ID: 1022497681

View in Genome Browser
Species Human (GRCh38)
Location 7:30863271-30863293
Sequence CTGGAGAGAAGCAGAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022497674_1022497681 27 Left 1022497674 7:30863221-30863243 CCTGGTAGCAAAAAGAGACAGCT 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG 0: 1
1: 0
2: 3
3: 53
4: 463
1022497678_1022497681 -8 Left 1022497678 7:30863256-30863278 CCAACTGCAGTTCAGCTGGAGAG 0: 1
1: 0
2: 1
3: 25
4: 205
Right 1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG 0: 1
1: 0
2: 3
3: 53
4: 463
1022497676_1022497681 -2 Left 1022497676 7:30863250-30863272 CCAGGACCAACTGCAGTTCAGCT 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG 0: 1
1: 0
2: 3
3: 53
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022497681 Original CRISPR CTGGAGAGAAGCAGAGTGGT GGG Intronic
900227254 1:1539226-1539248 CTGGAGAGGAGCTGAGGGATGGG - Intronic
900640899 1:3687674-3687696 CGGGAGCGGAGCAGAGTGGAGGG - Intronic
900798374 1:4723208-4723230 CTGGGGAGCAGCAGATTGGAAGG + Intronic
902329538 1:15724575-15724597 CTGGGGAGAAGCAGCCTGGGGGG + Intronic
903225816 1:21893722-21893744 ATGGAGAGAAGCAGAGAGAGAGG + Intronic
903231279 1:21923741-21923763 GGGGAGAGAGGCTGAGTGGTGGG - Intronic
903459080 1:23508423-23508445 CTGGAGAGAGGCTCAGGGGTTGG - Exonic
903545376 1:24120665-24120687 CTTGAGAGAAGCAGAGGGAGTGG - Exonic
903670243 1:25031156-25031178 CTGGAGAGATGGAGACTGGAGGG + Intergenic
904310119 1:29623719-29623741 GTGGCGAGAAGCACAGTGGCTGG + Intergenic
904311806 1:29633974-29633996 CTGGAGGGAAGCAGATGGGGAGG + Intergenic
904771912 1:32885699-32885721 CTGGAGAGGAGCTGTGCGGTCGG + Intergenic
906189435 1:43886552-43886574 CTATAGAGAAGGAAAGTGGTTGG + Intronic
906480323 1:46195218-46195240 GAGGAGAGTAGGAGAGTGGTTGG - Intronic
906511278 1:46411667-46411689 CTGGATTGGAGCAGGGTGGTGGG + Intronic
906685456 1:47760422-47760444 CTGCAGTGAAGCAGAGGAGTTGG - Intergenic
906732778 1:48097591-48097613 CTGAGGAGAAGCAGATTGGAGGG - Intergenic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
907074389 1:51565209-51565231 CTGCAGAGTAGCAATGTGGTGGG + Intergenic
907164316 1:52396960-52396982 CTGGGCAGGAGCACAGTGGTGGG - Intronic
907341838 1:53740654-53740676 CCTGTGAGCAGCAGAGTGGTTGG - Intergenic
907802480 1:57783894-57783916 CTGAAGAGAAGGAGAGAGATTGG - Intronic
908492880 1:64663951-64663973 CTGGAGAGCTGCAGAGTGTGTGG + Intronic
908783811 1:67715502-67715524 CTGCTGACAAGCAGGGTGGTGGG + Intronic
908786362 1:67738481-67738503 CTGGAGATAAACAGAGGGGAGGG - Intronic
908900008 1:68945826-68945848 CTGGAGAGGAGCAGATTATTTGG - Intergenic
909824156 1:80105051-80105073 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
910350849 1:86296060-86296082 CAGGAGAAATGCAGAATGGTGGG + Intergenic
911090834 1:94015686-94015708 CTGAAGAGAAGCCTGGTGGTGGG - Intronic
912119971 1:106459004-106459026 CTGCACAGAAGCAGAGTTCTCGG + Intergenic
913319099 1:117576222-117576244 CTGGAGAGAAGCTCAGAGATGGG + Intergenic
913385044 1:118250410-118250432 CTGGAGAGAAGCACAGTTTGAGG + Intergenic
914989620 1:152487025-152487047 CTGGAGAAAAGCAGAGAAGCAGG - Intergenic
915158614 1:153899736-153899758 CTTGAGAGAAGTAGTGTGGCTGG - Intronic
915472477 1:156134330-156134352 CTGGAAGGAAGCTGAGAGGTGGG - Intronic
915669060 1:157472123-157472145 CTGCAGAGAGGCAGAGAGGAAGG + Intergenic
917048132 1:170886407-170886429 CTGTATAAAAGCAGAGTGGAGGG + Intergenic
917474067 1:175353131-175353153 CTGTAGAGAGGCACAGTGGGAGG + Intronic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
917591332 1:176480092-176480114 CTGGAGAGAAGCCGGCTGGTGGG + Intronic
918430921 1:184459981-184460003 CTGGAGAGAAACGGAGTGAAGGG - Intronic
919429084 1:197470793-197470815 CTAGCTAGAAGTAGAGTGGTGGG - Intronic
919610515 1:199740539-199740561 CTGGAGACAAGCTGAGGGGAAGG + Intergenic
919749147 1:201025785-201025807 CTGGAGGGATGCAGAGAGGGTGG - Intergenic
919773710 1:201179536-201179558 CTGGAGAGAAGTGGAGAGGGTGG + Intergenic
919981563 1:202645210-202645232 CGGGAGTGTAGCAGAGTGGGGGG - Intronic
920128069 1:203709553-203709575 TTGAAGGGAAGCAGAGTGGTCGG - Intronic
920263558 1:204706037-204706059 CTGGGGAGTCGCAGAGTGGCTGG - Intergenic
920365944 1:205448492-205448514 CTGGAGGGAGGCAGTGTGGGTGG - Intronic
920368805 1:205464122-205464144 CTGGAGAGGAGGTGAGTGTTGGG - Intergenic
920850249 1:209623606-209623628 CCGGAGAGAGGCAGAGAGGCTGG - Exonic
921650417 1:217671683-217671705 TGGGAGAGAAGCATAGGGGTGGG + Intronic
922027091 1:221760269-221760291 CTAGTGGGAAGCAGAGTGCTGGG - Intergenic
923286090 1:232497339-232497361 CTGGAGGGAGGCAGAGTCGATGG + Intronic
923836664 1:237618435-237618457 ATAGAGAGAAGAAGAGAGGTTGG + Intronic
924888674 1:248249442-248249464 ATGGAGAGAAATAGAATGGTTGG - Intergenic
1063609922 10:7553540-7553562 TTGGAGAGAAGGGGAGTGGCGGG - Intergenic
1065130853 10:22618676-22618698 CTGGAGAGGTGCAGAGGGCTTGG + Intronic
1065171442 10:23034542-23034564 ATGGGTAGAAGCAGTGTGGTAGG - Intronic
1065898483 10:30184807-30184829 CTGGATAGCCTCAGAGTGGTAGG + Intergenic
1066103494 10:32137745-32137767 CTGGGGAGAAGGGGAGAGGTCGG + Intergenic
1066459609 10:35601679-35601701 ATGGACACATGCAGAGTGGTGGG + Intergenic
1066574516 10:36810769-36810791 GGGGAAAGAAGCAGAGGGGTTGG + Intergenic
1066628323 10:37432664-37432686 TTTGAGAGAAAGAGAGTGGTGGG + Intergenic
1066778640 10:38918797-38918819 CTGGAGTGGAGTGGAGTGGTGGG + Intergenic
1067311288 10:45115891-45115913 ATGGAGAGAAAGAGAGTGGAAGG - Intergenic
1067463280 10:46474155-46474177 CTGGAGAGAAGAAGAGGTGGGGG - Intergenic
1067623914 10:47910483-47910505 CTGGAGAGAAGAAGAGGTGGGGG + Intergenic
1069206961 10:65701545-65701567 TTGGAGAGAAACAGAGAGGGAGG + Intergenic
1069378950 10:67822508-67822530 CTGAAGAGAAGAAGAGAGGCAGG + Intronic
1069606737 10:69743606-69743628 CTGCACAGAAGCAGCATGGTGGG + Intergenic
1069793293 10:71036958-71036980 CTGGAGTAAAGCAGAGAGGATGG + Intergenic
1070359621 10:75674749-75674771 CTGCAGAGTAGCAGAATTGTTGG + Intronic
1070957340 10:80473222-80473244 CAGGAAAGCAGCAGAGTGGGTGG - Intronic
1071808574 10:89152496-89152518 CAGCAAATAAGCAGAGTGGTTGG + Intergenic
1072806705 10:98428082-98428104 CTGTTGAGAAGCAGAGTTCTGGG - Intronic
1072932266 10:99676462-99676484 CAAGAGACAAGCAGAGTGGGTGG + Intronic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1074370240 10:112894894-112894916 CTGGAGACCAGCAGAGTGCCTGG - Intergenic
1074400847 10:113140347-113140369 GTGGAGAGAAGCAGAGGGCAGGG - Intronic
1074498986 10:114005313-114005335 GTGGAGAGAAGAAGATGGGTTGG - Intergenic
1074607289 10:114985848-114985870 CTGAAGAGAGGGAGAGAGGTGGG + Intergenic
1074682002 10:115916721-115916743 CTGGACAGACACAGAGTAGTTGG - Intronic
1075033118 10:119040412-119040434 CTGAAGAGAATCAGAGGGATGGG + Intronic
1075051223 10:119183689-119183711 CTGGCTAGAAGCAGAGAGGTAGG + Intergenic
1075138517 10:119809444-119809466 TTGGAGAGAAATAGAGGGGTTGG + Intronic
1075410723 10:122226011-122226033 CTGCAGATAAACAGAGAGGTAGG - Intronic
1075623987 10:123948561-123948583 CTGGAGATGAGCAGTGTGGTGGG - Intergenic
1075713419 10:124542709-124542731 CTGGAAGGAGGCAGAGAGGTGGG - Intronic
1075745475 10:124724462-124724484 GTGGAGAGAAGCAGAGTGATGGG - Intronic
1075818220 10:125282876-125282898 CTGGAGAAGAGCTGAGTGGGAGG + Intergenic
1075849143 10:125573530-125573552 CAGGAGGGCAGCAGAGGGGTCGG - Intergenic
1075995540 10:126873568-126873590 CTTGAGATAAGCAGAGGGGTGGG - Intergenic
1076563787 10:131384707-131384729 CTGGAGAGAAGGTGAGTGCTTGG - Intergenic
1076875044 10:133211656-133211678 CTAGGCAGAAGCACAGTGGTGGG - Intronic
1077198469 11:1293318-1293340 CTGGGGTGGAGCTGAGTGGTCGG + Intronic
1077265183 11:1645104-1645126 CTGCAGAGCAGCAGAGGGGCTGG + Intergenic
1077303173 11:1856414-1856436 CTGCAGAGGAGCAGGGCGGTTGG - Intronic
1077361971 11:2144801-2144823 CTGGGGACCAGCAGAATGGTGGG + Intronic
1078448764 11:11424819-11424841 CTGGAGCTAAGCAAAGTGGGTGG + Intronic
1078593442 11:12665821-12665843 CTGGTTAGAAGCAGAGAGGAGGG + Intergenic
1078740060 11:14058339-14058361 CCGGAGACTCGCAGAGTGGTGGG + Intronic
1079089564 11:17471140-17471162 CTGGATAGAAGTAGCCTGGTGGG - Intronic
1079147031 11:17862094-17862116 CTGGAGGGGAGCAGAGCAGTGGG - Intronic
1079173689 11:18119934-18119956 CTGGCTAGAAGCAGAGAGGTAGG - Intronic
1079328233 11:19512448-19512470 CTGGGGAGAACCAGAGAGGGAGG + Intronic
1080552203 11:33382500-33382522 CTAGAGAAAAGCAGAGTCATGGG + Intergenic
1081199781 11:40202106-40202128 CAAGAGACAATCAGAGTGGTTGG + Intronic
1081416751 11:42824480-42824502 CAGGAGAGTAGGAGAGGGGTTGG - Intergenic
1083791664 11:64989813-64989835 CTGCAGAGAAGCAGATGGGCGGG + Intronic
1084275882 11:68050715-68050737 GGGGTGAGAAGCAGAGGGGTTGG - Intronic
1084386263 11:68844237-68844259 CAGGAGAGCTGCAGCGTGGTCGG - Intronic
1084569458 11:69950660-69950682 CTGGAGAGAAGGAGATTGTCAGG + Intergenic
1084944495 11:72631435-72631457 CTGGAGAGAAGCAGAAGTGGAGG - Intronic
1085706292 11:78789257-78789279 CTAGAGAGAAACAGACAGGTGGG - Intronic
1086527949 11:87751128-87751150 CTTGAAAGAAGTAGAGTTGTAGG + Intergenic
1087374665 11:97326270-97326292 CAGGAGACAAGCAAAGTAGTGGG - Intergenic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1090712640 11:129401385-129401407 CTGGAGGAAACCAGAGGGGTTGG + Intronic
1092057396 12:5519254-5519276 CTTCAGTGAAACAGAGTGGTGGG + Intronic
1092799548 12:12150760-12150782 CTTAAGTGAAACAGAGTGGTTGG + Intronic
1093905786 12:24690627-24690649 CTGGAGGGAAGCAGAGAGGATGG - Intergenic
1095166074 12:38973632-38973654 CTGGAGAGAGGGAGAGGGTTGGG - Intergenic
1095968526 12:47885190-47885212 CTTCAGAGAAGCAGAGGGGGAGG + Intronic
1096994819 12:55831798-55831820 CTGAAGAGCTGCAGGGTGGTGGG + Intergenic
1097397884 12:59098204-59098226 TTGAAGAGAAGCAGAATGGTTGG + Intergenic
1097743585 12:63273762-63273784 CTTGTGAGATGCACAGTGGTAGG + Intergenic
1097835070 12:64264749-64264771 CAGCAGAGAAGAATAGTGGTTGG + Intronic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1098773062 12:74579213-74579235 TTGGAGAGAAGCCTATTGGTGGG - Intergenic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1100380102 12:94053989-94054011 CTGGAGAGAAGGGGAGGGTTAGG + Intergenic
1102768425 12:115452483-115452505 GTGGAGAGAATCAGAGAGGTGGG - Intergenic
1103417290 12:120751513-120751535 CAGGAGAGGAGCAGAGTTCTAGG + Intergenic
1105067771 12:133215659-133215681 CTGCAGGCAAGCAGAGTGGGAGG + Intergenic
1105210277 13:18253296-18253318 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1105412839 13:20185742-20185764 CTAGAGAGCAGCTGAGAGGTGGG - Intergenic
1105859332 13:24395254-24395276 CTGGAGAGGAGGAGAGGGGTTGG - Intergenic
1106003726 13:25749468-25749490 CTGGAGAAAAGCAGAGCAGTGGG + Intronic
1106394714 13:29368665-29368687 CTGGAGGGATGCAGGATGGTAGG - Intronic
1106396393 13:29385045-29385067 CTGGAGCCCAGCAGAGTGGCTGG - Intronic
1106753488 13:32797839-32797861 CTGGAGAGAAGCAGAGGGAGGGG + Intergenic
1107062059 13:36170224-36170246 CTGAGTAGAAGCAGAGGGGTGGG + Intronic
1107063896 13:36191385-36191407 ATGGGAAGAAGCAGAGTAGTAGG + Intronic
1107809479 13:44186473-44186495 CTTGGGAGAGGCAGCGTGGTTGG - Intergenic
1108453590 13:50590822-50590844 CTGTAGACAAGCAGTGTGGTTGG - Intronic
1108572608 13:51766312-51766334 CTGGTTAGAAGTAGAGCGGTGGG - Exonic
1108742064 13:53348489-53348511 CAGGAGAGAAGAAGATGGGTCGG + Intergenic
1109403324 13:61863384-61863406 GGGGAGAAAAGCAGAGTGTTGGG - Intergenic
1109438785 13:62342653-62342675 TTGGAGAGAATCAGATAGGTTGG - Intergenic
1111091324 13:83452020-83452042 CTGGTGAGGGGCAGAGTGGATGG - Intergenic
1111506664 13:89198666-89198688 GTTGAGAAAAGCAGAGGGGTTGG + Intergenic
1112543389 13:100339731-100339753 CTGGAGAAAAGGAGAGCGGCTGG - Intronic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114184029 14:20386624-20386646 CTGGGGATAAGCAGAGAGCTGGG + Intronic
1114340692 14:21739947-21739969 ATAGTGAGAAGGAGAGTGGTAGG + Intergenic
1114513325 14:23280316-23280338 CTGGGGAGAAGCTGAGCTGTTGG - Intronic
1114718457 14:24853866-24853888 ATGGACAGAAGCAGTGTGGTGGG + Intronic
1115238292 14:31229723-31229745 CTGGGGAGGAGCAGAGGGGTGGG - Intergenic
1115308234 14:31953821-31953843 CTGAGGAGAAGCAGAGAGTTGGG - Intergenic
1115739089 14:36368495-36368517 CAGAAGAGAAGCAGTGTGGTGGG + Intergenic
1115976647 14:39004194-39004216 CTGGAGAGGACGCGAGTGGTGGG + Intergenic
1116085174 14:40228018-40228040 CTGGAGAGTGGCAGGGTGGGAGG - Intergenic
1116323693 14:43502855-43502877 CTGGAGAGGAGCGGAGGGGAGGG + Intergenic
1116357383 14:43946218-43946240 CTGAAGTGAAGCACAGTTGTTGG - Intergenic
1116795381 14:49384609-49384631 CTGGTGATGAGCAGGGTGGTGGG - Intergenic
1116849392 14:49893233-49893255 CTGCAGAGAAACAGAGAGGGAGG - Intronic
1117428361 14:55624726-55624748 CTGAAGAGGAGCGAAGTGGTGGG + Intronic
1117868468 14:60173400-60173422 TTGGAGGGATGCTGAGTGGTTGG - Intergenic
1118604071 14:67490316-67490338 ATGAAGAGAGGCAGAGTGGGCGG + Intronic
1119155683 14:72408000-72408022 CTGGAGAGAGTCAGAGTAATTGG + Intronic
1119380403 14:74224652-74224674 CTGGAGGGAAGGACTGTGGTAGG - Intergenic
1119911437 14:78353138-78353160 CTGGAGAGAGGCTGAGTAGCTGG + Intronic
1120039519 14:79736826-79736848 TTGGAGAAAAGCTGAGTGTTGGG - Intronic
1120255005 14:82107378-82107400 CTGGAGAGATGGAAAGTGGGAGG + Intergenic
1120473895 14:84962426-84962448 CTGGAGACAAGTTGAGTGTTTGG - Intergenic
1122918973 14:104871799-104871821 GGGGAGACAAGCAGAGTGGGCGG + Intronic
1123442341 15:20301523-20301545 CTGCAGTGCACCAGAGTGGTAGG + Intergenic
1124348095 15:28935652-28935674 CTGGAGAGAGGCTGAGGGGAGGG - Intronic
1124497250 15:30193946-30193968 CCGGAGTGTAGCAGAGTGGGGGG - Intergenic
1124700002 15:31904428-31904450 CTGCAGAGAGGCACAGTGGAGGG - Intergenic
1124746324 15:32344701-32344723 CCGGAGTGTAGCAGAGTGGGGGG + Intergenic
1125672572 15:41484691-41484713 GTGGAGAGAAGAAGGGTGCTGGG + Intergenic
1126868024 15:52957386-52957408 CTGGAGGGAACCAGGGAGGTGGG + Intergenic
1127188603 15:56506364-56506386 CAGAAGACAAGCAAAGTGGTGGG + Intergenic
1127352141 15:58163815-58163837 AAGGAGAGAACCAGAGTGGGTGG + Intronic
1127376319 15:58388338-58388360 CTGTAGAGAAACAGAGCAGTAGG - Intronic
1128224040 15:65989365-65989387 CTGGAGAGGAGAAGGGAGGTGGG - Intronic
1129184894 15:73899988-73900010 CTGGAGACAGGCAGAGGGGGCGG - Intergenic
1129302834 15:74635958-74635980 CTGGAGTGAAGCAGACACGTTGG - Intronic
1130532842 15:84760693-84760715 TAGGAGAGAAGGAGTGTGGTTGG + Intronic
1131651971 15:94409932-94409954 CTGGAGAGAGGCAGAGTAGAGGG - Intronic
1132159071 15:99519990-99520012 TTGGAGAGAGACAGAGTGGTTGG + Intergenic
1133873410 16:9710759-9710781 ATGGAGAGAGTCAGAGAGGTGGG + Intergenic
1136024824 16:27462626-27462648 CAGGAGAGAAGCAGGGAGTTTGG - Intronic
1136776428 16:32874203-32874225 CTGGAGAGCAGCACAGTGCAGGG - Intergenic
1136894187 16:33987309-33987331 CTGGAGAGCAGCACAGTGCAGGG + Intergenic
1136922539 16:34344582-34344604 CTGGACAAAAGCACAGAGGTGGG - Intergenic
1136982034 16:35067224-35067246 CTGGACAAAAGCACAGAGGTGGG + Intergenic
1138370737 16:56524529-56524551 CTGGAGGGAGGCAGCGTGGAGGG + Intergenic
1139676959 16:68530317-68530339 CTGGAGCGGAGAAGAGAGGTCGG + Intronic
1139846978 16:69928275-69928297 CAGGAGAGAAGCAGATTTGAAGG + Intronic
1140225097 16:73070778-73070800 CTGGAGAGAGGCAGAGAGGATGG - Intergenic
1141167792 16:81671943-81671965 CTGGAAAAAAGCAGAGGGCTGGG - Intronic
1141514481 16:84534728-84534750 CTGGAAAGAGGCAGAGAGGCAGG + Intronic
1203078843 16_KI270728v1_random:1136312-1136334 CTGGAGAGCAGCACAGTGCAGGG - Intergenic
1142563236 17:823666-823688 CTGGAGAGCAGCAGCCTGGAGGG - Exonic
1143328980 17:6120274-6120296 CAGGAGAGATGCAGAGTCGGGGG - Intronic
1143445204 17:7005234-7005256 CTGGAGAGGAGGAGATTGGAGGG - Intronic
1143474040 17:7192879-7192901 CTGGAGGGAGGCAGTGGGGTGGG + Intronic
1144627408 17:16851228-16851250 CAGGAGAGGGGCAGAGAGGTGGG + Intergenic
1144879032 17:18421491-18421513 CAGGAGAGGGGCAGAGAGGTGGG - Intergenic
1144941935 17:18948071-18948093 CGGCAGAGCAGCAGAGTGGAAGG - Intergenic
1145153205 17:20522903-20522925 CAGGAGAGGGGCAGAGAGGTGGG + Intergenic
1146748352 17:35352462-35352484 CTGGAAAGGAGCATAGTGTTTGG - Exonic
1146756895 17:35440689-35440711 CTGGAAAGGAGCATAGTGTTTGG - Exonic
1148238422 17:45984139-45984161 CTGGTGACATGCAGAGTGGCGGG - Intronic
1149045955 17:52245956-52245978 CTGGAGAGAAAGAGAGTGCTGGG - Intergenic
1149495961 17:57117688-57117710 ATGGACAGAAGCAGAGAGGAAGG - Intronic
1149793364 17:59498489-59498511 CTGAAGAGAAGCAGGGTGGAGGG + Intergenic
1149968827 17:61195322-61195344 GTGGAGAGATGCACAGTGTTTGG - Intronic
1149997827 17:61414099-61414121 TTGGAGAGATGCAGACTAGTGGG + Intergenic
1150294861 17:64002200-64002222 CTGGAGGGGCCCAGAGTGGTCGG + Exonic
1150356055 17:64485773-64485795 CTGGAAAGAATCATAGAGGTAGG + Exonic
1150455742 17:65305166-65305188 CTGCAGGGAAGGAGGGTGGTGGG + Intergenic
1151089352 17:71418305-71418327 ATGGAGAGAAGCAGATTAATTGG + Intergenic
1151327039 17:73385920-73385942 GTGGAGAGAAGCAGACAGGTGGG + Intronic
1151599572 17:75097969-75097991 CGGGAGAGGAGGAGAGTGGCTGG - Intronic
1152140279 17:78532443-78532465 CTGGAGACAAGGAGGCTGGTGGG + Intronic
1152160915 17:78668150-78668172 CTGGTGAGTAGCAGAGTTGATGG - Intergenic
1152811720 17:82385648-82385670 TTGGAGAGCAGCCCAGTGGTGGG - Intergenic
1203212333 17_KI270730v1_random:90638-90660 ATGGAGTGGAGTAGAGTGGTTGG + Intergenic
1153585047 18:6612349-6612371 TTGGAGAGAAGCAAAGAGGACGG - Intergenic
1153934031 18:9904895-9904917 CTGCAGGGAAGGAGAGGGGTAGG - Intergenic
1155520736 18:26666394-26666416 CTGCAAAGAAGCAGACTGCTTGG - Intergenic
1155756709 18:29507366-29507388 CTGGAGAGAAACAATGTGGCCGG - Intergenic
1156673704 18:39502000-39502022 GTGGAGAAAAGAAGAGTGGAGGG + Intergenic
1157446375 18:47749437-47749459 CTGGGGAGAAGCAGAGGGCGGGG - Intergenic
1157588770 18:48822472-48822494 GTGGGGAGATGAAGAGTGGTTGG - Intronic
1157727882 18:49978809-49978831 CTGGGGAGGAGCAGGGTGTTGGG + Intronic
1157883014 18:51340201-51340223 CGGGAGAGAAGGAGGGTGATGGG - Intergenic
1158447343 18:57532834-57532856 ATGGAGAGAGGCAGAATGGGAGG - Intergenic
1161453080 19:4357488-4357510 CGGGAGAGAGGGAGAGGGGTTGG - Intronic
1161592876 19:5136652-5136674 CTCCAGAGCAGCAGGGTGGTGGG - Intronic
1161903411 19:7136657-7136679 CTAGAGAGAAGCAGAGATGGGGG + Intronic
1161933632 19:7357524-7357546 TTGGAGAGAAGCATGGGGGTGGG + Intronic
1162424027 19:10583297-10583319 CTGATGAGATGCAGAGTGATGGG + Intronic
1162477485 19:10909228-10909250 CGAGACAGAAGCAGAGAGGTGGG - Intronic
1162478771 19:10915992-10916014 CTGGACAGAGGGAGGGTGGTGGG - Intronic
1162636910 19:11976040-11976062 CTAGATAGAAGCAGAGAGGAGGG - Intronic
1162873157 19:13600852-13600874 CTGGTGAGAAGCAGTGTGGCTGG - Intronic
1163477851 19:17537455-17537477 CTGCAGAGAAGCAGAGGTGCCGG - Exonic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1164547714 19:29182987-29183009 CTCGGCAGAAGCAGAGAGGTTGG - Intergenic
