ID: 1022498984

View in Genome Browser
Species Human (GRCh38)
Location 7:30870950-30870972
Sequence GAGGCACACTTGACTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7331
Summary {0: 1, 1: 0, 2: 8, 3: 491, 4: 6831}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022498984_1022498997 20 Left 1022498984 7:30870950-30870972 CCTCCCAGAGTCAAGTGTGCCTC 0: 1
1: 0
2: 8
3: 491
4: 6831
Right 1022498997 7:30870993-30871015 CAGGGTCCAGTGTGACCCCCAGG No data
1022498984_1022498998 21 Left 1022498984 7:30870950-30870972 CCTCCCAGAGTCAAGTGTGCCTC 0: 1
1: 0
2: 8
3: 491
4: 6831
Right 1022498998 7:30870994-30871016 AGGGTCCAGTGTGACCCCCAGGG No data
1022498984_1022498991 2 Left 1022498984 7:30870950-30870972 CCTCCCAGAGTCAAGTGTGCCTC 0: 1
1: 0
2: 8
3: 491
4: 6831
Right 1022498991 7:30870975-30870997 AGGGTAATGTGTGCCCCCCAGGG No data
1022498984_1022498990 1 Left 1022498984 7:30870950-30870972 CCTCCCAGAGTCAAGTGTGCCTC 0: 1
1: 0
2: 8
3: 491
4: 6831
Right 1022498990 7:30870974-30870996 CAGGGTAATGTGTGCCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022498984 Original CRISPR GAGGCACACTTGACTCTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr