ID: 1022498707

View in Genome Browser
Species Human (GRCh38)
Location 7:30869160-30869182
Sequence TCTCCTCCATGTCCTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 376}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022498707_1022498714 21 Left 1022498707 7:30869160-30869182 CCCCCAGGAGGACATGGAGGAGA 0: 1
1: 0
2: 4
3: 38
4: 376
Right 1022498714 7:30869204-30869226 GGTTAAGTCAGTCTTTGGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 149
1022498707_1022498715 22 Left 1022498707 7:30869160-30869182 CCCCCAGGAGGACATGGAGGAGA 0: 1
1: 0
2: 4
3: 38
4: 376
Right 1022498715 7:30869205-30869227 GTTAAGTCAGTCTTTGGTAAGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1022498707_1022498711 -4 Left 1022498707 7:30869160-30869182 CCCCCAGGAGGACATGGAGGAGA 0: 1
1: 0
2: 4
3: 38
4: 376
Right 1022498711 7:30869179-30869201 GAGACAGCTGCTCATTAGACTGG 0: 1
1: 0
2: 1
3: 9
4: 97
1022498707_1022498712 0 Left 1022498707 7:30869160-30869182 CCCCCAGGAGGACATGGAGGAGA 0: 1
1: 0
2: 4
3: 38
4: 376
Right 1022498712 7:30869183-30869205 CAGCTGCTCATTAGACTGGATGG 0: 1
1: 0
2: 1
3: 6
4: 131
1022498707_1022498713 16 Left 1022498707 7:30869160-30869182 CCCCCAGGAGGACATGGAGGAGA 0: 1
1: 0
2: 4
3: 38
4: 376
Right 1022498713 7:30869199-30869221 TGGATGGTTAAGTCAGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022498707 Original CRISPR TCTCCTCCATGTCCTCCTGG GGG (reversed) Intronic
900310929 1:2032770-2032792 TCTCTGCCTTGTCCTCCTTGCGG + Intergenic
900521877 1:3109906-3109928 GCTCCTCCATGTCCTGCGTGTGG + Intronic
900575646 1:3381073-3381095 TCGCTTCAATGTCCTCCTGCTGG + Intronic
900703476 1:4061985-4062007 GCTCCTCCATGTCACCCTGGTGG - Intergenic
900913593 1:5619174-5619196 TCTTCCCCAGGTCCACCTGGGGG - Intergenic
901154311 1:7125227-7125249 CCTCCTCCACGTCAGCCTGGGGG + Intronic
901416396 1:9119725-9119747 TCTCCTCCATGAGCTGGTGGAGG - Intronic
901534385 1:9872833-9872855 TCTCCTCCAGCTCCTCCTGGAGG - Intronic
902368281 1:15991002-15991024 TCCCCTCCCTGCACTCCTGGTGG - Intergenic
902408931 1:16201797-16201819 TGACCTCCTTGTCCTCCTGGGGG + Exonic
902650404 1:17833573-17833595 CCACCTCCATGGCCTCCTGATGG - Intergenic
903036160 1:20493969-20493991 TCTCCACAATGCCCTCCAGGTGG - Intergenic
904162210 1:28530433-28530455 TCTCCTCCCTGTCCCCCTCCGGG - Intronic
904376680 1:30086166-30086188 CCTCCGCCACCTCCTCCTGGTGG - Intergenic
904458098 1:30659154-30659176 CCTCCTCCTTGTCCTCCCTGGGG - Intergenic
904524451 1:31122249-31122271 TCTCCTCCCGGTCTGCCTGGAGG + Intergenic
904622165 1:31782131-31782153 CCTCTGCCCTGTCCTCCTGGAGG - Intergenic
905295028 1:36948815-36948837 GCTCCTGCCTGTCCACCTGGCGG - Intronic
905509731 1:38509519-38509541 TCCACTCCATCCCCTCCTGGAGG - Intergenic
906208295 1:43998547-43998569 TTTCCTCCATTTCCTTCTGCAGG + Intronic
907264006 1:53244263-53244285 TTTCCTCCATTTCCTTCTGCAGG - Intergenic
909634028 1:77795574-77795596 TCTCCACCTTGTCCTCCCAGAGG + Intronic
912976568 1:114336355-114336377 CCTCTTCCATGTCCTCATGGTGG + Intergenic
913415435 1:118600989-118601011 TCTGCTCCATGTAGTCCTTGAGG + Intergenic
915557909 1:156670344-156670366 TCTCCTCCCCTTCCTCCTGGGGG + Exonic
915834623 1:159166062-159166084 TCTCCTCCATGTGCTCTTTGAGG - Intergenic
917141785 1:171842076-171842098 TTTCCTCCCTGTCCTCCAGTCGG + Intronic
917855239 1:179094189-179094211 TCTCCACAATCTCCGCCTGGAGG - Exonic
918307198 1:183258102-183258124 TCTCCTCCATGGGCTCCTGTAGG - Intronic
918475527 1:184920093-184920115 CCTCCTCAATGTCCTCCAGTTGG - Intronic
919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG + Exonic
919766241 1:201129109-201129131 TGGCCTCCGTGTCCACCTGGAGG + Intergenic
919878071 1:201885085-201885107 TCTCCTGTTTGTCCTCTTGGTGG - Intergenic
920032522 1:203045849-203045871 GCTCTTCCATGTCCTCCTTCTGG - Intronic
921302794 1:213766572-213766594 TCTTCTCAATGACCTCCTGGTGG + Intergenic
