTTCGG + Intergenic
904599872 1:31667434-31667456 CAGCCTGTGCTGCAGGCTTGGGG + Intronic
906214852 1:44032651-44032673 TTGGCTCTGAGGAAGGTTTGTGG - Intergenic
906676846 1:47699430-47699452 CAGGCAGCGCTGAAGGTTTCAGG - Intergenic
906742809 1:48198928-48198950 CAGGTTCTGCTGATTATTTGAGG + Intergenic
906838231 1:49107573-49107595 CAGACTTTCCTGAAGATTTGGGG - Intronic
907814068 1:57900904-57900926 CAGGCTCTGTGCTAGGTTTGAGG - Intronic
908193931 1:61730093-61730115 CATGCTCAACTGAAGGTTTAAGG - Intergenic
908391569 1:63688131-63688153 CAGGGTCTGGGGAAGGGTTGAGG + Intergenic
908397704 1:63741269-63741291 CAGCCACTGCTGGAGGATTGAGG + Intergenic
910035857 1:82787435-82787457 AAGGCTGTTCTGAAGGTTTAGGG - Intergenic
912605790 1:110987220-110987242 CAGGATCTGCTGTAGGCCTGGGG - Intergenic
913035049 1:114956502-114956524 CAGGATCTGCTGTGGGTTGGAGG - Intronic
916808096 1:168279884-168279906 CAGGCTCTACTCAAGGTTGGGGG + Intergenic
917631903 1:176898616-176898638 CAGCCTCTCCTGAAGCTTTTAGG - Intronic
919497430 1:198291274-198291296 CAGGCTCTGCTCCTGGTTTCAGG - Intronic
919826642 1:201507695-201507717 CGGGTGCTGCTGAAGGTCTGCGG - Intronic
920455855 1:206100574-206100596 CAGGCTCTGGTGAAGCTTTGGGG - Intronic
920546498 1:206822787-206822809 CAGGCCCTGCACTAGGTTTGGGG - Intronic
921955988 1:220983751-220983773 CAGGCTCGGCTGAGGGATGGGGG - Intergenic
922930469 1:229385271-229385293 CAGGCAATGCTGCAGGTTTAGGG + Intergenic
923084805 1:230695114-230695136 CAGGCTCTCCTGCTGGCTTGGGG - Intergenic
923384725 1:233454809-233454831 CAGGCTCATCTGCACGTTTGGGG - Intergenic
924185222 1:241481684-241481706 CAGGCTCTGCTGAAAAGTTGTGG + Intergenic
1063285779 10:4686215-4686237 TAGGCTCTGCGGAATGTGTGGGG - Intergenic
1065721190 10:28630015-28630037 CAGGCCCTACTGTAGGTGTGGGG - Intergenic
1065968809 10:30789833-30789855 CAGGCACTGTTGTAGGTTTCAGG + Intergenic
1066311326 10:34199577-34199599 CAGGCTTTGCTGAAGGTAACCGG - Intronic
1067466038 10:46499720-46499742 CAGACTATCCTGAAGGTTTAGGG + Intergenic
1067621150 10:47884886-47884908 CAGACTATCCTGAAGGTTTAGGG - Intergenic
1069062503 10:63908866-63908888 CAGCTTTTACTGAAGGTTTGGGG + Intergenic
1070113305 10:73505407-73505429 CAGGCTCTGCAGATGGCATGGGG - Exonic
1070298828 10:75188080-75188102 CAAGGGCTGCTGGAGGTTTGTGG - Intergenic
1070803823 10:79258865-79258887 CATGGTCTGCTGAAACTTTGGGG + Intronic
1072786255 10:98284995-98285017 CTGGCTCTGATGAGGGTTCGGGG + Intergenic
1073289403 10:102405889-102405911 CAGGCTTTGCTCACGGTTTGTGG + Intronic
1073448793 10:103597200-103597222 CAGGCCCTGCTGCAGGCTTGTGG + Exonic