1165276765 19:34759901-34759923 CTGGATAAAAGAAGAGCGGTGGG + Exonic
1165716049 19:38046501-38046523 CTGGAAAGAGGCAGGGTGGCCGG + Intronic
1165757776 19:38304350-38304372 GTGGAGAGAAGTTGGGTGGTTGG - Intronic
1165867665 19:38948873-38948895 CTGAAGAGAAGCTGAGTGGATGG - Intronic
1165876040 19:39007578-39007600 CTGGGGAGATGCAGAGTTGGGGG - Intronic
1166749917 19:45159758-45159780 CTGGAGGGGAGCAGTGTGCTGGG - Intronic
1167271772 19:48510181-48510203 CAGGAGAGGAGAAGAGGGGTGGG + Intronic
1168240077 19:55084468-55084490 CTGGAGGGAAGCAACGTGGGAGG + Intronic
1168323954 19:55528708-55528730 CCGGAGAGAAGGAGAGAGGACGG + Intergenic
926885042 2:17589421-17589443 CTGTGCAGAAGGAGAGTGGTTGG + Intronic
928082182 2:28321235-28321257 CTGGAGAGAAACAGAGACTTGGG + Intronic
928256661 2:29728807-29728829 CTGGACAGTAGCAGTGTGATTGG - Intronic
928366235 2:30705690-30705712 CAGGGGAGAAGCAGAGGGGCTGG - Intergenic
928416102 2:31093211-31093233 ATGGAGAGAAGGAGAGAGATGGG + Intronic
929767131 2:44854360-44854382 CTGGAGAGAAAGAGAGATGTGGG + Intergenic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930299063 2:49592965-49592987 CTGGAGAGAAAGAGAGTGAGGGG - Intergenic
931094775 2:58926852-58926874 TTGAAGAGAAACAGAGTGGATGG + Intergenic
931530469 2:63208935-63208957 CTGGGGGGAAGCAGTGTGGGAGG - Intronic
932323145 2:70836572-70836594 CTGGTGAGGAGCAGACTGGTGGG + Intergenic
932396967 2:71455006-71455028 CTGGGGAGAAGGGGAGTGGCAGG - Intronic
932592785 2:73077095-73077117 ATGGAGATTAGGAGAGTGGTAGG - Intronic
933042541 2:77487492-77487514 CAGGAGAGAAGCTGAGAGGGAGG + Intronic
933629104 2:84636147-84636169 TTGGGGGGAAGCAGAGTGATAGG - Intronic
933846889 2:86334022-86334044 CTGGGGACAAGCAGAGTGGCTGG - Intronic
934151517 2:89151980-89152002 CAGGAGAGTAGCAGGATGGTGGG - Intergenic
934215742 2:90029926-90029948 CAGGAGAGTAGCAGGATGGTGGG + Intergenic
934524333 2:95042355-95042377 CATGAAAGAAGCAGAGTGATGGG - Intronic
934761511 2:96859440-96859462 CAGGGGAGAAGCGGAGTGGTGGG - Intergenic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935267338 2:101406276-101406298 GTGGAGAGAAGGAGGGAGGTAGG + Intronic
935417193 2:102831454-102831476 CTTAAAAGAAGAAGAGTGGTGGG + Intronic
937606531 2:123807728-123807750 CAGGAGACAAGCAAAGTGATGGG + Intergenic
937766669 2:125669230-125669252 CTGGAGTGAAGCAGGGTAATGGG - Intergenic
938563814 2:132498576-132498598 CTGGGGAGATACATAGTGGTGGG + Intronic
938909634 2:135874980-135875002 ATGAAAGGAAGCAGAGTGGTGGG + Intronic
939691686 2:145269830-145269852 CTGGAGAAAAGGAAAGGGGTTGG - Intergenic
940388865 2:153107599-153107621 CTGGAGAGGAGTAGAGAAGTAGG + Intergenic
940641169 2:156345757-156345779 CTGGAGTGTGGCAGTGTGGTGGG - Intergenic
942484237 2:176422546-176422568 CTTCAAAGAAGCAGAGGGGTGGG + Intergenic
942752549 2:179304237-179304259 CTGGAGAACAGCAGGGAGGTGGG - Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
945322645 2:208443246-208443268 CTGGAGGGGAGCAGGCTGGTTGG + Intronic
947726515 2:232404679-232404701 CTGGTGAGAATCAAAGTGGCTGG - Intergenic
948312083 2:236994905-236994927 CTGGAGAGGAGCACAGACGTGGG - Intergenic
948751943 2:240138028-240138050 CTGTAGAGAAGGGGAGTGGGGGG + Intergenic
948860514 2:240750548-240750570 CTGGGGAGAAGCAGAGGCGGCGG + Intronic
1169858897 20:10131765-10131787 CTAGAGAGAGGCAGGCTGGTTGG - Intergenic
1171291421 20:23984986-23985008 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1172128341 20:32638804-32638826 CTGGAGAGAAGCAGAAAGGGGGG + Intergenic
1172167372 20:32907473-32907495 CTGCAGAGGAGCACAGTGGCGGG - Intronic
1172192623 20:33071122-33071144 CTGGATAGAGGCAGAGTGTTGGG + Intronic
1172305206 20:33875666-33875688 ATGAAGAGAAGCAGAGTGTGAGG + Intergenic
1172887722 20:38242223-38242245 CTGGATAGATGCAGAGAGGAAGG - Intronic
1172931561 20:38589759-38589781 CTGGATAGAAGCACACTTGTGGG - Intergenic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1174612201 20:51807146-51807168 CTGGAGGGAGGGAGAGTGGGGGG + Intergenic
1175246369 20:57584704-57584726 CTGGAGTGAAACAGACTAGTAGG + Intergenic
1176530970 21:7957582-7957604 GTGGAGTGAAGAAGAGTGGAAGG - Intergenic
1177095240 21:16824111-16824133 TTGCTGAGAAGCTGAGTGGTGGG + Intergenic
1178100537 21:29264054-29264076 CTGAAGAGAGGGAGAGAGGTGGG + Intronic
1178315958 21:31567054-31567076 AGGGAGAGAAGGAGAGAGGTGGG - Intergenic
1178629531 21:34247285-34247307 TTGGGGAGAAGTAGAGTGGTAGG + Intergenic
1178684951 21:34703371-34703393 CTGGTGAGAAGGAGAGTGTGGGG + Intronic
1178724860 21:35042457-35042479 GTGGAGGGAAGCAGAGAGGAAGG - Intronic
1178736394 21:35156311-35156333 CTCCAGAGAAACAGAATGGTTGG + Intronic
1179238241 21:39566224-39566246 CTGGAGAGAGGCATGGTGGCTGG + Intronic
1179639187 21:42736073-42736095 CTGGAGAGAGGAGGAGAGGTGGG - Intronic
1180765978 22:18346107-18346129 CTGGGGAGGAACAGAGAGGTGGG + Intergenic
1180780335 22:18516271-18516293 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1180813051 22:18773592-18773614 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1181199228 22:21207908-21207930 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1181400536 22:22647949-22647971 CTGGGGAGGAACAGAGAGGTGGG + Intergenic
1181500782 22:23314486-23314508 CAGGAGAGAGGCAGAGGGGCTGG - Intronic
1181702517 22:24629047-24629069 CTGGGGAGGAACAGAGAGGTGGG + Intergenic
1181731863 22:24853192-24853214 CTGGAGTGAGACAGAGTGGGTGG - Intronic
1181851099 22:25750569-25750591 CTGGAGGCAGGCAGAGGGGTTGG - Intronic
1182017863 22:27055942-27055964 CTGGAGAAGAGTAGAGTGGCAGG + Intergenic
1182431704 22:30302642-30302664 CTGGAGAGAAGCAGTGAGTTAGG + Intronic
1182715237 22:32352833-32352855 CTGAAGAGCACCAGAGCGGTAGG - Intergenic
1182804720 22:33059721-33059743 CAAGAGAGCAGCAGAGGGGTGGG - Intergenic
1183153432 22:36055536-36055558 CAGGAAACAAGCAGAGTGGCAGG + Intergenic
1183292639 22:37012255-37012277 TTGGATGGAAGCAGAGTGGAGGG + Intronic
1183362435 22:37389690-37389712 CAGGAGAGAAGCTGCTTGGTGGG - Intronic
1183379527 22:37484071-37484093 CTGCAGAGGAGGGGAGTGGTGGG + Intronic
1184421413 22:44384790-44384812 GTGGAGACAAGCAGAGGGATTGG + Intergenic
1184524549 22:45014164-45014186 CTGGAGTCAGGCAGAGTGGAGGG - Intergenic
1184598538 22:45528854-45528876 CTGGAGTGACGCTGAGTGCTTGG + Intronic
1203227597 22_KI270731v1_random:86998-87020 CTGGGGAGGAACAGAGAGGTGGG + Intergenic
1203308031 22_KI270736v1_random:123250-123272 GTGGAGTGAAATAGAGTGGTAGG + Intergenic
1203308155 22_KI270736v1_random:124032-124054 GTGGAGTGAAATAGAGTGGTTGG + Intergenic
1203310881 22_KI270736v1_random:141889-141911 GTGGAGTGGAGCAGAGTGGAGGG + Intergenic
949756007 3:7411418-7411440 GTGGACAGAAACAGAGTGTTGGG - Intronic
950923163 3:16715717-16715739 CAGGAGACAAGCAAAGTGGTGGG - Intergenic
950951625 3:17006174-17006196 CTGGTCAGAAGCAGAGAGCTGGG - Intronic
952307117 3:32156111-32156133 CTGGAGAGATGCTGGGGGGTCGG - Intronic
952424405 3:33159973-33159995 CTAGAGAGACGCAAAGTGGATGG + Intronic
953126817 3:40098467-40098489 CTGCAGATAAACAGAGTGTTAGG - Intronic
953614473 3:44477731-44477753 CCGGAGAGAAGCAGAGACGTTGG - Intergenic
956037213 3:65107064-65107086 CTGGGGAGAAGGGTAGTGGTAGG + Intergenic
956111112 3:65870627-65870649 CAGGAGAGAGGCAGGGTGGGGGG + Intronic
956481072 3:69674538-69674560 CAGTAGGGAAGTAGAGTGGTGGG - Intergenic
960619498 3:119625040-119625062 CCAGAGAGCAGCAGTGTGGTTGG - Intronic
960737503 3:120796823-120796845 CAGGAAAGAAGCAGAATGCTTGG - Intergenic
961157851 3:124695974-124695996 ATGTAGAGAAACAGGGTGGTAGG + Intronic
961328429 3:126125201-126125223 CTGGAGAGAAGCAGGGTGAGCGG - Intronic
961544162 3:127620675-127620697 CTGGAGAGAAGCACAGTGTCAGG - Intronic
961989206 3:131169327-131169349 CAGGAGAGAATCAGAGTTATGGG + Intronic
962153584 3:132919538-132919560 CTGGGTAGATACAGAGTGGTGGG - Intergenic
963211964 3:142702769-142702791 CTGGAAAGAAGTATTGTGGTTGG + Intronic
967147866 3:186621092-186621114 CAGGACAGAAGCAGAGTGGGTGG + Exonic
967286047 3:187871576-187871598 CTTGAGGGAAGGAGACTGGTTGG - Intergenic
967715353 3:192756319-192756341 CTGGGAAGAAGGAGTGTGGTGGG + Intronic
968082876 3:195859185-195859207 CTGGAGGGAAGCTGAGGGCTGGG - Intergenic
969586910 4:8099210-8099232 CTGGGGAGAAGCAGAGACTTGGG + Intronic
969695165 4:8730060-8730082 CTGGAGAGGTGGAGGGTGGTAGG + Intergenic
970360134 4:15300994-15301016 CTTCTGAGAAGCAGAGTGGAGGG - Intergenic
971750492 4:30640980-30641002 CTGGAGAGAAACTTAGTGATGGG - Intergenic
971969896 4:33606837-33606859 CAAGAGACAAGCAAAGTGGTGGG + Intergenic
971981347 4:33755093-33755115 CTGGAGAAAAGCAGAATGAAAGG + Intergenic
972382832 4:38535385-38535407 CTGCAGGGAAGCTGAGTGGATGG - Intergenic
973636251 4:52863680-52863702 CAGCAGAGAAGGAGAGGGGTGGG - Intronic
974382493 4:61159414-61159436 CAGGAGAGAATCAGAGAGGATGG + Intergenic
976221548 4:82760378-82760400 CGGGTGAGAAGGAGAGTGGCAGG - Intronic
978001981 4:103567398-103567420 ATGGAGAGAAGCAGATAGTTTGG + Intergenic
978783979 4:112588778-112588800 CTGGAAAGTAGCAGAGCAGTAGG + Intronic
980472722 4:133268938-133268960 CTGGAGAAAAGCAGATTAATAGG + Intergenic
983521373 4:168712407-168712429 CTGGAGGGAAGCAGGCTTGTGGG + Intronic
983561747 4:169108610-169108632 CGGGAGAGTTGCAGGGTGGTGGG - Intronic
983941092 4:173534767-173534789 CTGGAGAGAAGAAGAGAGAGAGG - Intergenic
985946650 5:3190272-3190294 CTGGAGAGAAGGGCACTGGTAGG + Intergenic
986265387 5:6185940-6185962 CTGAAGAGAAGGCGTGTGGTGGG + Intergenic