922715240 1:227866798-227866820 GCTGCTCCATGACCTCATGGAGG - Intergenic
923019392 1:230151219-230151241 CCTCCGGGATGTCCTCCTGGAGG + Intronic
923816729 1:237388152-237388174 TCTTCACCATGTTCTCCTGAAGG - Exonic
1062939515 10:1410929-1410951 GCTGCGCCCTGTCCTCCTGGAGG + Intronic
1063547776 10:6999003-6999025 CCTCATCCAGGTCCTCATGGTGG - Intergenic
1064299840 10:14113829-14113851 TCTCCTCCTTCTCCTCCAGCAGG + Intronic
1065192981 10:23232040-23232062 TCCTCTTCATTTCCTCCTGGAGG - Intronic
1065917571 10:30365908-30365930 TCTCCTCCATCTCCTGTGGGGGG + Intronic
1066484278 10:35828484-35828506 CCACCCCCATGTCCTCCTGGAGG - Intergenic
1067058242 10:43064685-43064707 TCTCCCCCAGGGCCTCCAGGTGG + Intergenic
1067905878 10:50290436-50290458 TCACCTCCATGCCTTCCTTGAGG + Intergenic
1069896671 10:71684394-71684416 TCACCTTCCTGTCCTACTGGGGG - Intronic
1070599084 10:77853383-77853405 TCTCCTTCTGGTCCTCCTCGTGG + Exonic
1071573295 10:86709655-86709677 TCTTCCCGGTGTCCTCCTGGTGG + Intronic
1072662411 10:97370967-97370989 TCTTCTTCAGGTCCTCCAGGTGG + Exonic
1073243604 10:102074199-102074221 TCTCATCCTGGGCCTCCTGGAGG + Intergenic
1073243608 10:102074211-102074233 GCTCCTCCAGGGCCTCCAGGAGG - Intergenic
1073249125 10:102111141-102111163 TCTCCTTCACTTCCTCCAGGAGG - Exonic
1074341986 10:112641242-112641264 TCTCCTTCCAGTCCTCCTGCAGG + Intronic
1076180634 10:128404693-128404715 TCTCCTCTGTGTGCTCCTGATGG - Intergenic
1076256641 10:129031713-129031735 TCCCCCCCGTGGCCTCCTGGGGG - Intergenic
1076750930 10:132542597-132542619 TCCCCTCCATGTCCTTCTCCAGG + Intronic
1077050902 11:566349-566371 CCACCCCCATGTCCTCCCGGAGG + Intergenic
1077154997 11:1087250-1087272 CCTCCTCCAGGTCCTCCTCTGGG + Intergenic
1077155017 11:1087306-1087328 CCTCCTCCAGGTCCTCCTCTGGG + Intergenic
1077211729 11:1374222-1374244 TCCCCTCCATGGACTTCTGGGGG - Intergenic
1077219211 11:1408006-1408028 CCTCCTCCATCACCTCCTGGTGG + Intronic
1077738960 11:4823594-4823616 TCACATCCATGGCCTCATGGGGG - Intronic
1078264931 11:9747987-9748009 GCTGCTCCATGGCCTCCTGCAGG - Exonic
1081484367 11:43516349-43516371 CCTCCTCCCTGGCCTCCTGAGGG - Intergenic
1083330804 11:61897593-61897615 TCTCAGCCCTGTGCTCCTGGAGG - Exonic
1083486700 11:62987590-62987612 CCTCCTCCTTGTTCTGCTGGAGG + Intergenic
1083643241 11:64156983-64157005 TCACCTCCATGTCCTCTTATCGG + Intronic
1083871753 11:65492639-65492661 TGTCCCCCATGCCTTCCTGGGGG - Intergenic
1084201261 11:67560031-67560053 AGTCCTCCATCTCCTCCTGCTGG - Intergenic
1084602252 11:70152802-70152824 TGGCCTCTGTGTCCTCCTGGAGG - Intronic
1085707360 11:78798750-78798772 TCTCCTCCTTGGCCACCAGGGGG + Intronic
1086804913 11:91228695-91228717 TCTCCTCTATGTCCTGCAGGAGG + Intergenic
1087052189 11:93897165-93897187 TCCTCTCCATGTCCTTCTGTGGG - Intergenic
1087644207 11:100788314-100788336 TCTCCACAATGTCCTCCTTGTGG - Intronic
1089163630 11:116458220-116458242 CCTCCTTCCTGTCCACCTGGAGG - Intergenic
1089286125 11:117409285-117409307 TCTCTTCCAGGGCCTCCTTGAGG + Intronic
1089575083 11:119436487-119436509 TCTCTTTCTTGTACTCCTGGAGG - Intergenic
1089787134 11:120915720-120915742 TCTACTCCCTTCCCTCCTGGTGG - Intronic
1090048773 11:123359058-123359080 TCTCCTCCATGAATTTCTGGAGG + Intergenic
1090073544 11:123564365-123564387 CCTCCTCCATGTCCTCATGGGGG + Intronic
1090360911 11:126171991-126172013 ACACCTCCACCTCCTCCTGGAGG + Intergenic
1090743705 11:129690762-129690784 CCTCCTCCATCCCCTCCTGCCGG - Intergenic
1090832201 11:130427722-130427744 CCTCCTCGCTGTCCTCCTGGTGG + Exonic
1091541789 12:1469193-1469215 TCTTCTCCCTGTCCTGCTGGTGG + Intronic
1092245088 12:6859597-6859619 CCTCCTCCCTGACCGCCTGGGGG + Intronic
1092253190 12:6912835-6912857 TCTGCACCAGGGCCTCCTGGCGG - Exonic
1092299340 12:7230575-7230597 TTTCCTCCATGTAATTCTGGTGG - Intergenic
1098157455 12:67614456-67614478 TGTCCTCCATGTCTTCCCTGTGG + Intergenic
1099769194 12:87030142-87030164 TTTCCTCCTAGACCTCCTGGCGG + Intergenic