1074142737 10:110689271-110689293 CAGGCTCTGCTGGAGGCCTGGGG + Intronic
1074975937 10:118581714-118581736 CAGGCTCTACAGAGGATTTGAGG + Intergenic
1076230765 10:128818194-128818216 CTGGCTCTGGTGAAGGTCAGTGG - Intergenic
1077364767 11:2157126-2157148 CAGTCTCTGCTTAAGGAATGTGG + Intronic
1078116685 11:8459819-8459841 CATGCTCTCCTGAAGAATTGAGG - Intronic
1080645643 11:34185840-34185862 AAAGCACTGATGAAGGTTTGAGG + Intronic
1081462462 11:43284620-43284642 AACACTCTGCTGAAGGTTTTAGG - Intergenic
1082889058 11:58119009-58119031 CAGGCTCTGCTGGAGCCTGGTGG - Exonic
1083158191 11:60838447-60838469 CAGGCTCTTCTGAAAATTTCAGG + Intergenic
1083471197 11:62885200-62885222 CAGGATCTGCTGAAGGTCGGAGG - Exonic
1084084513 11:66848848-66848870 CAGCTTCTGTTGAAGGCTTGGGG + Exonic
1084172280 11:67406419-67406441 CAGGGTCTGCTGAGGGGTTTAGG - Intronic
1087611479 11:100439281-100439303 CAGCCTCTTCTGAAGATCTGAGG + Intergenic
1089316479 11:117594635-117594657 CAGGGGCTGCTGCAGGTCTGCGG - Intronic
1090096866 11:123750979-123751001 AAGACTTTACTGAAGGTTTGAGG + Intergenic
1090270226 11:125380816-125380838 CAGTCTCGGCTGCAGGCTTGGGG - Intronic
1092076127 12:5675052-5675074 CAGGAACTGTTGTAGGTTTGGGG - Intronic
1093280908 12:17195263-17195285 CAGGGTCCCCTGAGGGTTTGGGG + Intergenic
1095398403 12:41787397-41787419 CATGGTATGCTGAAGTTTTGAGG + Intergenic
1096876649 12:54634870-54634892 CAGAATCTGCAGAAGGTCTGGGG + Exonic
1097835094 12:64265023-64265045 CAGGCTCTAGTGAGGGCTTGGGG - Intronic
1098400994 12:70075384-70075406 CAGGAGCTGCTGAAAATTTGGGG - Intergenic
1101963476 12:109266422-109266444 CAGGGTCTGCTGAGGGTGTACGG - Exonic
1103764714 12:123271846-123271868 CCGGCTCCGCGGAAAGTTTGCGG - Exonic
1105694458 13:22874155-22874177 GAGCCTCTGCTGTAGGTTAGGGG - Intergenic
1106539532 13:30677484-30677506 CAGGCCCTGCTGCAGTGTTGGGG - Intergenic
1106868437 13:33992953-33992975 CAGGCTTTGCTTCAGGTTTTGGG + Intergenic
1107318336 13:39158856-39158878 CAGACTCTGGTTAAGGTTAGGGG - Intergenic
1108061085 13:46534235-46534257 CAGGGTCTGCTGACTGTTTAAGG - Intergenic
1108455470 13:50609395-50609417 CAGACTTTACTGAGGGTTTGGGG + Intronic
1110025657 13:70535594-70535616 CAGGCTCTGTGGAAGGATAGGGG + Intergenic
1110507110 13:76299587-76299609 CAGGCTCTCCTTAAGGTGTGAGG + Intergenic
1113552519 13:111204202-111204224 CAGGGTCTGCTAGAGGTGTGGGG + Intronic
1113828390 13:113274670-113274692 CAGGGTCTGCCGAAGGCCTGGGG + Intergenic
1113881075 13:113626634-113626656 CTTGCTCTGCAGAAGTTTTGTGG + Intronic
1114002932 14:18280785-18280807 CAGGCTCTTTTGAATGTTAGAGG + Intergenic
