ID: 1022499685

View in Genome Browser
Species Human (GRCh38)
Location 7:30874674-30874696
Sequence CAGAGCTAGAACTCATACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022499681_1022499685 15 Left 1022499681 7:30874636-30874658 CCAATGCCTCATGCCACGTAGCA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1022499685 7:30874674-30874696 CAGAGCTAGAACTCATACTTGGG 0: 1
1: 0
2: 4
3: 28
4: 339
1022499679_1022499685 19 Left 1022499679 7:30874632-30874654 CCACCCAATGCCTCATGCCACGT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1022499685 7:30874674-30874696 CAGAGCTAGAACTCATACTTGGG 0: 1
1: 0
2: 4
3: 28
4: 339
1022499682_1022499685 9 Left 1022499682 7:30874642-30874664 CCTCATGCCACGTAGCAAGACAA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1022499685 7:30874674-30874696 CAGAGCTAGAACTCATACTTGGG 0: 1
1: 0
2: 4
3: 28
4: 339
1022499680_1022499685 16 Left 1022499680 7:30874635-30874657 CCCAATGCCTCATGCCACGTAGC 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1022499685 7:30874674-30874696 CAGAGCTAGAACTCATACTTGGG 0: 1
1: 0
2: 4
3: 28
4: 339
1022499683_1022499685 2 Left 1022499683 7:30874649-30874671 CCACGTAGCAAGACAACAGCAGA 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1022499685 7:30874674-30874696 CAGAGCTAGAACTCATACTTGGG 0: 1
1: 0
2: 4
3: 28
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022499685 Original CRISPR CAGAGCTAGAACTCATACTT GGG Intronic
902047637 1:13537843-13537865 CAGAGCTGGAATTCAAACTCAGG + Intergenic
902132469 1:14274671-14274693 CAGAGCTAGAAGTCAAACCCAGG - Intergenic
902526639 1:17062945-17062967 CAGAGCTGGGATTCATACCTGGG - Intergenic
902631450 1:17706952-17706974 CAGAGCCAGAACTCAAACCCAGG - Intergenic
902791843 1:18774429-18774451 CAGAGCTAGAATTCAAACCCTGG + Intergenic
903029318 1:20451687-20451709 CAGAGCTAGAACTGAAACTCAGG - Intergenic
903104659 1:21065624-21065646 TAGAGCCAGAATTCAAACTTAGG - Intronic
903580620 1:24367936-24367958 CAGAGCTGGGATTCATACTCTGG + Intronic
904366759 1:30016034-30016056 CAGAGCTAGAATTAAATCTTGGG - Intergenic
904717151 1:32477055-32477077 CAGAGGAAGAACACGTACTTAGG - Intronic
904763546 1:32822953-32822975 CAGAGCTAGAATCCAAACTCAGG - Intronic
905002461 1:34683701-34683723 CAGAGCCAGAATTCAGACCTGGG - Intergenic
905545175 1:38792105-38792127 CAGAGGTAGGATTCATACTCGGG + Intergenic
906281655 1:44558693-44558715 CGGAGCTAGAATTCAGACCTAGG + Intronic
906341468 1:44984616-44984638 TAGAGCTAGAATTCAAACCTAGG - Intronic
907159859 1:52362040-52362062 CAGAGCTAGGATTCAAACCTAGG + Intronic
907569880 1:55473365-55473387 CAGAGCTGGAATTCAAACTCAGG - Intergenic
907811357 1:57873658-57873680 CAGAGCTAGAACTTGAACTCTGG - Intronic
907830648 1:58061199-58061221 CAAAGCTAGAACTCACCCGTGGG - Intronic
908116953 1:60949990-60950012 CAGAGCTAGGACACATGCTTGGG - Intronic
908607136 1:65810659-65810681 CAGAGCCAGGATTCAAACTTAGG + Intronic
911418742 1:97611680-97611702 CAGAGTCAGGACTCAAACTTAGG - Intronic
911687929 1:100798346-100798368 CAGATCTAGGATTCATACTCAGG - Intergenic
911784802 1:101932816-101932838 CAGAAATAGAACTCATAATATGG + Intronic
912188690 1:107312527-107312549 TAGAGCTGGAATTCAAACTTAGG + Intronic
915106828 1:153540003-153540025 CAGAGGGAGTACTCAGACTTTGG + Intronic
916334836 1:163659188-163659210 CAGAGCTAGAACTCTGCCCTGGG + Intergenic
916488213 1:165278141-165278163 CAGAGCCAGAATTCAAACTCAGG + Intronic
916894952 1:169152410-169152432 CAGAGCTAGAATTCAAACCCAGG + Intronic
917402415 1:174665224-174665246 CAGAGCTAGAATTCAAACTCTGG - Intronic
918331870 1:183469181-183469203 CAGAGTTAGAATGCATACTCAGG + Intergenic
919457535 1:197837790-197837812 CAGAGGTAGAATTCAAACTCAGG + Intergenic
919701225 1:200633028-200633050 CAGAGCCAGGATTCAGACTTAGG - Intronic
919941560 1:202290507-202290529 CAGAGCCAGGACTCAAACTCAGG - Intronic
920405297 1:205704559-205704581 GAGAGCCAGAACTCAGACCTAGG + Intergenic
921696063 1:218212269-218212291 CAGAGCTAAGACTCAAAGTTAGG + Intergenic
922132191 1:222790887-222790909 CAGAGCTAAAGCTCAGACCTTGG + Intergenic
922249248 1:223832638-223832660 CAGTGTTAGAAGTCATAGTTGGG - Intronic
922323228 1:224505661-224505683 CAGAGCTGGAATTCAGACTCAGG + Intronic
923485889 1:234430832-234430854 CAGAGCTAGGATTCAGACCTGGG - Intronic
923855428 1:237840048-237840070 CAGAGCTAGAATTCAGAATATGG + Intergenic
924564350 1:245184109-245184131 CAGAGCTATAACTGATCCTTGGG - Intronic
924684608 1:246275343-246275365 CAGAGTTAGTATTCAAACTTGGG - Intronic
924684654 1:246276081-246276103 CAGAGTTAGTATTCAAACTTGGG - Intronic
1062862859 10:823690-823712 CAGAGCTGGGGCTCAGACTTGGG - Intronic
1063556158 10:7081540-7081562 CAGTGCTAGAACTCCCACGTGGG - Intergenic
1064682053 10:17819984-17820006 CAGAGGCAGAATTCATTCTTTGG + Intronic
1065351073 10:24796305-24796327 CAGGGCAGGACCTCATACTTAGG - Intergenic
1067672995 10:48342855-48342877 CAGAATTGGAACTCACACTTGGG + Intronic
1067962253 10:50867138-50867160 CAGAACTAGAAATCGTAGTTGGG + Intronic
1068980238 10:63055134-63055156 CAGAGCAAGAAATCAAATTTAGG - Intergenic
1072425971 10:95331199-95331221 CAGAGCTAGAGCTAGAACTTGGG + Intronic
1072577205 10:96711197-96711219 CAGAGCCAGAACTGACACTCAGG + Intronic
1072681245 10:97508503-97508525 CAGAGCTGGAACTCAGCCTGAGG + Intronic
1072725937 10:97814051-97814073 CAGTGCTAGGACTCAAACCTGGG - Intergenic
1072966033 10:99973570-99973592 CAGGGCCAGAACTCAAACTGAGG + Intronic
1074059096 10:109948773-109948795 CAGAGCCAGAACTCACATTCAGG + Intronic
1074190971 10:111137019-111137041 CAGAGCCAGGACTTAAACTTGGG + Intergenic
1074672878 10:115814792-115814814 AAGAGCTGGAACTCAAACTCAGG - Intronic
1074792638 10:116906277-116906299 GAGAACTAGGACTCAAACTTGGG + Intronic
1075427870 10:122355956-122355978 CAGAGCTTGAACTCAAAACTGGG + Intergenic
1075513055 10:123087703-123087725 CAGAGCCAGAAGTCAAACATAGG - Intergenic
1076887035 10:133267686-133267708 CTGAGCTTGAACTTAAACTTGGG - Intronic
1079387959 11:19997674-19997696 CAGAGCTTGAATTCTAACTTAGG + Intronic
1079457252 11:20647142-20647164 CAGAGCTAGGACTCATGCAAAGG + Intronic
1079737106 11:24011071-24011093 TAGAGCTCAGACTCATACTTGGG - Intergenic
1080260462 11:30344070-30344092 CATAGCTAGAACTCAATCCTAGG + Intergenic
1080799685 11:35598671-35598693 CAGAGCTGGCACTCAAACCTGGG + Intergenic
1080992175 11:37550149-37550171 CAGAGCCAGAATTCAAACTCAGG + Intergenic
1081105567 11:39064310-39064332 TAGAGCAAGAACTCATATCTAGG + Intergenic
1081796274 11:45822419-45822441 CAGAACTAGAAATCAAACATAGG + Intergenic
1081944894 11:46982989-46983011 CAGAGCTAGAAATCATATCCAGG + Intronic
1083020918 11:59506123-59506145 CAGAGATAGGATTCATACCTGGG - Intergenic
1083268534 11:61558724-61558746 CAGAGGTGGTACTCACACTTGGG - Intronic
1083989076 11:66235648-66235670 CATAGCTGGAACTCAGACGTGGG + Intronic
1085416699 11:76323081-76323103 CAAAGGTAGAGCTCATATTTTGG - Intergenic
1086452126 11:86927313-86927335 CAGAGCTAAAATTCATACCGAGG + Intronic
1086593360 11:88542259-88542281 CAAAGCCAGGACTCATATTTGGG + Intronic