1100064431 12:90624447-90624469 TCTCCTGCAATACCTCCTGGAGG - Intergenic
1100560269 12:95741474-95741496 TCTCCTCCATGCCAACCTGGAGG + Intronic
1101304180 12:103511087-103511109 TCTCCTCCATTTTTTCTTGGAGG - Intergenic
1102799307 12:115717647-115717669 TCTGCTCCATGTCATTCTGGAGG - Intergenic
1103254679 12:119530982-119531004 TCGACCCCATGTCCTCCTGAAGG + Exonic
1103641374 12:122355240-122355262 TCTCCTTCAGGGCCTCCTGGAGG + Exonic
1103915159 12:124372341-124372363 CCTCCTCCTTCTCCTCCTTGGGG + Exonic
1104001036 12:124860439-124860461 TCTCCCCCATGTCCACCAGCTGG + Intronic
1104273622 12:127305093-127305115 GCTCCTCCCTCACCTCCTGGAGG - Intergenic
1104405167 12:128510990-128511012 TCCCTTCCAGGTCCTGCTGGAGG + Intronic
1106068102 13:26378325-26378347 TCTCCAGCATGTCATGCTGGAGG - Intronic
1106994205 13:35462230-35462252 TCTCCTCTATAACTTCCTGGAGG - Intronic
1108378633 13:49836664-49836686 TCTGCTCCACGGCCTCCTGCAGG + Intergenic
1112126175 13:96470892-96470914 CCTCCACAATGTCCTCTTGGAGG - Intronic
1113696400 13:112349118-112349140 CCTGCTCCAAGTCCTGCTGGAGG - Intergenic
1113784096 13:112993386-112993408 TCTCCTAAAAGCCCTCCTGGCGG - Intronic
1114671824 14:24415568-24415590 CCTCCTCCAGGGCCTGCTGGGGG + Exonic
1116221793 14:42096585-42096607 TGACCTCCCTGTGCTCCTGGGGG - Intergenic
1116856428 14:49956247-49956269 TTTCCTCTATGAGCTCCTGGGGG - Intergenic
1117445226 14:55797909-55797931 ACTCCTCCATGGCTTCCTGTTGG + Intergenic
1118234832 14:63992821-63992843 TCTCCTCCAAGGCCTCCTTGAGG - Intronic
1118875915 14:69784853-69784875 ATTCCTCCATGTCCTCCAGCAGG + Intronic
1119136909 14:72229469-72229491 TACCCTCCATGTCCTCTTGTAGG + Intronic
1119797643 14:77413703-77413725 TCTCCTCCCTGTGCCCTTGGTGG - Intronic
1120516593 14:85478134-85478156 TCTCCTCCATGTTCTCCCAGTGG - Intergenic
1120833006 14:89014656-89014678 TCTCGTCCACATCCTCCTTGGGG + Intergenic
1120996155 14:90420067-90420089 TCTGCCCCATGTCATTCTGGAGG + Intergenic
1121524487 14:94609925-94609947 TCTCCTGCAGGTCCAGCTGGAGG - Intronic
1122203988 14:100139182-100139204 ACTCCGCCACGTCCTGCTGGTGG + Intronic
1122787251 14:104169396-104169418 TCTGCCCCACTTCCTCCTGGGGG + Intronic
1122828951 14:104386392-104386414 TGTCCTCCGTGTGCGCCTGGTGG + Intergenic
1123473483 15:20571276-20571298 TCTCCTCCGTGTCCTGTTGGGGG - Intergenic
1123644526 15:22429077-22429099 TCTCCTCCGTGTCCTGTTGGGGG + Intergenic
1123665842 15:22608985-22609007 TCTCCTCCGTGTCCTGTGGGGGG + Intergenic
1123733780 15:23166287-23166309 TCTCCTCCGTGTCCTGTGGGGGG - Intergenic
1124319665 15:28703398-28703420 TCTCCTCCGTGTCCTGTGGGGGG + Exonic
1124482845 15:30092032-30092054 TCTCCTCCGTGTCCTGTGGGGGG - Exonic
1124489300 15:30144103-30144125 TCTCCTCCGTGTCCTGTGGGGGG - Exonic
1124520730 15:30405186-30405208 TCTCCTCCGTGTCCTGTGGGGGG + Exonic
1124537929 15:30561033-30561055 TCTCCTCCGTGTCCTGTGGGGGG - Exonic
1124544388 15:30613094-30613116 TCTCCTCCGTGTCCTGTGGGGGG - Exonic
1124564351 15:30800530-30800552 TCTCCTCCGTGTCCTGTGGGGGG - Intergenic
1124760724 15:32446553-32446575 TCTCCTCCGTGTCCTGTGGGGGG + Exonic
1124777910 15:32602510-32602532 TCTCCTCCGTGTCCTGTGGGGGG - Exonic
1125723670 15:41857191-41857213 TCTCTTCCCTGCCTTCCTGGAGG - Intronic
1129003005 15:72349624-72349646 TCTTCTCTATCTCCTCCTGTAGG + Intronic
1129262106 15:74374317-74374339 TCCCCTCCAGCACCTCCTGGTGG + Intergenic
1129269250 15:74410869-74410891 TCTGCTCCACGTTCTCCTTGTGG + Exonic
1129779807 15:78263362-78263384 TCTCCTCCATGTGTTCCATGGGG - Intergenic
1129973689 15:79803201-79803223 TCTCCTCCACTTTCTCCTCGTGG - Intergenic
1130276107 15:82477123-82477145 TCTGAGCCATGTCCTCCTGCAGG - Intergenic
1130468470 15:84204516-84204538 TCTGAGCCATGTCCTCCTGCAGG - Intergenic
1130485278 15:84395240-84395262 TCTGAGCCATGTCCTCCTGCAGG + Intergenic
1130495796 15:84469026-84469048 TCTGAGCCATGTCCTCCTGCAGG + Intergenic