1114549478 14:23524748-23524770 CAGGCCCTGCTGGAGGTTCAAGG + Exonic
1115758489 14:36553898-36553920 CAGGCTATGCTGAATCTGTGAGG + Intergenic
1115786327 14:36829764-36829786 CAGCCTCTGCTGAAGGGGTTGGG - Intronic
1120855007 14:89204658-89204680 CAGGCTCTGCTTTAGGTGTGAGG - Intronic
1121629711 14:95413395-95413417 GAGGCTTTGCAGAAGCTTTGAGG - Intronic
1123118261 14:105904547-105904569 CAGGCTGGGCGGTAGGTTTGGGG - Intergenic
1123388036 15:19839067-19839089 GAGGCTCTTCTGAATGTTAGAGG + Intergenic
1123586034 15:21761463-21761485 CAGGAACTGTTGTAGGTTTGGGG + Intergenic
1123622676 15:22204053-22204075 CAGGAACTGTTGTAGGTTTGGGG + Intergenic
1123699698 15:22905043-22905065 TTGGCTCTGGTGAAGGTCTGAGG + Intronic
1126962398 15:54011805-54011827 CAGGCTCTGCAGGGGATTTGGGG - Intergenic
1127613431 15:60659024-60659046 AATGCTCTGCAGCAGGTTTGCGG - Intronic
1128313924 15:66648139-66648161 CTGGCTGTTCTGAAGGTTAGAGG + Intronic
1128347790 15:66865386-66865408 CAGGCTCTAGTGTTGGTTTGGGG + Intergenic
1128521201 15:68375993-68376015 CAGCCTCTGTTGATGGTCTGGGG - Intronic
1128705475 15:69834862-69834884 CAAGGTCTCCTGAAGGTTTGGGG - Intergenic
1129002487 15:72346221-72346243 CAGGCTCTGGTAAGGGTTTTCGG - Exonic
1131544603 15:93305510-93305532 CAGGTTTTGCTGAGGGTTTGTGG - Intergenic
1131605784 15:93901111-93901133 CAGGCACTGCTGAACCTGTGGGG + Intergenic
1131697198 15:94890638-94890660 CAAGCCTTGCTGAAGGTTTGAGG + Intergenic
1132625535 16:889810-889832 GAGGCACTGGTGAAGGTTTCAGG - Intronic
1132951245 16:2563579-2563601 CGGGCTTTGCTGTTGGTTTGTGG + Intronic
1132963105 16:2636591-2636613 CGGGCTTTGCTGTTGGTTTGTGG - Intergenic
1136479076 16:30530467-30530489 CAGGCTGTGTTGAGGGTTAGGGG + Intronic
1136482626 16:30552072-30552094 GAGGCTGTGCTGAGGGTTAGGGG + Intronic
1139108390 16:63856916-63856938 CAGGCTGTGCTGAATGTTGAAGG + Intergenic
1139946859 16:70647722-70647744 CAGGAACTGTTGGAGGTTTGGGG + Intronic
1140035950 16:71371472-71371494 CAGGCTCTGCTAGAGCTCTGAGG + Intronic
1140895198 16:79318466-79318488 CTGGCTCTGGGGCAGGTTTGTGG - Intergenic
1142223388 16:88865979-88866001 CAGGCTCTGCTCAAGGAAGGTGG + Intronic
1142246517 16:88972672-88972694 CAGGCTCTGCTGACCCTGTGGGG - Intronic
1142711355 17:1725494-1725516 CAGGCTCTGCAGAGGGTCTATGG + Exonic
1146434061 17:32826306-32826328 CAGGCTCTGCTAAATGGGTGGGG - Intronic
1147219148 17:38918508-38918530 CAGGCTCTGCTCCAGGGTCGTGG + Intronic
1147404091 17:40198534-40198556 CACTCACTGCTGAAGGTCTGTGG + Intergenic
1147698955 17:42379648-42379670 CAGGTAGTGTTGAAGGTTTGAGG - Intronic