1088027066 11:105198566-105198588 CAGAGCTGAAAATCCTACTTTGG + Intergenic
1088690248 11:112320584-112320606 CAGAGCTAGGATTCGTACCTAGG + Intergenic
1089514218 11:119021521-119021543 CAGAGCTAGAACTCAAAGCCTGG + Intronic
1089657706 11:119963657-119963679 CAGAGCTAGAACTCACACACAGG - Intergenic
1089693095 11:120198833-120198855 CAGAGCCACAATTCAGACTTGGG + Intergenic
1090298969 11:125617379-125617401 CAGTGCTGGAATTCAAACTTAGG + Intronic
1090635644 11:128689155-128689177 TAGAGCTAGAATTCAAACCTAGG + Intronic
1091046238 11:132328324-132328346 TTTAGCTAGAACTCATCCTTGGG - Intronic
1091914209 12:4256516-4256538 TAGAGCCAGGATTCATACTTTGG + Intergenic
1093199364 12:16168559-16168581 CAGAGCCAAAAGTCAAACTTAGG - Intergenic
1093408681 12:18838864-18838886 TAGAATTTGAACTCATACTTAGG + Intergenic
1093655434 12:21688649-21688671 CAGAGATAGAATTCATAATCTGG + Intronic
1095558846 12:43541259-43541281 CAAACCCAGAACTCATACCTAGG - Intronic
1096440741 12:51641464-51641486 CAGAGCTAGGACTTAGACTCAGG - Intronic
1098369816 12:69745887-69745909 CAGAGCTAGTATTCAAACTCTGG - Intronic
1099388162 12:82044343-82044365 CAGAGTTTGCACTCAAACTTGGG - Intergenic
1099488567 12:83258108-83258130 GAGAGCAAGAACTGAAACTTAGG - Intergenic
1100097489 12:91059519-91059541 CAGAATTAGAAGTCATATTTTGG - Intergenic
1100208972 12:92381609-92381631 CAGAGTTAGAATTCAAACTCAGG - Intergenic
1100393734 12:94166406-94166428 CAGAGCCAGGAGTCAAACTTAGG + Intronic
1100850770 12:98708354-98708376 TAGAACTAGAATTCATACTGAGG + Intronic
1102238848 12:111311085-111311107 CAGAGCTGGGACTCAAACTCAGG - Intronic
1103028543 12:117593580-117593602 CAGAGCTAGAATTCTGACTCAGG - Intronic
1103263749 12:119611814-119611836 CAGAGCTGGGATTCAGACTTAGG - Intronic
1104365775 12:128175466-128175488 GAGAGCTAGAATTCAAACTCTGG - Intergenic
1104851675 12:131878476-131878498 CAGCTCTAGAACTCACCCTTGGG - Intergenic
1106116835 13:26825038-26825060 CAGAGCTAGAATTGAGTCTTTGG - Intergenic
1108008559 13:45978442-45978464 CAGAGCTGGAATTCAAACTCAGG - Intronic
1108291527 13:48966613-48966635 CAGAGCTGGGATTCATACTTAGG - Intergenic
1110520913 13:76475391-76475413 CAGAACAGGAACTCATAGTTGGG - Intergenic
1112422982 13:99270108-99270130 CAGAACTAAAAATCATTCTTAGG - Intronic
1114906031 14:27127678-27127700 CAGAGCTAGTACTCAAACAGAGG - Intergenic
1115093500 14:29606916-29606938 CAGAGCTGGAATTCAAACTCAGG - Intronic
1115945290 14:38653024-38653046 CAGGGCTAGAAGTAATAATTGGG - Intergenic
1116038245 14:39655379-39655401 CAGACCTAATACTCAAACTTAGG - Intergenic
1117588976 14:57245465-57245487 CAGAGCTGAAACTCAAACTCAGG + Intronic
1118787292 14:69056410-69056432 CAGAGCTAGGATTCAAACTCAGG + Intronic
1119540047 14:75432042-75432064 CAGAGCTAGGATTCACACTCAGG + Intronic
1121017956 14:90559873-90559895 CAGAGCTAGAATTCAAACAAGGG + Intronic
1124877189 15:33606125-33606147 CAGAGCTAGGACTCAAACCCAGG - Intronic
1124906589 15:33874294-33874316 CAGATCTAGAATTCACACTCAGG + Intronic
1126484762 15:49168060-49168082 CAGAGCTAGAACTAAAACCTAGG - Intronic
1126786817 15:52183799-52183821 CAGAGATAGGACTAATTCTTAGG + Intronic
1127468053 15:59264312-59264334 CAGAGCTAGGATTCAAACTCAGG + Intronic
1127568548 15:60217214-60217236 CAGAGCTGGAATTCAAACTCAGG - Intergenic
1128363322 15:66978224-66978246 CAGAGACAGAACTCATACCCAGG - Intergenic
1128670347 15:69570119-69570141 CACACCTACAACCCATACTTCGG + Intergenic
1128910509 15:71509601-71509623 CAGAGCTAGAAATCAAACCTGGG + Intronic
1128936220 15:71748682-71748704 CAGAGCCAGAAATCAGTCTTGGG - Intronic
1129428966 15:75484362-75484384 TAAAGCTACATCTCATACTTAGG + Intronic
1130538835 15:84806708-84806730 CAGAGCTGGAATTCACACTCAGG + Intergenic
1130732852 15:86517170-86517192 CAGAACTAGAACACATATTTAGG - Intronic
1131199325 15:90383544-90383566 CAGAGCTGGAACTCAAACCCAGG - Intergenic
1131840680 15:96433521-96433543 CAGAGCTAGTATTCAAACTAAGG + Intergenic
1131922831 15:97349014-97349036 CAGAGCTGGAATTCAAACATAGG + Intergenic
1133087227 16:3374429-3374451 AAGAGCCAGAGCTCATACTCAGG + Intronic
1133441249 16:5822811-5822833 CAGAGCTGGAACTTAAACCTGGG - Intergenic
1133915173 16:10102806-10102828 TAGAGCTAGGATTCAAACTTAGG + Intronic
1134054635 16:11162015-11162037 CAGAGCTTGGACTCAAACCTGGG + Intronic
1134765823 16:16756885-16756907 CAGAGTTAGAACTCAAACCCAGG - Intergenic
1134880396 16:17740914-17740936 CAGAGCTAGAATTCAAACCGAGG + Intergenic
1134980228 16:18602333-18602355 CAGAGTTAGAACTCAAACCCAGG + Intergenic
1135539216 16:23317096-23317118 CAGAGCTAGGAATCAAATTTAGG - Intronic
1136118418 16:28111671-28111693 CTGAGCAGGAAGTCATACTTGGG - Intronic
1137885617 16:52100350-52100372 CAGAGCTTGAGTTCATACCTAGG + Intergenic
1137991138 16:53156857-53156879 CAGAACAAGAAGTCATATTTGGG - Exonic
1141564974 16:84895237-84895259 CAGAGCTGGGACTCAAACCTAGG + Intronic
1142684992 17:1572392-1572414 CAGAGCCAGCACTCATATATGGG - Intronic
1146511988 17:33457877-33457899 CAGAGTTAGATCTCATACTCAGG + Intronic
1147603663 17:41761395-41761417 CAGGGCTAGAACACATCCGTGGG + Intronic
1148741565 17:49896216-49896238 CAGAACTAGAATTCATACCCCGG + Intergenic
1150235376 17:63588770-63588792 CAGAGCCAGAACTCAAATCTAGG - Intronic
1151645907 17:75431533-75431555 CAGATCTAGAATTCAAACTTGGG + Intergenic
1153763619 18:8354660-8354682 TAGAGCTAGAATTGAAACTTTGG + Intronic
1154234259 18:12589244-12589266 CAGAGCCAGAACTCAAACCCAGG + Intronic
1154263551 18:12859541-12859563 CAGATCTAGAGCACAGACTTTGG - Intronic
1157638379 18:49185815-49185837 CAGAACTAGAACTCAAGCCTAGG + Intronic
1157864301 18:51167637-51167659 AAGACCAAGGACTCATACTTAGG + Intergenic
1158125351 18:54094607-54094629 CAGAACTAGAAATGAAACTTTGG + Intergenic
1158514575 18:58120306-58120328 CAGAACCAGGACTCAAACTTAGG - Intronic
1159026599 18:63188268-63188290 CAGAGCTAGCACTGAAACTCAGG - Intronic
1159069105 18:63603366-63603388 CAGATCTGGAACTCAGATTTTGG - Intronic
1159335274 18:67056040-67056062 CAGAGTCAGAACTCAAACTTTGG + Intergenic
1159335280 18:67056111-67056133 CAGAGTCAGAACTCAAACTCTGG + Intergenic
1161829774 19:6594219-6594241 CAGCGCTAGAACTCGTGCCTGGG + Intronic
925292360 2:2756241-2756263 CAGACCTAGAACTGATCCTTTGG + Intergenic
925692660 2:6540762-6540784 CAGAGCCAGAACTCAAACCAAGG + Intergenic
925934870 2:8746812-8746834 CAAAGCTAGAGCTCACACTGAGG + Intronic
927257532 2:21053231-21053253 CTGAGCTAGAACTCAAACTCAGG + Intergenic
927853723 2:26515213-26515235 CAGAGCTAGGACTCAGGCCTGGG + Intronic
929006392 2:37397393-37397415 CAGAGCTAGAGTTCAAACTCAGG - Intergenic
929667825 2:43847101-43847123 CAGAGCTAGAACTAGAACTTTGG + Intronic
929676044 2:43930790-43930812 CAGAGCCAGAACTAAAACTCAGG + Intronic
931174177 2:59836345-59836367 CAGAGCTAGAACTGCTCCTAAGG + Intergenic
931964350 2:67517004-67517026 CAGATTTAAAAGTCATACTTTGG - Intergenic
932962098 2:76425178-76425200 CAGAGCTAAAGCTTATATTTCGG + Intergenic
933269450 2:80217361-80217383 CAGAGCTGGCACTCACACTAAGG - Intronic
933381017 2:81545548-81545570 CAGACTCAGAACTAATACTTGGG + Intergenic
935821388 2:106896469-106896491 CAGAGCTAGCACTGATCATTCGG - Intergenic
936635546 2:114252353-114252375 CAGAGTTAGAACTCATTACTGGG - Intergenic
936725572 2:115311150-115311172 CAGAGGCAGAACTCAAACTCAGG - Intronic
937535484 2:122881501-122881523 CAGAGCCAGAACTCAAACCTAGG + Intergenic
938744965 2:134268822-134268844 CAGAGGTAGGACTCAAACCTAGG + Intronic
939214930 2:139223909-139223931 CAGAACTAGAATTTATACCTGGG - Intergenic
939253498 2:139714016-139714038 CAGAACTAGAATTCCTACATAGG - Intergenic
940627850 2:156198260-156198282 CAGAGCTAGAAGACTTTCTTAGG + Intergenic
940812233 2:158258438-158258460 CAGAGGTAGGACTCAAACTCTGG - Intronic
941174276 2:162177976-162177998 CAGAGCTGGGACTCAAACTCAGG + Intronic
941624475 2:167815623-167815645 CATAGCTAGCACTCATAAGTCGG + Intergenic
941805513 2:169708168-169708190 CAGAGCTAGAATTCAAATTCAGG - Intronic
941923718 2:170875637-170875659 CAGAGCTGGAACTCTTACATGGG - Intergenic
942108943 2:172660865-172660887 CAGAGCTGGAACTCTGGCTTGGG - Intergenic
944123372 2:196265872-196265894 CAGAGCCAGAATTCAAACCTAGG + Intronic
944365672 2:198916337-198916359 CACAGCTACAGCTCATACTCAGG + Intergenic
945168290 2:206969130-206969152 CAGAGGTAGAAGTCATACTTTGG - Intronic
945979072 2:216294530-216294552 CAGAGCTGGAATTGATTCTTAGG - Intronic
946455957 2:219826327-219826349 TAGAATTAGAACTCATAGTTAGG - Intergenic
946632143 2:221681795-221681817 AAGAGGTGGAACTCATACCTGGG - Intergenic
948291680 2:236829930-236829952 CAGAGCAAGTACTCTAACTTTGG - Intergenic
948326037 2:237121805-237121827 CAGAGCAAGAACTCAAAGTCAGG - Intergenic
1168838787 20:895378-895400 CAGAGCCAGAACTCAAACCCAGG - Intronic
1168852970 20:989264-989286 CAGAGCTGGGACTCAAACCTGGG - Intronic
1169023225 20:2346167-2346189 CAGAGCTGGGACTCATACCCAGG + Intergenic
1169183607 20:3592886-3592908 CTGAGCAAGAACTTTTACTTAGG - Intronic
1170550521 20:17472229-17472251 CAGAGCTGGATCACATATTTTGG - Intronic
1171390546 20:24798975-24798997 CAGAGCTGGAATTCAAACCTGGG - Intergenic
1171411703 20:24952320-24952342 CAGAGCTGGAATTCAAACTCCGG + Intronic
1171725939 20:28620855-28620877 CAGAGCCAGTCCTCATGCTTGGG - Intergenic
1171857575 20:30361505-30361527 CAGAGCCAGTCCTCATGCTTGGG + Intergenic
1172042843 20:32058144-32058166 CAGAGCTGGCACTCAGACTCGGG - Intronic
1172467302 20:35165786-35165808 CAGAGCTGGGACTCATACCCAGG - Intergenic
1172586774 20:36091104-36091126 CAGAGCTAGGATCCAAACTTGGG - Intergenic
1172960984 20:38799465-38799487 CAGAGCCAGAACTCTTACCTGGG + Intergenic
1173344966 20:42190872-42190894 CAGAGCTGGAACTCAAACCTAGG - Intronic
1173371180 20:42437603-42437625 TAGACCAAGATCTCATACTTGGG + Intronic
1174524143 20:51157849-51157871 CAGAGCTGGAACTCGAACCTAGG + Intergenic
1175202081 20:57285013-57285035 CAGAGCTGGGACTCAAACCTTGG - Intergenic
1178603165 21:34012587-34012609 CAGAGCTAGGATTCAAACTCGGG - Intergenic
1179103059 21:38373586-38373608 CAGAGCTTGAACTCAGACCCAGG - Intergenic
1181117502 22:20642048-20642070 CAGAGCTGGGACTCAGACTCTGG - Intergenic
1181782453 22:25202852-25202874 CAGATCTAGAGCTCAGACTGGGG - Intronic
1182090234 22:27589751-27589773 CAGAGCCAGAATTCAGACTAGGG + Intergenic
1182110965 22:27723231-27723253 CAGAGCTAGAATTTAAACTCAGG - Intergenic
1182362625 22:29755886-29755908 CAGAGCTGGCACGCACACTTGGG + Intronic
1182675154 22:32033313-32033335 TAGAGCTTAGACTCATACTTAGG - Intergenic
1182893168 22:33836193-33836215 CAGAGCCAGAATTTAAACTTTGG - Intronic
1183006843 22:34910465-34910487 CCAAGCTGGAACTCATATTTGGG - Intergenic
1183007491 22:34915568-34915590 CAGAGCTGGGATTCAAACTTGGG - Intergenic
1183104454 22:35606323-35606345 CAGAGCTGGGACTCAAACTATGG - Intergenic
1183290792 22:37000512-37000534 CAGAACTGGAACTCAAACCTAGG - Intronic
1184442866 22:44529109-44529131 CAGAGCTACAACTCCAATTTAGG - Intergenic
1184808774 22:46814393-46814415 CAGAGCCAGGGCTCAAACTTAGG + Intronic
949413745 3:3794734-3794756 CAGAGCCAGAGCTCATGATTTGG - Intronic
950026865 3:9826049-9826071 CAGAGCTAGGACTCAAACCCAGG - Intronic
950390917 3:12696153-12696175 TAGAGCTAGAATTCAAACCTAGG + Intergenic
950396124 3:12735427-12735449 CAGAGGTAGGACTCAAACCTGGG + Intronic
950571109 3:13800618-13800640 CAGAGCCAGGATTCAGACTTGGG - Intergenic
952090681 3:29881516-29881538 CAGAGCTAGAACTTGAACTCAGG + Intronic
952535344 3:34303551-34303573 CAGAGCTAGAAAGCATGGTTTGG - Intergenic
953963897 3:47287284-47287306 CAGACCCAGAACTCAAACGTAGG - Intronic
954820383 3:53321412-53321434 CAGAGCTATAAGTAAAACTTGGG + Intronic
955660147 3:61290096-61290118 CAGAGCCAGGACTCAAACTCAGG - Intergenic
955736196 3:62040985-62041007 CAGAGCCAGGACTCAAAGTTTGG - Intronic
955845394 3:63157215-63157237 AAGAGCCAGAGCTCAAACTTAGG + Intergenic
956279986 3:67546106-67546128 TTGAGCTAGAATTCATACTGGGG + Intronic
956931034 3:74043238-74043260 CAGAGATAGAACTCAAACCCAGG + Intergenic
958028687 3:88080568-88080590 CAGAGCTGGAATTCAAACCTAGG + Intronic
959658205 3:108834389-108834411 CAGAGCTATTACTAATACTTGGG - Intronic
959932900 3:112002391-112002413 CAGAGCCAGAATTCAAACCTGGG + Intronic
960159341 3:114333144-114333166 CAGTGCTAGAAATGATGCTTTGG + Intergenic
964599829 3:158486704-158486726 CAGTGCTAGAACCAAAACTTAGG + Intronic
964924570 3:161939665-161939687 CAGAGCTAACACTCCTCCTTGGG + Intergenic
966119389 3:176505646-176505668 CAGAGCCAGAATTTAAACTTAGG + Intergenic
966488793 3:180503128-180503150 CAGAGTTAGGATTCAGACTTAGG + Intergenic
966700780 3:182847817-182847839 CAGAGCTAGAATTCAAACCAAGG + Intronic
967407819 3:189137083-189137105 TAGAGCTAGGACTCAAACCTGGG + Intronic
969313900 4:6370189-6370211 CAGAGCCAGAGCTCATGCTCGGG - Intronic
970943579 4:21663904-21663926 CAGAGCTAGAATTCAAACTTAGG + Intronic
971222441 4:24720755-24720777 GAGAGCCAAAACTCAAACTTAGG - Intergenic
971767547 4:30852792-30852814 CAGAACCAGAACTCAAACTCAGG + Intronic
973261057 4:48164072-48164094 CAGGGCCAGAACTCAAACTCTGG + Intronic
974102336 4:57430822-57430844 CAGAGCTAGAATTCATATCCAGG + Intergenic
974130496 4:57748611-57748633 CAGAGCTAAAATTGATTCTTAGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
976464198 4:85348993-85349015 CATAGCTAGAAATCAAACTCTGG + Intergenic
976510340 4:85901605-85901627 CAGAGCTTGAGATCATACATGGG + Intronic
977508077 4:97927722-97927744 CAGAGCCAGAATTCAAACTGAGG - Intronic
977917304 4:102608410-102608432 CAGAGCTATGAATCACACTTCGG + Intronic
978759628 4:112342849-112342871 TAGAGCTAGAATTCAGACTTGGG + Intronic
980022506 4:127726558-127726580 CAGAACAAGAATTTATACTTTGG + Exonic
980209185 4:129763963-129763985 CAGAGTTAGAACTCATTCAAAGG - Intergenic
981039679 4:140211607-140211629 CAGAGCTAGAACTCATTCCTTGG + Intergenic
981798812 4:148631958-148631980 AAGGGGTAGAACTCATCCTTTGG - Intergenic
984560493 4:181263194-181263216 AAGAGCCAGAATTCATACTAAGG - Intergenic
985434613 4:189916940-189916962 CAGAGCCAGTCCTCATGCTTGGG + Intergenic
990983336 5:61620692-61620714 TAGAGCTAGGATTCAAACTTGGG + Intergenic
991442416 5:66664573-66664595 AAGAGCTAGAAATAGTACTTTGG + Intronic
992481704 5:77158114-77158136 CAGAGCTGGAACTCATACCCAGG + Intergenic
992960065 5:81949248-81949270 CAGAGATGGAAGTGATACTTTGG + Intergenic
993923884 5:93841651-93841673 CAGAGCCAGAATTCAAACCTAGG + Intronic
995512761 5:112924729-112924751 CAGAGCTAGAATTCAGAATCAGG + Intergenic
995872999 5:116762012-116762034 CAGAGCTAGGACCCAAACCTAGG + Intergenic
997364565 5:133317662-133317684 CAGAGCTAGAGCTCAAACCCAGG - Intronic
997771690 5:136560973-136560995 CAGAGCTGCAACTCAAACTCAGG + Intergenic
998194006 5:140050706-140050728 CAGAGCTGGAATTCAGACGTAGG - Intergenic
998363216 5:141609450-141609472 CAGAGCTAGGATTCAAACCTAGG - Intronic
998985214 5:147749428-147749450 CAGAGCTAGAAGTCAAACCCTGG + Intronic
999530691 5:152460359-152460381 CAGAGCTGGAATTCAAACCTGGG + Intergenic
999661900 5:153873411-153873433 CAGAGCTAGAATTTAAACCTAGG - Intergenic
1001511647 5:172327348-172327370 CAGAGCCAGAACTCAAACCCAGG + Intronic
1001649234 5:173303674-173303696 CAGAGATAAAACTCATGCATTGG + Intergenic
1001871320 5:175158402-175158424 CAGAGCCAGAATTCAAACGTGGG - Intergenic
1005419487 6:25634067-25634089 CAGAGTTAGAGCTCAGTCTTGGG - Intergenic
1006804471 6:36779161-36779183 CAGAGCTAGGATTCACACTGGGG - Intronic
1009229416 6:61044081-61044103 CAGGGATAGAACTCTTACTGTGG + Intergenic
1010437097 6:75845060-75845082 AAAAGTTAGAACTCTTACTTGGG - Intronic
1010924187 6:81723432-81723454 CAAAGGAAGAACCCATACTTAGG + Intronic
1011819981 6:91241859-91241881 CAGAGCTAGGATTCAGACCTGGG - Intergenic
1012836859 6:104280431-104280453 CAGAGCCAGAATACATATTTGGG + Intergenic
1013892574 6:115043142-115043164 CAAAGCTATGACTCAGACTTTGG - Intergenic
1014266172 6:119280281-119280303 CAGAGCTAGGCTTCAAACTTGGG - Intronic
1015460395 6:133484858-133484880 CAGTGGTAGAACTCATCTTTTGG + Intronic
1016449732 6:144169700-144169722 CAGAGCAAGACCTCATAGGTAGG - Intronic
1016491115 6:144603985-144604007 CAGAGGTAGAATTCATATTCTGG - Intronic
1017036149 6:150269195-150269217 CACAGCTAGAACTCCAACTTTGG - Intergenic
1017476375 6:154798245-154798267 CAGAACTAGAGATAATACTTTGG + Intronic
1017626850 6:156357820-156357842 CAGAGCTAGGATTCAAACCTAGG - Intergenic
1021909700 7:25372414-25372436 CAGAGCGAGATGTCAGACTTGGG + Intergenic
1022499685 7:30874674-30874696 CAGAGCTAGAACTCATACTTGGG + Intronic
1030044726 7:105484816-105484838 CTGAGATTTAACTCATACTTAGG + Intronic
1030880460 7:114871839-114871861 CTGAGCTGGAACTCAAACTCAGG + Intergenic
1031440234 7:121785744-121785766 CAGTTGTAGAACTCATACATTGG + Intergenic
1031746739 7:125507998-125508020 CAGAGAGAGAAGTCATTCTTTGG - Intergenic
1034940895 7:155229452-155229474 CAGAGCCAGAACTCCAACTAAGG + Intergenic
1035190515 7:157163487-157163509 CACAGCTAGAACTCTGACATTGG + Intronic
1037796939 8:22003608-22003630 CAGAGCTAGAACTAGAACTTAGG - Intronic
1039062964 8:33586446-33586468 AAGAGCTAGGATTTATACTTGGG - Intergenic
1041466738 8:58164946-58164968 AAGAGCCACAACTCAAACTTAGG - Intronic
1042461858 8:69079193-69079215 CAGAACCAGAATTCAGACTTAGG - Intergenic
1042899555 8:73709615-73709637 AAGAGCTAGTACTTAAACTTAGG - Intronic
1043174351 8:77005301-77005323 CAGAGCCAGAATTCAAACTCAGG - Intergenic
1043564482 8:81533175-81533197 CAGAGATAGAAGCCATACATGGG - Intergenic
1044300913 8:90581913-90581935 CAGAGCTGGAATTCAGGCTTAGG - Intergenic
1044350845 8:91164773-91164795 CAGAGCTGAAACTCAAACCTAGG + Intronic
1044417966 8:91957477-91957499 CAGAGATAGAGCTCAGAGTTAGG + Intronic
1044528378 8:93278151-93278173 CAGAGCACCAACTCATTCTTAGG - Intergenic