1130590763 15:85209115-85209137 TCTGAGCCATGTCCTCCTGCAGG - Intergenic
1131567136 15:93496522-93496544 TCTGCTCCATGTTCTTTTGGAGG + Intergenic
1132232310 15:100193235-100193257 TTTGCGCCATGTCCTCCTTGAGG + Intronic
1133109274 16:3536115-3536137 TCTCCTCCGAGTCCTCCTATAGG - Exonic
1133301261 16:4784128-4784150 TCTCCTCTGTGTCCTCTGGGCGG + Intronic
1133796651 16:9051854-9051876 TCTCCTCACTATTCTCCTGGGGG + Intergenic
1133825026 16:9270667-9270689 CCTCCTGTCTGTCCTCCTGGAGG + Intergenic
1134008551 16:10834479-10834501 GCTCTTCCATGTCCTTCAGGTGG + Intergenic
1136275686 16:29178035-29178057 CCTCCTCCATCCCCTCCTGTGGG - Intergenic
1136450942 16:30353981-30354003 CTTCCTCCATCTCCTCCTGCAGG + Exonic
1136516572 16:30772163-30772185 ACTCCTTGATCTCCTCCTGGAGG - Exonic
1136720229 16:32314143-32314165 TTTTCCCCATGTCCTTCTGGAGG - Intergenic
1136725282 16:32352536-32352558 TTTTCCCCATGTCCTTCTGGAGG - Intergenic
1136838605 16:33520419-33520441 TTTTCCCCATGTCCTTCTGGAGG - Intergenic
1136843612 16:33558593-33558615 TTTTCCCCATGTCCTTCTGGAGG - Intergenic
1137395150 16:48111826-48111848 TCTCCTCCATTAACTCCTTGTGG + Exonic
1137799729 16:51251489-51251511 GCTCCTCCTTGTACTTCTGGTGG + Intergenic
1138348395 16:56333743-56333765 TCTGCTCCAGGACCTGCTGGGGG - Intronic
1138585992 16:57970848-57970870 GGTCCCCCAAGTCCTCCTGGGGG + Intronic
1139323250 16:66132448-66132470 CTTCATCCATGACCTCCTGGAGG - Intergenic
1140199985 16:72887228-72887250 TCAGCTTCATTTCCTCCTGGAGG - Intronic
1140211329 16:72972925-72972947 TCTCCTCCCTGTTCTCCTGTAGG + Intronic
1140279924 16:73544776-73544798 TCACCTCCCAGTCCACCTGGGGG + Intergenic
1141465116 16:84200407-84200429 TTATCTCCATCTCCTCCTGGGGG + Intergenic
1141556262 16:84838648-84838670 TCTCCTCCTTGTCCTCCCTGGGG - Exonic
1142129251 16:88425287-88425309 CCTCCTCCATCACCTCCTGGAGG + Intergenic
1142432441 16:90037225-90037247 TGTCCTCCATCTGCTCCTGCAGG - Exonic
1203001148 16_KI270728v1_random:165218-165240 TTTTCCCCATGTCCTTCTGGAGG + Intergenic
1203006202 16_KI270728v1_random:203626-203648 TTTTCCCCATGTCCTTCTGGAGG + Intergenic
1203132751 16_KI270728v1_random:1701622-1701644 TTTTCCCCATGTCCTTCTGGAGG + Intergenic
1203148770 16_KI270728v1_random:1820705-1820727 TTTTCCCCATGTCCTTCTGGAGG - Intergenic
1203153777 16_KI270728v1_random:1858891-1858913 TTTTCCCCATGTCCTTCTGGAGG - Intergenic
1144742208 17:17590317-17590339 TCTCCTCCTGTGCCTCCTGGAGG + Intronic
1145200268 17:20938595-20938617 CGTCCTCCATGTGTTCCTGGAGG + Intergenic
1146061078 17:29607735-29607757 GCTGCTCGATGTCCACCTGGAGG - Exonic
1147315336 17:39617725-39617747 TCTCCTCCTTGTCCTTCTCCTGG + Intergenic
1148821067 17:50360000-50360022 TCTGCTCCATGTACTCGTTGTGG - Exonic
1149584704 17:57777996-57778018 TCTGCTCCTTGTCCTTCTAGTGG - Intergenic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1150343429 17:64386843-64386865 TCTCCTCCCAGTCCTCCTACTGG - Intronic
1151276173 17:73036046-73036068 TCTCCTCCAAATCCTCCAAGAGG + Intronic
1151591709 17:75048568-75048590 TCTACTCTATATCCTCCTTGTGG + Intronic
1152024296 17:77798732-77798754 TCTCCTGCACCTCCACCTGGTGG + Intergenic
1152290557 17:79437559-79437581 GCTCCTCCACCTGCTCCTGGTGG - Intronic
1152312671 17:79560384-79560406 TGCCCTCCCTGTCCTGCTGGCGG + Intergenic
1152438277 17:80289138-80289160 CCTCCCCCAACTCCTCCTGGGGG - Intronic
1152546282 17:81001553-81001575 CCTCCTCCAAGTCCTCCCGCCGG - Intronic
1153894701 18:9547905-9547927 TCTGCTCCACAGCCTCCTGGTGG + Exonic
1153985938 18:10350952-10350974 TCTCCTTCATTTCCTACTGTGGG - Intergenic
1155071619 18:22321816-22321838 TCTCCCACATGACCTCTTGGTGG - Intergenic
1156661638 18:39352870-39352892 TCTCCTCAGTGTCCCCATGGTGG + Intergenic
1157762115 18:50272889-50272911 TCTCCTCCTTGTCCTCCTCTGGG + Exonic
1158247402 18:55447198-55447220 TTCCCTCCTTGGCCTCCTGGTGG - Intronic
1159576839 18:70189348-70189370 TCTCCTCCATCACCTCCAAGTGG + Intronic