1148069871 17:44902449-44902471 CAGGCTCTACTGCAGCTTGGGGG + Exonic
1148530335 17:48384221-48384243 CAGGCCTTGTTGATGGTTTGGGG + Intronic
1148562937 17:48616541-48616563 TAGGCACTGCAGAAGGTGTGGGG - Intronic
1151078415 17:71300799-71300821 CAGGCTTTGGGAAAGGTTTGGGG + Intergenic
1151245851 17:72794056-72794078 CAGGCTCTGCCTGAGGTTTGTGG + Intronic
1151255097 17:72870644-72870666 CACGCTCTCCTGCAGATTTGTGG + Intronic
1151320205 17:73348412-73348434 CAAGTTCTGCTCAAAGTTTGCGG - Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1152832209 17:82504334-82504356 CAGGAGCTCCTGAAGGTCTGCGG + Intergenic
1153308640 18:3655727-3655749 CAGGCTCTGCTGAAAGATCCAGG + Intronic
1156763356 18:40620575-40620597 CAGGCTCTGCTGAAAGCTCTGGG - Intergenic
1161325988 19:3664543-3664565 CAGGCTCTGCCCGAGGTTTCAGG + Intronic
1161345368 19:3766545-3766567 CAGGCCCTGCTCTAGGCTTGAGG + Intronic
1161839506 19:6670423-6670445 CAGGCTCTGCTCTCGGTGTGGGG + Exonic
1162201003 19:9019975-9019997 CAGGGTGTGCTGAGCGTTTGGGG - Intergenic
1162513617 19:11135036-11135058 CATGCTCTGCCGTAGGCTTGTGG + Intronic
1164912688 19:32025595-32025617 TAGGCCCAGCTGAAGGTCTGCGG - Intergenic
1165069580 19:33247804-33247826 CAGGCTGTGATGAAGGATTCGGG + Intergenic
1165094380 19:33402479-33402501 CTGGCTCTGCTGCAGCTCTGGGG + Intronic
1165441591 19:35831427-35831449 AAGGCTCTGAGGGAGGTTTGGGG - Intronic
1165913831 19:39246001-39246023 GAGGCTCTGCTCAAGAATTGAGG + Intergenic
1167169014 19:47818641-47818663 CAGGCTCTACTGCAGGATGGGGG - Intronic
1167732379 19:51267963-51267985 CAAGCCCTGCTGAAGATGTGGGG - Intronic
925023698 2:591057-591079 GAGGCTCTGCTGAACAGTTGAGG + Intergenic
925328083 2:3038118-3038140 CAGGCACTGCTGAAGGTGGTGGG - Intergenic
925996444 2:9297329-9297351 CAGGCTCTGGAGAAGTTTGGCGG + Exonic
926012147 2:9416968-9416990 CAGGTTCTGCAGAGAGTTTGAGG - Intronic
926620119 2:15039862-15039884 CAAGCTCTGCTAAAGGTGAGGGG + Intergenic
927159759 2:20245776-20245798 CAGAAGCTGCTGAAGTTTTGTGG - Intergenic
927172182 2:20379408-20379430 CTGGCTTTGCTGAAGCTTGGAGG + Intergenic
927487188 2:23496564-23496586 CTGGCCCCGCTGAAGGTTAGAGG - Intronic
928172422 2:29012165-29012187 GAGCCTCTGCTGCAGGGTTGGGG + Intronic
929844162 2:45504308-45504330 CAGACTGTGTTGAAAGTTTGTGG - Intronic
930449078 2:51511332-51511354 CAGGCTCTGCTGCAGGCTTTTGG - Intergenic
933812928 2:86044356-86044378 CAGCCTCTGATGAGGGTTGGGGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934588285 2:95525471-95525493 CAGGCTATGCTGCAGGTGTGGGG - Intergenic
935428663 2:102949137-102949159 CAGGCACTGCGGTAGGTTAGGGG + Intergenic