986847247 5:11769867-11769889 CTGGAGAAAATCAGTGGGGTTGG - Intronic
986919674 5:12666583-12666605 CTGGCGAGAAGCAGCCTGGGAGG + Intergenic
987464037 5:18251369-18251391 CGTGCGAGAATCAGAGTGGTGGG + Intergenic
987876431 5:23687164-23687186 TTGGAAAGAAGCTGAGTGTTGGG + Intergenic
988236120 5:28547610-28547632 CTGGGGAAAAGCTGAGTGTTGGG + Intergenic
989165378 5:38428678-38428700 CTGCAGAGAGGCAGTGTGGAGGG - Intronic
989297623 5:39848314-39848336 CTGTAATGAAGCAGAGTGGAAGG - Intergenic
989693343 5:44170983-44171005 CAGGAGACAAGCAAAGTAGTGGG + Intergenic
990309111 5:54520738-54520760 AAGGAGAGAAGCAGAGAGGAAGG - Intronic
991050955 5:62272540-62272562 CTGGATGGAAGAAGAGGGGTGGG - Intergenic
991711107 5:69409339-69409361 CTGGAGTGCAGCAGGGTGTTTGG - Intronic
992676925 5:79114355-79114377 CCAGACAGAAGCAAAGTGGTAGG - Intronic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
996475223 5:123910886-123910908 TTGAAGAGAAGTAGAGTGTTTGG + Intergenic
996705886 5:126497990-126498012 CAGGAGAGAAGTAGATTTGTTGG + Intergenic
997428800 5:133823395-133823417 CTGGAGAGGAGGAGAGTGCAGGG - Intergenic
999037887 5:148373945-148373967 GTGGGGAGAAGCAGGATGGTTGG - Intergenic
1000422209 5:161051249-161051271 CTGCAGATCAGCAGAGAGGTTGG + Intergenic
1000637665 5:163662203-163662225 CTGGAGTGAAGTGCAGTGGTGGG - Intergenic
1001534817 5:172491017-172491039 CCCTAGAGAAGCAGGGTGGTTGG - Intergenic
1002052346 5:176578144-176578166 CTGCAGAGAGGCAGAGAGGTGGG - Intronic
1002099184 5:176848948-176848970 CTGGACAGAGGCGGAGAGGTCGG - Intronic
1003341617 6:5227017-5227039 CTGGTGAAAAGAAGAGGGGTTGG + Intronic
1003351337 6:5320265-5320287 CTGGAGAGCAGCAGATCGTTAGG - Intronic
1004342501 6:14819677-14819699 CTGGAGACAAGCAGCCTGGCTGG - Intergenic
1005367567 6:25094636-25094658 CTGGAGTAAGGGAGAGTGGTTGG - Intergenic
1005750160 6:28874877-28874899 TGGGAGAGAAGCTGAGTGTTGGG - Intergenic
1005756550 6:28929862-28929884 TGGGAGAGAAGCAGAGTAGAAGG - Intergenic
1006682754 6:35808979-35809001 AGGGAGAGATGCAGAGTGGGCGG + Intronic
1007339432 6:41181149-41181171 ATGGAGAGAAGAAGGGTGGGAGG - Intergenic
1007735290 6:43978494-43978516 CTTGAGAGAAGCACAGGGATTGG + Intergenic
1007961807 6:45967037-45967059 CTGGAGAGAACAAATGTGGTTGG - Intronic
1008723575 6:54389099-54389121 CGAGACAGAAGCAGAATGGTAGG - Intronic
1008849333 6:56005739-56005761 CTGGAGAAGGGCAGAATGGTTGG + Intergenic
1009325799 6:62346378-62346400 CTGGTGACAAGCAGTGGGGTAGG - Intergenic
1009629749 6:66180200-66180222 ATGAAGAGATCCAGAGTGGTGGG - Intergenic
1010331649 6:74630073-74630095 GTGGGGAGAGGCAGAGTGGGGGG - Intergenic
1011015544 6:82750580-82750602 CTGGAGAGAAACAGAATGTGTGG + Intergenic
1011325475 6:86146708-86146730 CTGGGGAAAAGCTGAGTGTTGGG + Intergenic
1012148102 6:95711639-95711661 GTTGAGATAAGCACAGTGGTTGG + Intergenic
1012284463 6:97372169-97372191 CTGAAGAGAAGGAGAGAGATGGG - Intergenic
1013173533 6:107658438-107658460 CTGGGGAGAAGCAGAGATGGTGG - Exonic
1013304747 6:108837988-108838010 CAGGAAGGAAGCAGAGGGGTGGG - Intergenic
1013347687 6:109277927-109277949 CTGGAGAGAAGCATGGTAGCAGG - Intergenic
1013660995 6:112296858-112296880 CTGAAAAGAAGCAGCCTGGTAGG + Intergenic
1013919160 6:115380280-115380302 CTGAAGAGAGGGAGAGTAGTGGG - Intergenic
1015083833 6:129263542-129263564 CTGGAAAGAAGGAGCGTGGCTGG + Intronic
1015842127 6:137488000-137488022 TCGGGTAGAAGCAGAGTGGTCGG - Intergenic
1016620515 6:146104048-146104070 CTGGGGAGAAGCAAAGAGCTAGG + Intronic
1016658378 6:146545441-146545463 CTGGCTGGTAGCAGAGTGGTTGG + Intronic
1018028833 6:159826285-159826307 CTGGAGAGAAGCTGCATTGTAGG - Intergenic
1018477845 6:164160574-164160596 ATGGAGAGATGCAGAGTGAAAGG + Intergenic
1019297956 7:289231-289253 CTGGAGAAAAGTAGAGAGGCGGG - Intergenic
1019960205 7:4452651-4452673 CTGCAGAGACGCCGACTGGTAGG - Intergenic
1019991310 7:4693645-4693667 CTGGAGAACAGCAGAGTGATGGG + Intronic
1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG + Intronic
1024255696 7:47538402-47538424 CTGGAGTGAAGGCCAGTGGTAGG - Intronic
1024672815 7:51612159-51612181 CTGGAAAGCAGCAGAGAGGGAGG + Intergenic
1026895055 7:74005581-74005603 CGGGAGAGGGGCAGAGTCGTGGG - Intergenic
1027125859 7:75556286-75556308 CGGGAGGGAATCAGAGTGGCAGG - Intronic
1027548875 7:79565553-79565575 CTGGAAATAATCAGAGTAGTAGG + Intergenic
1028082968 7:86600366-86600388 CAGGAGACAAGCAAAGTGGTGGG + Intergenic
1029128478 7:98312092-98312114 ATCGAGAGAAGCAATGTGGTAGG - Exonic
1029317006 7:99724561-99724583 CTGGTGAGGAGCAGCCTGGTGGG - Intronic
1030956928 7:115864493-115864515 CTGGAGAGAATCAAGGTGGATGG - Intergenic
1031888422 7:127265091-127265113 TTGGACAGAAGAAGATTGGTTGG - Intergenic
1032332144 7:130990550-130990572 CTGGAGAGGAACAGGGTGGCAGG - Intergenic
1032991612 7:137400644-137400666 GTGGAGGGAAGGAGAGTGATGGG - Intronic
1033088855 7:138366799-138366821 GTGGAGGGGGGCAGAGTGGTAGG - Intergenic
1033140875 7:138825295-138825317 CTGGGGAGAGGCAGAGTGCGAGG - Intronic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1034487484 7:151374966-151374988 CGGGCAGGAAGCAGAGTGGTAGG + Intronic
1035581861 8:745118-745140 CTGGAGACAAGCACAGCGGCAGG + Intergenic
1038500065 8:28036373-28036395 GTGGAGAGAAGGACAGTGATAGG - Intronic
1039393313 8:37200665-37200687 ATGGAGGGAAGGAGAGTGGATGG + Intergenic
1040902496 8:52431289-52431311 TTGGAGAGAAGTGGAGTGGTGGG - Intronic
1040974793 8:53178060-53178082 CTGAAGAAAAGCAGAGATGTGGG + Intergenic
1041291239 8:56310398-56310420 CTGGGGAAAAACAGAGAGGTAGG + Intronic
1042865012 8:73349387-73349409 AGGGAGAGAAGCAGGGTGGTGGG - Intergenic
1045349632 8:101326962-101326984 CTGGAGAAAAGCAGTGTAATTGG + Intergenic
1045561536 8:103268628-103268650 CTGGAGACAGGCAGAGTAATAGG + Intergenic
1046564097 8:115876492-115876514 CTTGGAAGAAGCAGAGTTGTTGG - Intergenic
1047495257 8:125404516-125404538 GTGGGGAGAAGCAGAGGGGTGGG + Intergenic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049412370 8:142478959-142478981 CTGTGGAGAAGCAGAGTGTGGGG + Intronic
1050212813 9:3282492-3282514 CTGGCGAAAATCAGAGTTGTGGG + Intronic
1050284284 9:4085192-4085214 GTAGAGAAAAGCACAGTGGTGGG - Intronic
1052415007 9:28167146-28167168 CTGGAGAAAAGAAAAGTGGGGGG - Intronic
1052819665 9:33128817-33128839 CTGGGGAGAAGCAGACTCCTGGG - Intronic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1053425987 9:38010520-38010542 CTTGAGAAAAGCATAGAGGTGGG - Intronic
1054881827 9:70152054-70152076 CTGGAGAGAAGCTGAAAGGCTGG - Intronic
1055791922 9:79931580-79931602 CTGGAGAGAGGCAGGGTGGAGGG + Intergenic
1055865850 9:80812263-80812285 CTGAAGAGAAGAAGAGTTGAAGG + Intergenic
1056376627 9:86020175-86020197 TTGGAGGGAAGCAGAGTGCCTGG + Intronic
1056622768 9:88228078-88228100 CTCCAGAGAAACAGAGTGGTAGG - Intergenic
1056764814 9:89438173-89438195 CAGGAGAGAAGCAGGGCGCTTGG - Intronic
1056844336 9:90024508-90024530 ATAGAAGGAAGCAGAGTGGTTGG - Intergenic
1057948592 9:99351815-99351837 CTGGAGAGGAACAGAAAGGTTGG + Intergenic
1058385230 9:104428342-104428364 CAGGAGAGATACAGAGTGTTGGG - Intergenic
1058951697 9:109909992-109910014 CTGCATAGAAGCAGAGAGATTGG + Intronic
1061383791 9:130276375-130276397 GTGGAGAGAAGCTGGGTGGGTGG + Intergenic
1061954639 9:133955416-133955438 GTGGGGAGAAGCAGGGGGGTGGG - Intronic
1062196102 9:135275053-135275075 AGTGAGAGAAGCAGAATGGTAGG - Intergenic
1062355048 9:136157991-136158013 CTGGGGAGGAGCAGAGTGTCTGG - Intergenic
1186461579 X:9752598-9752620 CTGCAGAGAACCAGAGAGGAGGG + Intronic
1186580809 X:10816062-10816084 TAGGAAAGAAGCAGATTGGTGGG - Intronic
1186626391 X:11298525-11298547 CTGGTGAGAAACAGAGAGGCAGG - Intronic
1186797980 X:13065075-13065097 CTGGAGACAAGCACAGTGCCTGG + Intergenic
1187984522 X:24796063-24796085 CTGGAGAGGAGGAGAGAGGTGGG - Intronic
1189000607 X:36940412-36940434 CTGGAAAGAAGTAGAGTGGTGGG - Intergenic
1189575694 X:42350778-42350800 GTGGAGAAAAGCAAAGTGGAGGG + Intergenic
1191755021 X:64583525-64583547 GTGGGGAGAAGCAGAGTGCCTGG + Intergenic
1191930531 X:66366662-66366684 CTGGAAAGAAGCTCAGTGGAAGG + Intergenic
1192402809 X:70853938-70853960 CTGGACAGAAACAGAGTTCTAGG + Intronic
1193061659 X:77214152-77214174 CGGGAGACAAGCAAAGTGGTGGG - Intergenic
1193473687 X:81937561-81937583 CTGAAAAGAAACAGAGTAGTAGG - Intergenic
1194615682 X:96100565-96100587 CTGGAGACAAGCAGAGTGGCTGG + Intergenic
1194845937 X:98809237-98809259 TTGGTGAGAGGCAGAGTGGTAGG - Intergenic
1195625889 X:107005665-107005687 CTGGAGAGGAGCCGAGAGGGGGG - Intergenic
1196318971 X:114266396-114266418 ATGAAGAGAAGCGGAGTGGTAGG + Intergenic
1198222357 X:134614054-134614076 GTGGAGGGAAGCAGTGTGGCAGG - Intronic
1199710317 X:150464392-150464414 CTGGAGAATACCAGGGTGGTTGG - Intronic
1199787183 X:151116037-151116059 CTGGAGAGAAGGATAGTGTCTGG + Intergenic
1200088463 X:153623398-153623420 CTGGCAGGAAGCAGAGTGGTGGG - Intergenic
1200103435 X:153699837-153699859 CTGGAGAGTAGCACAGTGCAGGG + Intergenic
1200142136 X:153907648-153907670 CTGGAGAGAAGCAAGGGGGCTGG + Exonic
1200216932 X:154372071-154372093 GTGGAGGGAAGCAGAGAGGGAGG - Intronic
1201126870 Y:10923674-10923696 GTGGAGAGGGGTAGAGTGGTGGG - Intergenic
1202147151 Y:21810394-21810416 CTGGAGTGAGGCAGTGTGGCTGG + Intergenic
1202266185 Y:23021554-23021576 CAGAAGAGAAGCAAAGAGGTGGG - Intergenic
1202419178 Y:24655297-24655319 CAGAAGAGAAGCAAAGAGGTGGG - Intergenic
1202451608 Y:25014787-25014809 CAGAAGAGAAGCAAAGAGGTGGG + Intergenic