1160162801 18:76487912-76487934 TCTTCTCCCTCCCCTCCTGGGGG - Intronic
1160479046 18:79221282-79221304 GCTCCTTCATGTCCTGCAGGAGG - Intronic
1160918017 19:1506916-1506938 CCTGCTCCAGGTCCTCCTGCAGG - Exonic
1161140954 19:2647441-2647463 TGTGCTCCATGTCCTCTTGCTGG + Intronic
1161698447 19:5782940-5782962 TCAGCTCCATGTCCACGTGGGGG - Exonic
1161947124 19:7444379-7444401 CCTCCTCCAGGGACTCCTGGCGG - Exonic
1162729788 19:12711446-12711468 CCTCCTCCACATCCCCCTGGGGG + Exonic
1162833482 19:13301419-13301441 TCTCCTCATTCTCCTTCTGGGGG - Intronic
1164520691 19:28976892-28976914 TCTCCTCCTTCCCCTCCAGGAGG - Intergenic
1164859086 19:31548165-31548187 CCTCCTCCATGTCCACCATGGGG - Intergenic
1165117260 19:33536247-33536269 TCTCTCCCCTGTCCTCCTTGAGG - Intergenic
1165494368 19:36142899-36142921 TGACCTCCATGTCCTGCGGGCGG - Exonic
1165755047 19:38288167-38288189 TGGCCCCCATCTCCTCCTGGAGG + Intronic
1166346329 19:42168390-42168412 TCTCCTCTCAGTCCTCCTGAAGG + Intronic
1166521957 19:43486632-43486654 TCTCCGCCATGGCCTGCTGCAGG + Exonic
1166571040 19:43797608-43797630 GCTCCTCCCAGTCCTCCTGCTGG - Exonic
1166860958 19:45810847-45810869 TCTCCTCCCACTCCTCCTGCGGG - Intronic
1167710908 19:51109915-51109937 CCACCACCCTGTCCTCCTGGTGG + Intergenic
1168105688 19:54164586-54164608 TCTCCTCCAGCTCCACCTGAAGG + Exonic
1168421672 19:56208117-56208139 TCTCCTCCCTGTCTTCCTCCAGG - Exonic
1168712665 19:58510907-58510929 TCTCCTCCAGGCTCTCCCGGAGG + Exonic
927325690 2:21802481-21802503 TCTTCTCCATGTCTTGCAGGTGG - Intergenic
927444767 2:23149431-23149453 TCTCCTTCATGGCCTCCCTGGGG + Intergenic
927843956 2:26461903-26461925 TGTCCTGCTTGTCCTCCTGCTGG + Exonic
928644080 2:33333544-33333566 TCTCCTCCATGTCCTACATCGGG - Intronic
929565056 2:42978859-42978881 CCTCCTCCCTGTCCTTCTGAGGG - Intergenic
930103175 2:47618493-47618515 TTGCCTGCCTGTCCTCCTGGCGG + Intergenic
932454683 2:71841739-71841761 TTTGCTCCTTTTCCTCCTGGTGG + Intergenic
932793168 2:74673435-74673457 TCTCCTCCCTGTCGCCCTGCAGG + Exonic
933648357 2:84830206-84830228 TCTCCTTCCTGTTCTCCTGCAGG - Intronic
934320595 2:91968023-91968045 TTTTCCCCATGTCCTTCTGGAGG + Intergenic
935041278 2:99430244-99430266 TCTCATCCATGTCCACCTCCAGG - Intronic
937104242 2:119295111-119295133 TCTCAGCCACCTCCTCCTGGAGG - Intergenic
937220481 2:120340402-120340424 TCTCTCTCATGTCCACCTGGGGG + Intergenic
937985918 2:127638034-127638056 CCTCCACCCTGGCCTCCTGGGGG - Intergenic
940714422 2:157203708-157203730 TCTCCTCCAAGACCTCATGAAGG + Intergenic
942406654 2:175663172-175663194 TCTCTTCCTTCTCCTCTTGGAGG + Intergenic
943000592 2:182323719-182323741 TATCCTCCTTGTGTTCCTGGGGG - Intronic
944780710 2:203014611-203014633 CCTCCTCCATGTCCAGCTGAGGG + Intronic
946514416 2:220395875-220395897 TCTCGTGCCAGTCCTCCTGGAGG - Intergenic
947352641 2:229262390-229262412 TCTCCTTTATTTCCTTCTGGTGG - Intronic
948602468 2:239115247-239115269 CCTCCTCCGTCTCCTCCGGGTGG + Exonic
1170914628 20:20610727-20610749 TCTCCTCCATCTACTCCAGGTGG + Intronic
1172173686 20:32959928-32959950 TGTCCTCAATGTCTTCCAGGGGG - Intronic
1172697445 20:36832332-36832354 TCTCCACCATGTCCTCCACCTGG + Intronic
1172977610 20:38918615-38918637 TCTCCTCCATCTCCTCTATGGGG - Exonic
1173453050 20:43182144-43182166 GGTCCTCCCTGACCTCCTGGTGG - Intronic
1174087577 20:48020016-48020038 GCTCCTCCCTCTCCTGCTGGAGG + Intergenic
1174146038 20:48453335-48453357 TCTCCTCCACCTCCTCCTTCAGG + Intergenic
1175105388 20:56611217-56611239 TCGCATCCCTGACCTCCTGGCGG + Intergenic
1175412098 20:58777174-58777196 TCTCCACCAAGTACACCTGGTGG - Intergenic
1175672489 20:60917412-60917434 TCTCCTCCAAGACAGCCTGGGGG - Intergenic
1176346592 21:5753996-5754018 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176353406 21:5874580-5874602 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176498235 21:7570459-7570481 TCTCCTCTTTGGCCTCCTAGAGG - Intergenic