935830312 2:106995328-106995350 GGGGCTCTGCTGAAGATTTCTGG + Intergenic
936944378 2:117917369-117917391 CAGCCTCTGCTCAAGGTTTCAGG + Exonic
936987507 2:118325581-118325603 CAGGCTGTGCTGCAGGGGTGGGG + Intergenic
937973980 2:127569998-127570020 GAGGAGTTGCTGAAGGTTTGTGG - Intronic
938692901 2:133808651-133808673 CAGGCTATACTGATGGGTTGGGG - Intergenic
939205032 2:139090757-139090779 CAAGCTTTGCTGGAGGATTGAGG - Intergenic
941149703 2:161898954-161898976 AAGGATGTGCTGAAGGCTTGAGG - Intronic
941684162 2:168430456-168430478 CCAGCTTTGCTGAAGGTTTAGGG + Intergenic
946124703 2:217552399-217552421 CAGACTGTGTTAAAGGTTTGGGG + Intronic
947738978 2:232476334-232476356 CAGCCTTTGCTGAAGTTTCGGGG - Intergenic
947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG + Intronic
947855455 2:233320759-233320781 CAGGCTCTCTTGCAGTTTTGTGG - Exonic
948479661 2:238241390-238241412 CAGGCTCTGCTGGGGGTGCGGGG - Intergenic
1169285244 20:4302210-4302232 CAGGCTCTGCTCCAGGGTTAGGG + Intergenic
1170032350 20:11956462-11956484 CAGCCTCTGAAGAAGGTTTCAGG + Intergenic
1170915393 20:20619269-20619291 CAGGCTTTGTTGCAGGTATGTGG - Exonic
1171018700 20:21564477-21564499 CAGGCTCTGCCCCAGGTTTCCGG + Intergenic
1172313866 20:33938605-33938627 CAGGCTCTGATTCAGGTCTGGGG - Intergenic
1173943035 20:46928266-46928288 CAGACTTTGCTGAGGGTTTCAGG - Intronic
1175275011 20:57762428-57762450 CAGGAGCTGCTGAGGCTTTGGGG + Intergenic
1175425877 20:58866109-58866131 AAGGCTCTGCTGTTGTTTTGGGG - Intronic
1175873503 20:62219235-62219257 CAGGCTCTGCTGCCGGCTGGGGG - Intronic
1176004237 20:62851013-62851035 CAGGCACTGCTGAAGGTGCTGGG - Intronic
1176070530 20:63223970-63223992 CAGGCTCACCTGGAGGTTTCAGG - Intergenic
1177121056 21:17137622-17137644 CAGGTTCTGGTGAGGCTTTGGGG + Intergenic
1178870368 21:36369123-36369145 CATGATCTACTGCAGGTTTGGGG - Exonic
1179238532 21:39568301-39568323 CAGGCGCTGCTGATGGCTTCAGG - Intronic
1179359786 21:40695095-40695117 CAGAGTCTGCGGAAGGTTTGGGG - Intronic
1180010774 21:45049857-45049879 CAGGCTCTGCTGCAGCTGGGTGG + Intergenic
1180198388 21:46210680-46210702 CAGGCTCTGCTTGAGGTTCGTGG - Exonic
1180427448 22:15211580-15211602 CAGGCTCTTTTGAATGTTAGAGG + Intergenic
1181640929 22:24198080-24198102 CAGGCTCTGTTGTAGGTTGGTGG - Intergenic
1183231939 22:36587997-36588019 CAGGCTCTTCTAAAGGGCTGTGG - Intronic
1184383641 22:44161903-44161925 CAGGCTGTCCTGCAGGGTTGGGG + Intronic
1184552075 22:45209860-45209882 CAGGATCTGCTGAAAATTTGGGG - Intronic
1184857827 22:47156177-47156199 CAGGCTCTGCGGAAGGTGACAGG + Intronic
1185057467 22:48588423-48588445 AAGGCTCTGCTGAGGCATTGGGG + Intronic
1185103165 22:48852565-48852587 GAGGGTCTGATGAAGCTTTGAGG - Intergenic
1185314250 22:50171872-50171894 CAGGGTCTGCTGAGGTTTGGAGG - Intronic
949484422 3:4524082-4524104 CAAGCTCTGCTGCAGGCTTTGGG + Intronic
951419018 3:22461919-22461941 CAGGCTATGCTCAAGGTCAGAGG + Intergenic
953123209 3:40066053-40066075 GAGGCTGTGCAGAAGGTGTGGGG - Intronic
954581576 3:51706127-51706149 CAGACTGTGCTGAAGGAATGGGG - Intergenic
954627385 3:52029960-52029982 CAGGGTCTTCTGACAGTTTGGGG - Intergenic
955407314 3:58633597-58633619 CAGGCTGTGCTGCAGGCTTCAGG - Intergenic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
960474402 3:118106752-118106774 CAGACTTTCCTGAAGGGTTGAGG + Intergenic
961070390 3:123918942-123918964 GAGACTCTGCTTAAGGGTTGGGG - Intronic
962384602 3:134922755-134922777 GGGGCTCTGCTGAAGCTCTGGGG - Intronic
962743272 3:138378672-138378694 ATGGCTCTGCCGAAGGTTTGGGG - Intronic
965043869 3:163550005-163550027 CAGGGTCTCCTGGAGGGTTGAGG - Intergenic
965067002 3:163862685-163862707 CTGTCTCTCCTGAAGGCTTGAGG - Intergenic
967951575 3:194845152-194845174 CAGGCTCTGCCCCAGGTTTGGGG - Intergenic
969882238 4:10184559-10184581 CAGGCACTGCTGAAGGTCTTAGG - Intergenic
971227682 4:24769998-24770020 GAGGCTCTGCTGAACTTTAGCGG + Intergenic
973040271 4:45460785-45460807 CAGGTTCTGCTGATAGTTTGTGG + Intergenic
973332877 4:48927474-48927496 CAGGCTCTGTTCTAGGTGTGGGG + Intergenic
975863955 4:78706799-78706821 CAGGTACTGCTCTAGGTTTGGGG - Intergenic
978596177 4:110379601-110379623 CAGGGGATGCTGAAAGTTTGTGG - Intronic
979190487 4:117850377-117850399 GAGGCTGTGGTGAAGTTTTGTGG - Intergenic
979472941 4:121122867-121122889 CAGTCTGTCCTGAAGATTTGTGG - Intergenic
985869324 5:2541395-2541417 CAGGCTCTGCTGTGTGTGTGTGG + Intergenic
986017957 5:3774679-3774701 CAGGCACTGAGGAAGGTTTCTGG - Intergenic
987570678 5:19654111-19654133 CAGCCTCTGCAGAAACTTTGAGG + Intronic
988231817 5:28489168-28489190 CTCTCTCTGCTTAAGGTTTGCGG + Intergenic
989239707 5:39189780-39189802 CAGGCTTCACCGAAGGTTTGAGG - Intronic
991569619 5:68040652-68040674 CACTCTCTTCTGAAGGTATGTGG - Intergenic
993569485 5:89519501-89519523 ATAGCTCTACTGAAGGTTTGTGG - Intergenic
994323924 5:98426806-98426828 GAGGCTCTGCTGAACATTTTAGG + Intergenic
995241621 5:109891101-109891123 CAGGGTCTCCTGAAGCTTGGAGG - Intergenic
995674460 5:114647495-114647517 CTGGCTCTGCAGAATATTTGGGG - Intergenic
997243368 5:132324951-132324973 GAGGCACTGCTGGTGGTTTGGGG + Intronic
998334326 5:141357231-141357253 CTGGGTCTGCTGAAGGCTTGAGG - Exonic
998429877 5:142061705-142061727 CAGGTTTTACTGAAGGTCTGGGG - Intergenic
999339510 5:150758155-150758177 CAAGCGCTGCAGAAGTTTTGGGG + Intronic
999707623 5:154288100-154288122 CAGGCTCTGCTGCAAATTTTAGG - Intronic
1000264017 5:159617502-159617524 CTGACACTGCAGAAGGTTTGGGG - Intergenic
1001246564 5:170109359-170109381 CTGGATCTGCTCAAGGTTTCTGG - Exonic
1001564125 5:172688557-172688579 CATGCGCTGCTGGTGGTTTGGGG + Exonic
1003007910 6:2398499-2398521 CAGACACTGCTGAAGGATTTTGG - Intergenic
1003264553 6:4553869-4553891 CAGACTTTGCTGAAGTTTGGGGG - Intergenic
1003330656 6:5125608-5125630 CAGGCTCAGCTGCAGGCTTGTGG - Intronic
1003468911 6:6410154-6410176 CAGCCTCTGATGAATGTCTGGGG - Intergenic
1005374526 6:25168841-25168863 CACACTTTGCTGAAGGTCTGAGG - Intergenic
1006513396 6:34533405-34533427 CTGGCTTTGCCGTAGGTTTGGGG - Exonic
1007921277 6:45611815-45611837 CAGGCTCTGTTGAAGCTTGGGGG - Intronic
1008938147 6:57015180-57015202 GAGGCTCTGCTTAAGGGTGGGGG + Exonic
1010367744 6:75071596-75071618 CAAGCTCTGCTGCAAGGTTGAGG - Intergenic
1016307438 6:142698504-142698526 CAGGCTCTGATGAGGGCATGTGG + Intergenic
1016380347 6:143471586-143471608 CAAGCTGTGCAGAAGGTTTTAGG + Exonic
1019812647 7:3175757-3175779 CAGGCTCTGCTGCAGGGAAGAGG + Intergenic
1020004360 7:4774438-4774460 TAGGCACTGCTGAAGGTTCTGGG - Intronic
1020560634 7:9726493-9726515 CAGGCGCTTCTGAAAGTGTGGGG + Intergenic
1020688782 7:11328825-11328847 CAGGTTCTGCCGTAGGTGTGTGG + Intergenic
1021990342 7:26135207-26135229 CAGACTCTACAGATGGTTTGAGG + Intergenic
1022312379 7:29209169-29209191 CAGCCTCTCCTGAAGGGGTGAGG + Intronic
1022497555 7:30862510-30862532 CAGGCTCTGCTGAAGGTTTGCGG + Intronic
1023582840 7:41700576-41700598 CAGTCAGTGCTGTAGGTTTGTGG + Intronic
1026137179 7:67673719-67673741 GAGACTCTGGGGAAGGTTTGGGG - Intergenic
1026419113 7:70214704-70214726 CATGCTCTGTGGAAGGTTTCTGG + Intronic
1029125269 7:98291096-98291118 CCGTCTCTGCTGCAGGGTTGGGG + Exonic
1030932140 7:115537440-115537462 CAGGCTCTACAGAAAGTATGGGG + Intergenic
1032785482 7:135196559-135196581 CAGGCCCTGCTGAAGGAGAGGGG + Intronic
1033141375 7:138829953-138829975 GAGCCTCTGCAGAAGGTCTGTGG + Intronic
1034184747 7:149166727-149166749 AAGGCTGAGCTGAAGCTTTGTGG - Intronic
1034959865 7:155358448-155358470 CAGGCTCTGCTGCAGGCATCTGG - Exonic
1035341717 7:158166640-158166662 AAGGCGCTGCTGAGGGTGTGAGG - Intronic
1035343595 7:158182476-158182498 CAGGGCCTGCTGAGGGTTGGGGG - Intronic
1035717012 8:1763219-1763241 CAGGCTCTGCCGCAGCTTTCAGG + Intronic
1036733120 8:11283886-11283908 CAGGCTCTGCTGCAGATTAACGG + Intergenic