1044933256 8:97270288-97270310 TAGAGCCAGGACTCAAACTTGGG - Intergenic
1045357165 8:101399524-101399546 GGGAGCTGGAACTCATACCTCGG - Intergenic
1045803798 8:106133130-106133152 CAGAGCAAGAACTCATTACTGGG - Intergenic
1046292670 8:112183274-112183296 CAGAGCAAGAATTAATAGTTGGG - Intergenic
1046316216 8:112505874-112505896 TAGAGCTAGAAATCAAATTTAGG + Intronic
1046829774 8:118731629-118731651 CAGAGCTGGAATTCAAACCTAGG + Intergenic
1046966556 8:120173461-120173483 CACAGCTAGTACCCATATTTTGG - Intronic
1048326204 8:133441366-133441388 CAGAGCTTGAACTTGAACTTGGG + Intergenic
1048550622 8:135430468-135430490 CAGAGCTAGAATTCAAACCTAGG + Intergenic
1048712312 8:137226071-137226093 CAAAGCTTGATCTCACACTTGGG + Intergenic
1050059498 9:1691336-1691358 CAGAGTTAATACTCATATTTTGG + Intergenic
1050804647 9:9658521-9658543 TAAAGCTAGAGTTCATACTTGGG + Intronic
1051982470 9:23039208-23039230 CAGAGTTAGAACTCAAATTAGGG - Intergenic
1052237607 9:26231148-26231170 CAGAGCCAGAACCCACACTTCGG + Intergenic
1053138141 9:35664674-35664696 CAGAGCTTGGAGTCAGACTTAGG - Intronic
1053556936 9:39146835-39146857 CAGACCTAAAAATCCTACTTAGG - Intronic
1054089917 9:60835244-60835266 CAGACCTAAAAATCCTACTTAGG - Intergenic
1054111328 9:61110802-61110824 CAGACCTAAAAATCCTACTTAGG - Intergenic
1054342288 9:63876986-63877008 CAGAGCCAGTCCTCATGCTTGGG - Intergenic
1054609529 9:67220323-67220345 CAGACCTAAAAATCCTACTTAGG + Intergenic
1055071608 9:72172463-72172485 CAGAGCTAGGATTCAAACCTAGG + Intronic
1056069429 9:82970470-82970492 CAGAGCTGGGACTCAAACCTAGG - Intergenic
1056831413 9:89920166-89920188 CAGAGCTGGGATTCATGCTTAGG + Intergenic
1058378917 9:104357485-104357507 CTGTGCTGGAACTCATACTCTGG - Intergenic
1058957528 9:109963023-109963045 CAGAGCTAGGATTCATACTCTGG + Intronic
1058985442 9:110205677-110205699 CAGAGCTGGGACTCAAACTCAGG + Intronic
1059136596 9:111813086-111813108 CAGAACCAGGACTCAGACTTAGG - Intergenic
1059188292 9:112297510-112297532 AAGAGCTAGATCTAAAACTTGGG - Intronic
1059788877 9:117618170-117618192 CAGAGCTAGGATTCATATTCCGG + Intergenic
1059963662 9:119592223-119592245 CAGAGCCAGAATTCAACCTTGGG + Intergenic
1060087935 9:120718257-120718279 TAGAGCTAGAAATCAAACTGAGG + Intergenic
1203451487 Un_GL000219v1:120985-121007 CAGAGCCAGTCCTCATGCTTGGG - Intergenic
1186534328 X:10330746-10330768 CTAAGTTAGAACTCATACTAAGG - Intergenic
1187761588 X:22592535-22592557 TAGAGCTGTAACTCATGCTTTGG - Intergenic
1189086828 X:38034278-38034300 CAGAGCTGGTACTCAAACTTAGG - Intronic
1189178764 X:38983324-38983346 TAGAGATAGAACTCAAACCTAGG - Intergenic
1190869610 X:54414081-54414103 CAGAGCTAGGACTGAAACTCAGG - Intergenic
1190935062 X:54992470-54992492 TAGAGCTGGAACTCAAACCTAGG + Intronic
1192139069 X:68632168-68632190 CAGAGCTAGAGCTCAAATTAAGG - Intergenic
1196798598 X:119522453-119522475 CAGAGCTGGGACTCAAACTCAGG + Intergenic
1196981467 X:121218710-121218732 CAGAGTTAGGACTCAAACTCAGG - Intergenic
1197719493 X:129735488-129735510 CAGAGCTGGGACTCAAACCTGGG - Intergenic
1197759493 X:130017561-130017583 CAGAGCTAGAACTCAGACTCTGG + Intronic
1198229500 X:134675731-134675753 CAGAGTTAGAACTCATGGTGTGG + Intronic
1199295835 X:146157598-146157620 CAGAGCCAGAACTCAAAGTCAGG - Intergenic
1199721032 X:150542906-150542928 CAGAGCTGGAATTCAAACCTAGG + Intergenic
1200042461 X:153379936-153379958 CAGACATAGAACTCAGAGTTTGG - Intergenic
1201038979 Y:9810210-9810232 CAGAGCTCAAAATCAGACTTGGG + Intergenic