1176540913 21:8152066-8152088 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1176559864 21:8335111-8335133 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1178363410 21:31968590-31968612 TCTCCTCCAGGTGCCCCTGCAGG - Intronic
1179721248 21:43317113-43317135 TCTCCTCCAGCTCCTGGTGGAGG - Intergenic
1179802311 21:43816745-43816767 TCTCCTGCATGGCCTGCAGGAGG + Intergenic
1179835062 21:44025899-44025921 TCTCCTCCAGGTCCTTCCTGTGG - Intronic
1180031782 21:45214973-45214995 TCTCTTACATGTCATCTTGGGGG + Intronic
1180308847 22:11152082-11152104 TTTTCCCCATGTCCTTCTGGAGG + Intergenic
1180547324 22:16513893-16513915 TTTTCCCCATGTCCTTCTGGAGG + Intergenic
1180784535 22:18539464-18539486 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1180920820 22:19520745-19520767 TGTCCTCCAGGCCCTCCGGGTGG + Intergenic
1180977952 22:19860859-19860881 TCTCCTTCCTGCCCTGCTGGTGG + Intergenic
1181128112 22:20713517-20713539 GCTCCTCCTTGGCCTCCTTGGGG - Intronic
1181241438 22:21478821-21478843 GCTCCTCCTTGGCCTCCTTGGGG - Intergenic
1182143230 22:27980615-27980637 TCTGCTCCATGTGCTGCTGGTGG + Exonic
1182211842 22:28683441-28683463 TTTTCCCCATGTCCTTCTGGAGG - Intergenic
1183182097 22:36267142-36267164 ACTCTCCCTTGTCCTCCTGGGGG + Exonic
1183467487 22:37986970-37986992 TCTCCTCCTTTCCCTGCTGGGGG + Intronic
1184854947 22:47141596-47141618 TTTCCTCCATGTCTTCCGGAAGG + Intronic
1185135120 22:49065914-49065936 CGTCCTCCATGTCCTCCTTGTGG - Intergenic
1185338436 22:50281122-50281144 TCTCCTCCAGGCCCTCCAGCTGG + Exonic
1185369706 22:50455419-50455441 GCTCCTCGCTGACCTCCTGGCGG - Intronic
1203245852 22_KI270733v1_random:68485-68507 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
950217169 3:11167973-11167995 TCTCCTGCATGTCCCTCTGCTGG - Intronic
950262797 3:11554534-11554556 CCTCCTGCATGTCCACCTCGGGG - Intronic
950330772 3:12154451-12154473 TCTCCTCCATCTCCCCTTGAAGG - Exonic
952220603 3:31320425-31320447 TGGCTTCCATGTCCTCCAGGGGG + Intergenic
952854267 3:37754963-37754985 GCTCCTCCAGGTCATCCTTGGGG - Intronic
953349324 3:42202772-42202794 GCCCCTCTCTGTCCTCCTGGGGG + Intronic
953696828 3:45166390-45166412 TCCACTCCATGTTCTCCTCGTGG + Intergenic
954157543 3:48694944-48694966 TCTCCTCCTTCTCCTCCTCCTGG - Intronic
954177589 3:48856788-48856810 CCTCCTCCACCTCCTCCTGCTGG + Intergenic
954430343 3:50467505-50467527 CCTCCTCCATGTCAGCCTTGTGG + Intronic
954901318 3:54022358-54022380 TCTCCACCATGTGCCTCTGGAGG - Intergenic
955891467 3:63654486-63654508 TCTGCTCCATTTCCGTCTGGAGG + Intronic
956375694 3:68611344-68611366 TCTTCTCCATGTCTTCATCGTGG + Intergenic
957039983 3:75329246-75329268 GCTGCTCCATCTCTTCCTGGTGG + Intergenic
957792567 3:84959367-84959389 TCTCCTCCTCCTCCTGCTGGTGG - Intronic
959884645 3:111485416-111485438 TCTCCACCATCTACTTCTGGGGG - Intronic
961486525 3:127221216-127221238 TCTCCTCCCTGTCACCCTGCAGG - Intergenic
961872076 3:129995946-129995968 TCTCCTTGCAGTCCTCCTGGAGG - Intergenic
962853995 3:139328283-139328305 CCTCCTCCAAGTTCTCCTGATGG - Intronic
965733112 3:171792975-171792997 TCTCCTTCAGGTATTCCTGGTGG - Intronic
967697127 3:192544963-192544985 TCTCCTCCATCTCCTCTTCCAGG - Intronic
967981551 3:195068919-195068941 TCTCCTGCATGTCCTTGTGGTGG + Exonic
968001837 3:195211864-195211886 CCTCCTCCAGATCTTCCTGGTGG - Intronic
968001848 3:195211909-195211931 CCTCCTCCAGATCTTCCTGGTGG - Intronic
968001860 3:195211954-195211976 CCTCCTCCAGATCTTCCTGGTGG - Intronic
968001871 3:195211999-195212021 CCTCCTCCAGATCTTCCTGGTGG - Intronic
968353170 3:198080139-198080161 TCTCCACCAAGTGCTCCAGGCGG + Intergenic
968533941 4:1112606-1112628 TCTCCCCCAGGTCCTCCAGGCGG + Intronic
968666782 4:1826764-1826786 TCTTCTCCCTGTCCTCCTGGGGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969158609 4:5235385-5235407 TGTCCTCCATTTCCTCATGTTGG + Intronic
969877814 4:10148951-10148973 GTGCCTCCATGTCCTCCTGTGGG + Intergenic