1037395327 8:18435598-18435620 CAGGCTGGGCTGGAGGTTTCTGG - Intergenic
1037746120 8:21646371-21646393 CAGGCCTGGCTGACGGTTTGAGG - Intergenic
1038311923 8:26451315-26451337 CAGGCTCTGGTTAGGCTTTGTGG + Intronic
1039509412 8:38078966-38078988 CAGTCTCTGCTGAAGCTTCTGGG - Intergenic
1039928504 8:41961031-41961053 CAGGACCTGCTTGAGGTTTGTGG - Intronic
1042836521 8:73084087-73084109 AAAGCTCTGCTGAAGGTCTGGGG + Intronic
1044806528 8:96013798-96013820 CAGGCTCTCATGGAAGTTTGGGG + Intergenic
1044915068 8:97104445-97104467 TAGCCTCTGATGAAGTTTTGAGG + Intronic
1045381793 8:101634698-101634720 CAAGCTATGCTGAAGCTATGGGG + Intronic
1045438234 8:102185799-102185821 TAGGCTCTTCTGAAGATTTGGGG + Intergenic
1046840036 8:118846269-118846291 AAGGCTCTGCTCAAGGTGTCAGG + Intergenic
1047308875 8:123675999-123676021 CAGGCTCAGCACAAGGTTTAGGG + Intergenic
1049188526 8:141272584-141272606 CAGGCTCTCCGGAAGGGTTTGGG - Intronic
1049526824 8:143131077-143131099 CCCACCCTGCTGAAGGTTTGGGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053686083 9:40524265-40524287 CAGGCTCTTTTGAATGTTAGAGG - Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056043697 9:82695039-82695061 GAGGCTGTGGTGAAGTTTTGTGG + Intergenic
1057407245 9:94783923-94783945 CAGGGGCTACTGAAGGATTGAGG + Intronic
1059064800 9:111072036-111072058 CAGGCTCTCCTGAAGTTGTGAGG - Intergenic
1059651334 9:116318878-116318900 CAGGCCCTGCTGAGGGTCGGCGG - Intronic
1061012048 9:127961507-127961529 CAGGCACTGCTGAAGGCTCTGGG + Intronic
1061532951 9:131229092-131229114 CAGCATGAGCTGAAGGTTTGGGG + Intronic
1061674248 9:132206872-132206894 CAGACTATGCTGAAGAGTTGGGG + Intronic
1062087491 9:134656287-134656309 CAGGCTCTGCAGAAGGACAGAGG - Intronic
1185755756 X:2651761-2651783 CTGGGTCTCCTGAAGCTTTGGGG + Intergenic
1188715656 X:33456653-33456675 CAGGCTCTGCAGTCAGTTTGTGG - Intergenic
1188895228 X:35659237-35659259 CAGGATCTGCTGTGGGTTGGAGG + Intergenic
1189097954 X:38159980-38160002 CAGGTTCTGCTGCAGGCTGGAGG + Intronic
1189487948 X:41447116-41447138 CAGGGTCTGGGGAAGGTTTAAGG + Intergenic
1191685529 X:63885512-63885534 CAGGCACAGCAGCAGGTTTGTGG - Intergenic
1196938107 X:120749535-120749557 CAGCCTCTGCTGAATGATTCTGG - Intergenic
1198478176 X:137016064-137016086 CAGGCTCTGCTGTAGGTACTGGG + Intergenic
1199823890 X:151478328-151478350 CAGGCTTTGCAGCAGATTTGTGG + Intergenic
1200138275 X:153885414-153885436 CTGGCTCTGCGGCAGGTTTTCGG + Intronic
1200707709 Y:6456947-6456969 CTGGCTGTGCTTTAGGTTTGGGG - Intergenic
1201026403 Y:9707761-9707783 CTGGCTGTGCTTTAGGTTTGGGG + Intergenic