970834143 4:20380528-20380550 TTTCCTCCATGTCCTACATGTGG - Intronic
971985196 4:33813104-33813126 TCTCCTCTAGGTCCTCCCGAAGG - Intergenic
972489879 4:39577168-39577190 CCTCCTCCTCCTCCTCCTGGTGG - Intronic
975395951 4:73873389-73873411 TCTTCTGCATCTCTTCCTGGGGG + Intergenic
976118500 4:81754285-81754307 TCTCCTCCCTCTACTCCTGCAGG - Intronic
976773987 4:88686760-88686782 TCTCCTCCACATCCTCCCCGGGG - Exonic
978280967 4:107013584-107013606 TCTCCTGCATTTTTTCCTGGTGG - Intronic
985960900 5:3302589-3302611 CCTCCTCCAGGTCCCCCTGGGGG + Intergenic
986699424 5:10391545-10391567 TCTGCACCATTTCCTCCTGCTGG - Exonic
988161292 5:27520853-27520875 TCTCCCCCAGGGCCTCCAGGAGG + Intergenic
988989436 5:36655091-36655113 TCACCTCCAGGTCCCCCAGGAGG - Intronic
991125397 5:63064149-63064171 TCTCCTCTTTCTCCTTCTGGGGG + Intergenic
991457113 5:66815934-66815956 CCTCCTCCTTTTCCTCCTTGAGG - Intronic
991543989 5:67761095-67761117 GCTCCTCCTTGTACTTCTGGTGG - Intergenic
992111310 5:73497080-73497102 TCTCCTCCATGTTATATTGGAGG - Intergenic
992192959 5:74312220-74312242 TCCCCTCACTGTCTTCCTGGCGG - Intergenic
992494589 5:77280333-77280355 TCTCCTCCCTGTCCTCCTGCAGG + Intronic
994054869 5:95403897-95403919 TGTCCCCCATGTCCTTCTGAGGG - Intronic
995837121 5:116410034-116410056 TCTTCTCCATTAGCTCCTGGAGG + Intronic
998142129 5:139705948-139705970 TCCCCTCCATCCCTTCCTGGGGG - Intergenic
998169516 5:139864254-139864276 TCTGCTCCACCTCCACCTGGTGG + Intronic
998175859 5:139901713-139901735 TCTGCTCCATGTCTGCCTGTGGG + Intronic
999439530 5:151590788-151590810 TCTCCTCCATGTCCTCTTAAAGG + Intergenic
999931789 5:156441204-156441226 AATCTTCCATGTCCTCATGGAGG - Intronic
1003569492 6:7246863-7246885 TCTCGTCCTTGGGCTCCTGGCGG - Exonic
1006024740 6:31139619-31139641 TCTCCACCATGTCCTTCTTCAGG + Exonic
1006340365 6:33443373-33443395 CCCCCTCCATGGCCGCCTGGGGG - Exonic
1007307181 6:40916142-40916164 TCTCCACCATGTCACCCTGAAGG - Intergenic
1007625936 6:43246538-43246560 TCTCCTCCATATCTGCCAGGTGG + Intronic
1007695786 6:43733728-43733750 TCTCCTCCCTGCCATCCTTGGGG + Intergenic
1007951418 6:45875968-45875990 TCCCTTCCATGTCCTCCTTTTGG - Intergenic
1009353775 6:62714241-62714263 TGGCCTCCATGACCTCATGGGGG - Intergenic
1009416624 6:63422768-63422790 TCTTTTCCCTGTCTTCCTGGGGG - Intergenic
1010764061 6:79758447-79758469 TCTCCACCTTGTACTACTGGAGG - Intergenic
1012310464 6:97718248-97718270 TCTTCTCCAATTCCTGCTGGTGG + Intergenic
1013366166 6:109440284-109440306 TCTCCTCCCGGTCCTCCAGACGG + Intronic
1015331265 6:131981893-131981915 TCTCATCCATCCCTTCCTGGAGG - Intergenic
1017059363 6:150467823-150467845 TCTCCTTAGTCTCCTCCTGGCGG + Intergenic
1017592758 6:155994467-155994489 TCTAGTCCAAGTCCACCTGGAGG + Intergenic
1018767796 6:166947406-166947428 TCTCCTCCCTGGCCTCTTTGGGG - Intronic
1019409933 7:901942-901964 TCGGCTCCATCTCCTGCTGGGGG - Intronic
1019448355 7:1083034-1083056 ATTCCGCCATGTGCTCCTGGGGG + Intronic
1019729970 7:2624185-2624207 TCTGCCCCATGTCCCCTTGGGGG - Intergenic
1019780839 7:2938750-2938772 TGTCCTCCAGGGCCTCCTTGCGG + Exonic
1020255890 7:6503085-6503107 TCTCCTCTGTCTTCTCCTGGAGG + Exonic
1020265070 7:6555117-6555139 TCTCCTTCTTGGCCTCCTCGGGG + Intergenic
1021404816 7:20252809-20252831 TTTCCTCCATGTTCTCTTGTAGG - Intergenic
1022498707 7:30869160-30869182 TCTCCTCCATGTCCTCCTGGGGG - Intronic
1025004526 7:55343984-55344006 CCTTCTCCATAGCCTCCTGGTGG - Intergenic
1025606273 7:63042037-63042059 ACTCCTGCATGTCTTCCTGCAGG - Intergenic
1028679235 7:93506358-93506380 TCTCATCCATATTCTCCTGCAGG + Intronic
1028724185 7:94069015-94069037 TCTCCTCCTCCTCCTCCTGATGG - Intergenic
1029252984 7:99250301-99250323 TCTGCTACCTGTCCTTCTGGAGG - Intergenic
1029547333 7:101217260-101217282 TCCCCACCATGACCTCCTCGGGG - Exonic
1030155470 7:106450098-106450120 TATTTTCCATTTCCTCCTGGTGG + Intergenic
1030333985 7:108303740-108303762 CCTTCTCCATGTCTGCCTGGGGG + Intronic
1032054824 7:128675761-128675783 ACTCCCCAATGTCCTCCTGATGG + Exonic
1032419040 7:131762927-131762949 TCCACTCCATTTCCTCCTGATGG + Intergenic
1034411988 7:150946726-150946748 TCCCACCCCTGTCCTCCTGGAGG - Intronic
1034429979 7:151036371-151036393 ACGCCTCCATGGCCTCCTTGAGG - Intronic
1036215729 8:6878219-6878241 TCTCCTCCATGTGATCCAGAAGG - Intergenic
1036778667 8:11630923-11630945 ACTCCTGCATGTCCTCCTGCAGG + Intergenic
1036926380 8:12909736-12909758 CCTCCTCCAGGGCCTCCTGGGGG + Intergenic
1036972152 8:13367029-13367051 TCCTCTCCATGTCTCCCTGGAGG + Intronic
1040590747 8:48789988-48790010 CCTCTTCCATTCCCTCCTGGAGG + Intergenic
1042175441 8:66033516-66033538 TCTTCTCCATGACATCTTGGTGG + Intronic
1043918854 8:85957838-85957860 TCTCCTCCATGTTCTCTTCTAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1047223408 8:122937178-122937200 TCTGCCCCAGGTCCTCCTCGGGG - Intronic
1047287304 8:123498620-123498642 TCTTCTCCATTTCCTCCTTCAGG - Exonic
1047682480 8:127268336-127268358 TCTTTTCTATGTGCTCCTGGTGG - Intergenic
1047695479 8:127399502-127399524 TCTGCTCCATGTGCTCATTGAGG - Intergenic
1048608141 8:135991461-135991483 GCTGCTCCATCTCCTCCTGCTGG + Intergenic
1048844464 8:138593972-138593994 TATGCTCCGTGTACTCCTGGAGG - Intronic
1049002726 8:139836446-139836468 TCTCCTCCAGGTCCCCCCAGCGG - Intronic
1049046475 8:140155956-140155978 TCCCCTCCATGTGTTCCTTGTGG - Intronic
1050820486 9:9872809-9872831 TCTCCTCCATCTTCTCTTGAAGG - Intronic
1051306475 9:15715908-15715930 TCTACTCCACCTCCTCCTGTGGG + Intronic
1052996396 9:34553658-34553680 GCTGCTCCATTTCCTCCTGGAGG + Intronic
1053053202 9:34978100-34978122 TCTGCTCCATGCTATCCTGGGGG - Exonic
1053454752 9:38225516-38225538 TCTCCTCCTTGTGTCCCTGGAGG + Intergenic
1056495163 9:87148766-87148788 TCCCCTGCATCTCCTCCTGGGGG + Exonic
1056498798 9:87188045-87188067 TCTCCTTAATGTCCTTCGGGAGG - Intergenic
1057859281 9:98626862-98626884 TCTCTTCCAGATGCTCCTGGAGG + Intronic
1058634357 9:107022034-107022056 TCTACTCCATGGCCTGCTAGAGG + Intergenic
1058726642 9:107810852-107810874 TCTCCTCCATGCCCTAGTAGTGG - Intergenic
1059284750 9:113162776-113162798 TCTAATCCATGTCATCCAGGTGG + Exonic
1059642734 9:116233636-116233658 TCTTCTCCATCTCCACTTGGTGG + Intronic
1060374169 9:123103703-123103725 GCTTCTCCATGTCTACCTGGGGG - Exonic
1060530816 9:124346265-124346287 GCTCCTCCACGCCCTCCTGAAGG + Intronic
1060734321 9:126056750-126056772 TCTCCTCCTTTTCCTCTTGCTGG + Intergenic
1060899380 9:127244267-127244289 TCTCTTCCCTGTCCTCCAGCAGG - Intronic
1062075922 9:134589948-134589970 TCTCGTCTTTCTCCTCCTGGGGG + Intergenic
1062400298 9:136369863-136369885 TCTCCTCCATGCACTGCAGGGGG + Exonic
1062716941 9:138015454-138015476 TCTGCTTCCTGTTCTCCTGGTGG + Intronic
1203462189 Un_GL000220v1:51556-51578 TCTCCTCTTTGGCCTCCTAGAGG + Intergenic
1186425649 X:9463372-9463394 GCCCCACCATGTCCTTCTGGGGG + Intronic
1186631258 X:11351486-11351508 TCCCCTCCATCTCGTCCTGCTGG + Intronic
1188252404 X:27913632-27913654 TCTACTCCATGTCTTCCAGAAGG - Intergenic
1188823843 X:34805776-34805798 TCTCCACCATGTGCTGCTGGGGG + Intergenic
1192571069 X:72205430-72205452 TTTCCTCCATGTCCTCCACGTGG + Exonic
1192745679 X:73936113-73936135 TAGCCTCCATGACCTCCTTGTGG - Intergenic
1195513856 X:105749006-105749028 CCTCCTCCTTGTACTGCTGGTGG + Exonic
1197281243 X:124539029-124539051 TTTTCTCAATGTCCTCCTGGAGG + Intronic
1197990304 X:132310460-132310482 TTTCCTCCTTCTCTTCCTGGCGG + Intergenic
1199052001 X:143246568-143246590 GCTCCTCCTTGTACTTCTGGGGG + Intergenic
1199882536 X:151986029-151986051 TCTCCTCCCTTTGCTCCTGCTGG + Intergenic
1200125708 X:153813427-153813449 CATCCTCCTGGTCCTCCTGGTGG - Intronic
1201188096 Y:11423128-11423150 TTTTCCCCATGTCCTTCTGGAGG + Intergenic
1202372893 Y:24210320-24210342 GCTTCTCCATGGCCTCCTGCAGG + Intergenic
1202497889 Y:25459800-25459822 GCTTCTCCATGGCCTCCTGCAGG - Intergenic